ID: 1023836853

View in Genome Browser
Species Human (GRCh38)
Location 7:44073611-44073633
Sequence CCGGAGCAGGTACATTGTTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 58}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023836853_1023836859 -7 Left 1023836853 7:44073611-44073633 CCCCAACAATGTACCTGCTCCGG 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1023836859 7:44073627-44073649 GCTCCGGGTCAAACAGCCCATGG 0: 1
1: 0
2: 1
3: 8
4: 95
1023836853_1023836861 8 Left 1023836853 7:44073611-44073633 CCCCAACAATGTACCTGCTCCGG 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1023836861 7:44073642-44073664 GCCCATGGCTGTTCAGCCACAGG 0: 1
1: 0
2: 1
3: 10
4: 143
1023836853_1023836864 23 Left 1023836853 7:44073611-44073633 CCCCAACAATGTACCTGCTCCGG 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1023836864 7:44073657-44073679 GCCACAGGCCCTTCTCCTTCCGG 0: 1
1: 0
2: 1
3: 23
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023836853 Original CRISPR CCGGAGCAGGTACATTGTTG GGG (reversed) Exonic
901693410 1:10989075-10989097 CAGGCTCACGTACATTGTTGGGG - Intergenic
904297562 1:29531226-29531248 CTGGAGCAGGTGTATTGTTGCGG + Intergenic
906364814 1:45198573-45198595 AATGAGCAGGAACATTGTTGTGG - Intronic
909294923 1:73935328-73935350 AGGGAGCAGGTTCATTATTGAGG + Intergenic
915276344 1:154791346-154791368 CCACATCAGGTACATTCTTGCGG + Intronic
915839885 1:159205264-159205286 CCGGAGCAGGAACAGTCCTGGGG - Exonic
1069712630 10:70499731-70499753 CAGGTGCAGGTTCATTCTTGTGG + Intronic
1077102097 11:827009-827031 CCGGAGCAGGGACAAGGCTGCGG - Intronic
1083417716 11:62536204-62536226 CAGGGGCAGGTGCATTGCTGAGG - Intronic
1094394011 12:29985279-29985301 CAGGAGTAGGTTCATTATTGTGG + Intergenic
1098371317 12:69763254-69763276 AATGAGCAGGAACATTGTTGTGG + Intronic
1098466546 12:70793649-70793671 AATGAGCAGGAACATTGTTGTGG - Intronic
1101033056 12:100678580-100678602 TCAGAGCAGGGACTTTGTTGGGG + Intergenic
1113976354 13:114230746-114230768 CAGCAGCAGGTACCTGGTTGGGG - Intergenic
1114594666 14:23901039-23901061 CTGGAGCAGGGACAGTCTTGTGG + Intergenic
1115922915 14:38396486-38396508 CCTTAGAAGGCACATTGTTGAGG - Intergenic
1118644146 14:67820543-67820565 CCGGAGCACGTAAATTCCTGCGG - Intronic
1120204518 14:81573506-81573528 CCGGAGAAGGTAGAATTTTGTGG + Intergenic
1122309920 14:100787957-100787979 CTGGAGGAGGTGCATTCTTGGGG - Intergenic
1129821234 15:78603453-78603475 CCTGGGCAGGGCCATTGTTGTGG - Intronic
1137365858 16:47858936-47858958 CCCGGGGAGCTACATTGTTGGGG + Intergenic
1142702713 17:1673898-1673920 CCAGACCAGGTACACTGCTGAGG + Intronic
1145184980 17:20786251-20786273 CTAAAGCAGGTAAATTGTTGGGG + Intergenic
1146460853 17:33045105-33045127 CCTCAGCTGGTACAGTGTTGGGG - Intronic
1148548276 17:48533104-48533126 CCGAAGCAGGCAGATCGTTGAGG - Intergenic
1152106097 17:78329935-78329957 CCGGAGAAGGTGCATGGCTGGGG - Intergenic
1155338756 18:24792985-24793007 TAGGAGCTGGTAAATTGTTGAGG - Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1161000415 19:1907922-1907944 CCGGAACAGGCACAGTGTTCAGG - Intronic
1163771245 19:19192517-19192539 CCGCAGAAGGGACCTTGTTGTGG + Exonic
1165585424 19:36911183-36911205 CTGAAGCAGGTACAGTCTTGTGG + Intronic
1165728826 19:38131159-38131181 AGGGAGCAGGCACTTTGTTGTGG - Intronic
932327432 2:70872363-70872385 ACGGAGCAGTTACTTTGATGAGG - Intergenic
941620003 2:167766717-167766739 AATGAGCAGGTACATTGTTGTGG + Intergenic
941634327 2:167919182-167919204 AATGAGCAGGAACATTGTTGTGG - Intergenic
944436050 2:199690745-199690767 CCGAAGCAGGAACATTGTAGAGG + Intergenic
948229870 2:236341978-236342000 CGGGCGCAGGGACACTGTTGCGG - Intronic
1170412106 20:16103102-16103124 CCCCAGCAGGTACATGGGTGAGG + Intergenic
1176058292 20:63160516-63160538 CCTGAGCAGCTCCACTGTTGGGG + Intergenic
949434535 3:4014031-4014053 CATGAGCAGGAGCATTGTTGTGG + Intronic
953116018 3:39993221-39993243 CAGGAGCAGGCTCATTATTGTGG - Intronic
953580238 3:44147241-44147263 CCTGAGCATGGACTTTGTTGGGG - Intergenic
972343488 4:38173174-38173196 TCGGAGCAGGGAATTTGTTGGGG - Intergenic
974880827 4:67755361-67755383 CCAAAGCAGGTACAATGTTAAGG + Intergenic
976235677 4:82894038-82894060 GATGAGCAGGAACATTGTTGTGG + Intronic
977732990 4:100377971-100377993 AAGGAGCAGGAGCATTGTTGTGG - Intergenic
992200628 5:74380471-74380493 CCAGGGCAGGTACATTCTAGGGG + Intergenic
994267215 5:97732214-97732236 CCGGAGCAGTTAACTTGATGAGG + Intergenic
997276105 5:132592491-132592513 AATGAGCAGGAACATTGTTGTGG + Intronic
997766081 5:136504913-136504935 CAAGAGCAGGTACATAATTGGGG - Intergenic
1003661730 6:8068531-8068553 CCGGAGCAGTTACTTTCTAGTGG - Intronic
1004272953 6:14211379-14211401 CCGGAGCAGGGAAACTTTTGCGG - Intergenic
1013161257 6:107547569-107547591 CCTGAAAAGGTATATTGTTGAGG + Intronic
1014491597 6:122068687-122068709 CTGGAGCATGTCCATTTTTGAGG + Intergenic
1023836853 7:44073611-44073633 CCGGAGCAGGTACATTGTTGGGG - Exonic
1029548022 7:101221554-101221576 CGGGAGCAGGTTCTGTGTTGAGG + Intronic
1034449093 7:151127915-151127937 CCGGGGCAGGCTCCTTGTTGTGG + Intronic
1039090158 8:33819442-33819464 CAGGAGTAGGTTCATTATTGTGG - Intergenic
1048144662 8:131829707-131829729 GCTCAGCAGGTACATTGTTTTGG - Intergenic
1056037835 9:82627664-82627686 ACATAGCAGGCACATTGTTGGGG - Intergenic
1187301187 X:18051583-18051605 CAATGGCAGGTACATTGTTGTGG + Intergenic
1192397694 X:70799396-70799418 AATGAGCAGGAACATTGTTGTGG + Intronic