ID: 1023837240

View in Genome Browser
Species Human (GRCh38)
Location 7:44075486-44075508
Sequence CACTGCCCAGTTCAGCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 155}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023837240_1023837249 8 Left 1023837240 7:44075486-44075508 CCTGTCAGCTGAACTGGGCAGTG 0: 1
1: 0
2: 1
3: 14
4: 155
Right 1023837249 7:44075517-44075539 GAAGATGTGCGAAGAGGCAGTGG No data
1023837240_1023837248 2 Left 1023837240 7:44075486-44075508 CCTGTCAGCTGAACTGGGCAGTG 0: 1
1: 0
2: 1
3: 14
4: 155
Right 1023837248 7:44075511-44075533 CCGGGGGAAGATGTGCGAAGAGG No data
1023837240_1023837252 28 Left 1023837240 7:44075486-44075508 CCTGTCAGCTGAACTGGGCAGTG 0: 1
1: 0
2: 1
3: 14
4: 155
Right 1023837252 7:44075537-44075559 TGGAGCTGGCAGTGCCTGCTGGG 0: 1
1: 0
2: 3
3: 40
4: 339
1023837240_1023837250 14 Left 1023837240 7:44075486-44075508 CCTGTCAGCTGAACTGGGCAGTG 0: 1
1: 0
2: 1
3: 14
4: 155
Right 1023837250 7:44075523-44075545 GTGCGAAGAGGCAGTGGAGCTGG No data
1023837240_1023837251 27 Left 1023837240 7:44075486-44075508 CCTGTCAGCTGAACTGGGCAGTG 0: 1
1: 0
2: 1
3: 14
4: 155
Right 1023837251 7:44075536-44075558 GTGGAGCTGGCAGTGCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023837240 Original CRISPR CACTGCCCAGTTCAGCTGAC AGG (reversed) Intronic
901381761 1:8878958-8878980 CACACCCCAGTTCGGCTCACCGG - Intronic
902734464 1:18391080-18391102 CACTGCCCACTTCAGCATGCTGG + Intergenic
903359102 1:22765860-22765882 CACTGGCCAGTTCTGCTCCCTGG + Intronic
903488820 1:23712071-23712093 CCCTTCCCAATGCAGCTGACTGG - Intergenic
906913658 1:49983526-49983548 CACTGGCCACTTCACCTGGCAGG - Intronic
911073169 1:93847849-93847871 CAGGGCCCAGCTCAGCCGACTGG + Intergenic
916212257 1:162368398-162368420 CACTGCCCAGTGGAGGGGACAGG - Exonic
920227595 1:204449763-204449785 CACTGGCCAGTGCAGCAGCCAGG + Intronic
920448059 1:206035144-206035166 CACTGCCTGGCTCAGCTCACAGG - Intergenic
923129269 1:231061074-231061096 CACTGCACAGTTCTGCTGTCTGG + Intergenic
1062781191 10:209930-209952 CACAGCTAAGCTCAGCTGACGGG - Exonic
1065593338 10:27287876-27287898 CACTGCCCAGTTGAACTTACTGG + Intergenic
1065657037 10:27962411-27962433 CACTGCCCAGTTGAACTTACTGG - Intronic
1065815943 10:29482624-29482646 CACTGGCCAGGGCAGCAGACAGG + Intronic
1066125373 10:32336483-32336505 TACTGCCCAAGTGAGCTGACTGG + Intronic
1067052244 10:43028416-43028438 CACTGCCTAGTTCAAGTCACAGG + Intergenic
1067554134 10:47255958-47255980 CACAGCCCAGGTCAGCTGGAGGG + Intergenic
1068309879 10:55263466-55263488 CCCTTCCCAGTTCAGGTGCCTGG + Intronic
1068813949 10:61288534-61288556 CAGTGTCCAGTTCAACTAACTGG + Intergenic
1069834646 10:71300990-71301012 CCCTGCCCTGTGCAGCTGCCTGG + Exonic
1070897374 10:79996295-79996317 CACTTCTGAGCTCAGCTGACAGG - Intergenic
1072231207 10:93415296-93415318 CCCAGCCAAGTTCAGCTGGCTGG - Intronic
1072532486 10:96332482-96332504 CAGTGACCAGTCCAGCTGGCAGG + Exonic
1076175235 10:128363133-128363155 GACTGCCCAGTGCAGCTGGCAGG + Intergenic
1077474650 11:2780588-2780610 CACTGCACAGCCCAGCTGAGGGG - Intronic
1077489844 11:2855731-2855753 CACTGCCCAGTTCAGGGAGCAGG + Intergenic
1078545774 11:12245973-12245995 CCCAGCCCACTCCAGCTGACTGG + Intronic
1080153402 11:29078892-29078914 CACTGCCCAGTGAAGCTGTGAGG + Intergenic
1082569973 11:54727024-54727046 CACTGCCTTATTCAGCTAACAGG + Intergenic
1086245862 11:84752071-84752093 CACTGCCCAGTTCAGTGAAAAGG + Intronic
1088812239 11:113399657-113399679 CACTGCACACTGCAGCTGCCAGG + Exonic
1089035496 11:115385762-115385784 GACTGCCCAGACCAGCTAACTGG + Intronic
1089376716 11:117999856-117999878 CACTGACCTGTTCTGTTGACTGG + Exonic
1091290374 11:134436127-134436149 CACTCCCCAGTGCAGCAGTCAGG + Intergenic
1091553094 12:1551767-1551789 GAATGCCCACTTTAGCTGACTGG + Intronic
1094637542 12:32240995-32241017 CACTGCCCTCCTCTGCTGACTGG - Intronic
1096071846 12:48779951-48779973 CCCTTCCCAGTCCAGCTCACAGG + Intronic
1099443825 12:82728872-82728894 CACTGCCCAGTGCAGCGGGCTGG - Intronic
1101846223 12:108365244-108365266 CACTGCAGAGTTCACCTGAATGG + Intergenic
1102083794 12:110119599-110119621 CATTGCCTAGGTCAGGTGACAGG - Intergenic
1103368151 12:120398159-120398181 CCCTGCCCAGTTCCCCTGATAGG - Intergenic
1104590431 12:130080384-130080406 CTCTGCACCTTTCAGCTGACTGG + Intergenic
1105215114 13:18279651-18279673 GACTGAGCAGTTCAGCTGAATGG + Intergenic
1105912472 13:24883299-24883321 TACTGCCCAGTTCAAGAGACGGG - Exonic
1113692294 13:112319510-112319532 CCCTGCCAAGTTCAGCTCACAGG - Intergenic
1122557771 14:102591019-102591041 CCCTGCCCAGGCCAGCTGACAGG + Intergenic
1122880311 14:104687902-104687924 CACTGCCCAGCACCGCTGCCAGG + Intergenic
1122945833 14:105008519-105008541 CAGTGCCAAGTTTAGATGACTGG + Intronic
1123030300 14:105448358-105448380 CAGAGCCCTGTTCTGCTGACCGG + Intronic
1124995112 15:34716275-34716297 CTCTGCCCTGTCCAGCTGCCAGG + Intergenic
1127821996 15:62666454-62666476 CACTGGCAGGTTCAGCTGTCTGG - Intronic
1130900360 15:88202379-88202401 CACTGCACAGAGCAGCTGGCTGG - Intronic
1131325122 15:91435911-91435933 GCCTGCCCTGCTCAGCTGACTGG + Intergenic
1137349073 16:47694771-47694793 CACTGCCCAGGTAGGCAGACAGG - Intronic
1138421309 16:56901068-56901090 CACTGTCAAGTGCAGCTGAAAGG - Intronic
1140485339 16:75288917-75288939 CACTGCCCAGTTCTGAAGTCAGG + Intergenic
1140830930 16:78750216-78750238 CACTGCCCAGGTCAGCTGGTGGG + Intronic
1141529276 16:84634961-84634983 CCCTGCCCACTGCCGCTGACCGG - Intergenic
1141926208 16:87171272-87171294 CAAAGCCCAGTTCAGGTGAGTGG - Intronic
1141955777 16:87370506-87370528 CACTGCAGAGTTCAGCTGGTAGG + Intronic
1142614613 17:1127149-1127171 CAATGCCCCATTCAGCTGCCAGG + Intronic
1145991010 17:29079513-29079535 CACCAGCGAGTTCAGCTGACAGG + Intronic
1146546500 17:33743329-33743351 CACTACCCAGTTCAGCTTGATGG + Intronic
1148049116 17:44760458-44760480 CACTGTCCCTTTCAGCTGCCAGG + Intronic
1148218855 17:45848803-45848825 CACTGCCCAGGCCACCTCACAGG + Intergenic
1148457428 17:47818509-47818531 CACTGCCCAGTACTGCTCACCGG - Exonic
1150640799 17:66948258-66948280 AGCTGCCCAGTTCAGCTGTTGGG + Intergenic
1151735376 17:75936796-75936818 CACAGCCCAGTGCAGCTCGCTGG + Intronic
1152118464 17:78403494-78403516 CTCTGCCCAGCTCAGGGGACAGG - Intronic
1152316938 17:79586404-79586426 CATGGCCCAGTTCAGCAGAAGGG + Intergenic
1152577300 17:81148472-81148494 CACAGCCCAGGCCAGCTCACAGG + Intronic
1153276647 18:3374189-3374211 CACTGCCCAGCTGAGCTGTTGGG - Intergenic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1160144436 18:76352071-76352093 CACTGCCAAGCTCAGCTCAGTGG + Intergenic
1160267903 18:77356451-77356473 CAATGCCCAGTTCAGCTCTGGGG - Intergenic
1161508537 19:4657592-4657614 CTCTTCCCAGTTCATCTGAAAGG + Exonic
1166130775 19:40744420-40744442 CACTGCCCAGTAGAGCAGAGAGG - Intronic
1167000322 19:46741907-46741929 CCCTGCCCACTTCAGCTTCCTGG - Intronic
931371332 2:61666171-61666193 GACTGACCTGTTCAGCTAACAGG - Intergenic
931419635 2:62114708-62114730 CACTGGCCAGTGCAGCAGAGTGG - Intronic
931643423 2:64400972-64400994 CCCTGCCCAGATCAGGTGGCCGG - Intergenic
933713811 2:85345735-85345757 CCCTGCCCCTTTCAGCTGAGTGG + Intronic
934299205 2:91767086-91767108 GACTGAGCAGTTCAGCTGAATGG - Intergenic
936505126 2:113099643-113099665 CACTGCTCTGTTCATCTGAGTGG + Intergenic
937083720 2:119157675-119157697 CACGGGCAAGTTCAGCTGCCAGG - Exonic
946000696 2:216479705-216479727 AACTCTCCAGTTCAGCTGAATGG + Intronic
946278224 2:218646657-218646679 CACTGCCAAGCTCGGCTGCCCGG + Intronic
947689346 2:232120504-232120526 CAGTGCCAAGTGCAGGTGACGGG + Intronic
948067709 2:235093574-235093596 CATGACCCAGTTCAGATGACTGG - Intergenic
1169773252 20:9224322-9224344 GACTGTCCAGTCCAGCTTACTGG - Intronic
1170083205 20:12499629-12499651 CACTGGCAAGTACAGATGACGGG - Intergenic
1170279920 20:14634583-14634605 CTCTGAACAGTTCTGCTGACAGG - Intronic
1171784986 20:29455545-29455567 CACTGCCCAGTGGATTTGACGGG - Intergenic
1172102321 20:32492673-32492695 CACTGCCCAGCACAGGTGCCTGG - Intronic
1172151304 20:32792486-32792508 CACAGCCCAGGACAGCTGTCTGG + Intronic
1174368027 20:50068175-50068197 CACTGCCCTCTACAGCTTACAGG - Intergenic
1175034646 20:55988567-55988589 CAGTGCCCAGTGCAACTGAAAGG - Intergenic
1175826228 20:61937967-61937989 AACTGCCCTCTTCAGCTGCCAGG - Exonic
1178701844 21:34840634-34840656 CACTGCCAAGTCTAGCTGTCAGG + Intronic
1180903811 22:19394398-19394420 CACTGCCCAGATCATCGAACGGG - Exonic
1181496194 22:23288689-23288711 CACTGCCCTGTTCATATGGCCGG + Intronic
1182827648 22:33279511-33279533 AACTGGCCAGTGCAGCTGAATGG + Intronic
1183433902 22:37782322-37782344 CACTGCCCAGTACAGAGCACTGG + Intergenic
1184800273 22:46754743-46754765 CACTGTCCAGTTCACCTTGCCGG - Intergenic
950347653 3:12312596-12312618 CACTGCATAGTCCAACTGACTGG - Intronic
953241814 3:41156087-41156109 CAGTGCCCAGACCAGCTGCCGGG - Intergenic
954104365 3:48401707-48401729 AACTACCTAGGTCAGCTGACTGG - Intergenic
960519843 3:118641958-118641980 AACTGACCATTACAGCTGACTGG + Intergenic
961467963 3:127092812-127092834 CACTGCCCAATGCAGCAGACGGG + Intergenic
962764434 3:138548721-138548743 CACTGCTCTGTTCATCTGAGTGG - Intronic
963606106 3:147412805-147412827 CTCTGCCCAGTTCCACTGAGTGG - Intronic
963725454 3:148915559-148915581 CACTGCTTAGTTCAGTTGACAGG + Intergenic
968088631 3:195886035-195886057 CACTGCCCAGCTCACCTCCCGGG - Intronic
969476848 4:7426880-7426902 CAATGCCCAGTTGTGCTGAGCGG + Intronic
969915969 4:10492093-10492115 CCCTGCCCTGTTCACCTCACAGG - Intronic
971857584 4:32062368-32062390 CACTGCCCAGTTCTGCCCACTGG + Intergenic
973636368 4:52864973-52864995 AACTGCCCAGTTCAGGAGGCGGG - Intronic
980426196 4:132630643-132630665 CACTGCCTAGTGCAGCTGTGAGG + Intergenic
981568948 4:146131539-146131561 CACTGCCCATTTCCTCTGCCTGG + Intergenic
982169160 4:152644428-152644450 CACTTCCCAGTTCATCTAAAAGG + Exonic
991632614 5:68671488-68671510 CACAGCCCAGCTCAGGTTACCGG - Intergenic
992756515 5:79911613-79911635 CACTGCTCTGTTGAGCTGTCAGG - Intergenic
993227368 5:85184336-85184358 CACTGCCAACTTGGGCTGACAGG + Intergenic
994049610 5:95347673-95347695 TACTGCCCAGTTCAGCACAGTGG - Intergenic
998529447 5:142871324-142871346 CACTGCCAAGGGCAGCTGCCAGG - Intronic
1003534308 6:6962866-6962888 CACTGGCCAGTACAGCTGACAGG + Intergenic
1005008347 6:21312292-21312314 CACTGCCAAGGTCAGCGGAAAGG - Intergenic
1005528249 6:26673895-26673917 CATTGCACAGTTCAGCTCTCAGG - Intergenic
1005531028 6:26705923-26705945 CATTGCGCAGTTCAGCTCTCAGG - Intergenic
1005539768 6:26795713-26795735 CATTGCGCAGTTCAGCTCTCAGG + Intergenic
1005542546 6:26827744-26827766 CATTGCACAGTTCAGCTCTCAGG + Intergenic
1006355882 6:33557516-33557538 AACTGAGCAGTTCCGCTGACTGG - Intergenic
1007267700 6:40609781-40609803 CACTGACCAGCTCAGATGCCAGG - Intergenic
1007790180 6:44304262-44304284 CAGTGCCCAGTTCAGCAGGTGGG + Exonic
1009010587 6:57837854-57837876 CATTGCGCAGTTCAGCTCTCAGG + Intergenic
1009013357 6:57869862-57869884 CATTGCACAGTTCAGCTCTCAGG + Intergenic
1009926232 6:70124576-70124598 CACTGACCAGAGCAGCTGAGTGG + Intronic
1013599244 6:111688905-111688927 GACTGCCCAGATCCACTGACTGG + Intronic
1013717222 6:112976283-112976305 CACTGCCTAGTGCAGCTGTGAGG + Intergenic
1015598993 6:134894215-134894237 CTCTGCTCAGCTTAGCTGACTGG - Intergenic
1015685252 6:135851695-135851717 CAGTGCCCAGACCAACTGACTGG - Exonic
1019479522 7:1260116-1260138 CACAGCCCAGCCCTGCTGACCGG - Intergenic
1021031475 7:15742382-15742404 AAGTCCCCAGTTGAGCTGACTGG + Intergenic
1022355793 7:29613277-29613299 CACTGACCCATTCAGCTGCCTGG - Intergenic
1023140628 7:37098564-37098586 CACTGCCCAGCTCACCTCAGTGG - Intronic
1023837240 7:44075486-44075508 CACTGCCCAGTTCAGCTGACAGG - Intronic
1024518767 7:50284484-50284506 CACTGATCTGTTCAGCGGACAGG - Intergenic
1031847532 7:126824468-126824490 CACTGCCCATTCCTGTTGACTGG + Intronic
1032415360 7:131731552-131731574 CAGTGCCCAATGCTGCTGACAGG - Intergenic
1032991074 7:137395649-137395671 CACAGCCCGGTTCCGCTGGCAGG + Exonic
1034165542 7:149022482-149022504 CTGTGCCCAGTTCAGTTTACTGG - Intronic
1034224758 7:149473908-149473930 CTCTGCCCAGTTGGGCTGAGTGG - Exonic
1035796502 8:2362252-2362274 CTCTTCCCAGTGCAGCTGATGGG - Intergenic
1037315638 8:17596282-17596304 CACTGGCCAGATCGGCTGCCAGG + Intronic
1039228515 8:35417393-35417415 CACTGCCCAGTGAATCTGAGAGG - Intronic
1039520980 8:38171417-38171439 AACTGCCCAGCTCAGCTGGGTGG + Intronic
1048951302 8:139499076-139499098 CCCTGCCCAGTGAAGCTGACTGG + Intergenic
1049510280 8:143023866-143023888 CACTTCCCAGGTGAGCTGACTGG + Intergenic
1050498663 9:6271090-6271112 CACTGCCAATCTCATCTGACCGG + Intergenic
1051735045 9:20189371-20189393 CACTACCCAGTTATGATGACTGG - Intergenic
1053427293 9:38018782-38018804 CACTGCCCAGTCCTGATGGCTGG - Intronic
1057238988 9:93392062-93392084 CAGTGGCCAGTTCAGGTAACTGG + Intergenic
1058190967 9:101915138-101915160 CAGTGCCCAGAGCTGCTGACTGG - Intergenic
1060431021 9:123551661-123551683 CACTGCCAAGTTCACCTCAGTGG - Intronic
1061923362 9:133794336-133794358 CGCTGCCCAGTGCAGCCGAGCGG + Intronic
1203445781 Un_GL000219v1:54700-54722 CACTGCCCAGTGGATTTGACAGG - Intergenic
1187459520 X:19474179-19474201 TACTATCCAGTTCAGCTGAGAGG - Intronic
1189176532 X:38963301-38963323 CACTGCCTAGTGCAGCTGCGAGG - Intergenic
1193216927 X:78875091-78875113 CACTGGCCAGTGCAGCAGGCTGG + Intergenic
1199540555 X:148953503-148953525 AACAGCCCAGTTCAGGTGAAGGG - Intronic
1202194268 Y:22280884-22280906 CACTGCCCAGTAGAGCAGAAAGG - Intergenic