ID: 1023842521

View in Genome Browser
Species Human (GRCh38)
Location 7:44105114-44105136
Sequence CAAAAGCGGCCCTGCCGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 85}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023842521_1023842535 16 Left 1023842521 7:44105114-44105136 CCCGGGCGGCAGGGCCGCTTTTG 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1023842535 7:44105153-44105175 GGGTTGGTGCTGTGGTTGTACGG No data
1023842521_1023842532 0 Left 1023842521 7:44105114-44105136 CCCGGGCGGCAGGGCCGCTTTTG 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1023842532 7:44105137-44105159 GGGGCCGGTGGCTCTAGGGTTGG No data
1023842521_1023842531 -4 Left 1023842521 7:44105114-44105136 CCCGGGCGGCAGGGCCGCTTTTG 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1023842531 7:44105133-44105155 TTTGGGGGCCGGTGGCTCTAGGG 0: 1
1: 0
2: 0
3: 9
4: 119
1023842521_1023842534 8 Left 1023842521 7:44105114-44105136 CCCGGGCGGCAGGGCCGCTTTTG 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1023842534 7:44105145-44105167 TGGCTCTAGGGTTGGTGCTGTGG No data
1023842521_1023842536 17 Left 1023842521 7:44105114-44105136 CCCGGGCGGCAGGGCCGCTTTTG 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1023842536 7:44105154-44105176 GGTTGGTGCTGTGGTTGTACGGG No data
1023842521_1023842530 -5 Left 1023842521 7:44105114-44105136 CCCGGGCGGCAGGGCCGCTTTTG 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1023842530 7:44105132-44105154 TTTTGGGGGCCGGTGGCTCTAGG 0: 1
1: 0
2: 2
3: 15
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023842521 Original CRISPR CAAAAGCGGCCCTGCCGCCC GGG (reversed) Intronic
902921001 1:19665794-19665816 CGACGGCGGCCCTGCCCCCCAGG - Exonic
912514735 1:110210634-110210656 CCAGAGCGGCCCCGCCCCCCAGG + Intergenic
915634794 1:157178493-157178515 CAGAAGCGGCCCCACCTCCCTGG - Intergenic
917409434 1:174742680-174742702 CAAAAGCACCCCTGCAGCCTGGG + Intronic
917861556 1:179149996-179150018 CTAAAGCAGCCCTCCCACCCTGG - Intronic
920080801 1:203371599-203371621 CAAAAACAGCCCTGTGGCCCAGG - Intergenic
1065214740 10:23439051-23439073 CAACCGCGGCCCCGCCTCCCGGG + Intergenic
1076474742 10:130744122-130744144 CAAGGGTGGCCCTGCGGCCCCGG - Intergenic
1077676143 11:4194266-4194288 CCAAAGCTGCCCTCCTGCCCAGG + Intergenic
1081075421 11:38667508-38667530 CAAAAGCGCTCGTGCCGACCCGG - Intergenic
1084188242 11:67486650-67486672 CAAAAAAGTCCCTGCCCCCCTGG - Intronic
1085461767 11:76698334-76698356 CAAGGGAGGCTCTGCCGCCCAGG - Intergenic
1086931447 11:92697636-92697658 CAAAGGCTGCCCTACCACCCTGG - Intronic
1088547663 11:110976750-110976772 CAAAACCTGCTCTGTCGCCCAGG + Intergenic
1091494971 12:964602-964624 CAATAGCGGCTCTGCTGCCCAGG + Intronic
1102434765 12:112912605-112912627 CAAAAGCAGCACTGCCCCCAGGG + Intronic
1102550884 12:113691521-113691543 CAAAATCGACCCTACCTCCCTGG + Intergenic
1108323127 13:49305690-49305712 CAAAAGAGGACCTGCCTCACAGG - Intergenic
1108492908 13:50999167-50999189 CAAAAGAGGCCATGCCGTGCAGG + Intergenic
1119432873 14:74579666-74579688 CAAGAGCTGCCCTGGTGCCCTGG + Intronic
1121139748 14:91531032-91531054 CAAAGGAGGCCATGCCTCCCGGG + Intergenic
1121602320 14:95214583-95214605 CTCAAGCGACCCTGCCGCCATGG + Intronic
1122627382 14:103091438-103091460 CAAAAGCTGCCCTGCTGGACGGG - Intergenic
1122779111 14:104136235-104136257 CGACAGCGCCCCTTCCGCCCCGG - Intergenic
1123034762 14:105467389-105467411 CCAAACCGGCCCTGCTGCCCTGG - Intronic
1125479295 15:40069484-40069506 GACAAGCGGCCCTGCCACACTGG - Intergenic
1132179088 15:99738198-99738220 CACAAGCAGACATGCCGCCCAGG + Intergenic
1132564216 16:613406-613428 CAAGAGCAGGACTGCCGCCCTGG + Intronic
1135589153 16:23692712-23692734 CAAAATCAGCTCTGCCACCCTGG - Intronic
1137718010 16:50610832-50610854 CAAAAGGAGCTCTGCAGCCCTGG - Intronic
1138607581 16:58098793-58098815 CAGATGCGGCCCTGCCCTCCCGG + Intergenic
1143099751 17:4498721-4498743 CAGGAGGGGCTCTGCCGCCCGGG + Intergenic
1145886303 17:28384654-28384676 CAAAAGCGACCCTGGCGCCGCGG - Intronic
1153226396 18:2903213-2903235 CAGAAGCTGGCCTGCCTCCCAGG - Intronic
1157333437 18:46720234-46720256 GCTAAGCGGCCCTGCCTCCCAGG - Intronic
1159689327 18:71466400-71466422 CAAAAGCGGCACTGAGGCCCTGG - Intergenic
1160564614 18:79779510-79779532 CAGCAGCCGCCCTGCCGGCCTGG + Intergenic
1160738739 19:676431-676453 CCAGAGTGGCCCTGGCGCCCCGG - Exonic
1161726507 19:5932424-5932446 AAACAGCAGCCCTGGCGCCCAGG - Intronic
1165993342 19:39828099-39828121 CAAAATGGGCCCTGCCCCTCAGG + Intronic
1167127089 19:47557185-47557207 CAAATGCTGCCCTGCCGTCTGGG + Intergenic
1167376455 19:49114664-49114686 CACCAGCGGCCCTGCGGCCCCGG - Intronic
933680481 2:85095487-85095509 CAAAAGCGACCCTCCCGCCTTGG + Intergenic
937203953 2:120223859-120223881 CAAGAGCGCCGCTGCCGCCTGGG - Intergenic
937928653 2:127187934-127187956 CAGAACCAGCCCTGCCTCCCAGG + Intronic
937928784 2:127188697-127188719 CAGAACCAGCCCTGCCTCCCAGG + Intronic
948407965 2:237736985-237737007 CCAGAGCGGCCCCGGCGCCCAGG + Intronic
1171454002 20:25256612-25256634 CTAAGGAGGCCCTGCCGCCTGGG - Intronic
1173688284 20:44939308-44939330 CAAAATCTGCCTTGCCTCCCAGG + Exonic
1173749881 20:45468833-45468855 CAAAAGGGGCCCTCCAGCACTGG - Intergenic
1178301400 21:31456375-31456397 CAGTAGCCTCCCTGCCGCCCTGG + Intronic
1178513873 21:33230059-33230081 CAAAAGCGGCCCGTGCGGCCGGG - Exonic
1181151841 22:20889624-20889646 CAAAAGCTGCTCTGCATCCCGGG - Exonic
1182955558 22:34422140-34422162 TAAAAGCAGCCCTGCATCCCTGG + Intergenic
1184877225 22:47283424-47283446 CAAAAGCGGCCCCTGCCCCCTGG + Intergenic
1185057346 22:48587899-48587921 CAGAAGCAGCCCTCCCTCCCAGG + Intronic
953055545 3:39384341-39384363 CAATAGCGGCCCGGCGGCCCGGG - Intronic
954809673 3:53240288-53240310 CACAAGCGGCCCCGAGGCCCTGG + Exonic
958893960 3:99809774-99809796 CACAAGCTGCCCTGCCACTCAGG - Intergenic
967912869 3:194556458-194556480 CAGGAGGGGCCCTGCAGCCCAGG - Intergenic
969259305 4:6023483-6023505 CAGAAGGGGCCCTGCCAGCCAGG - Intergenic
969375670 4:6761772-6761794 CAAAGGCGGCTCTGTCCCCCAGG + Intergenic
969511315 4:7619603-7619625 GAGAAGCGGCCCTGCCTCCTTGG + Intronic
985203151 4:187505392-187505414 CCACAGCGGCCTTCCCGCCCGGG + Intergenic
1002294804 5:178224329-178224351 CAAACGAGGCCCTGCCCTCCAGG - Intronic
1003179432 6:3779549-3779571 CCAAATCAGCCCTGGCGCCCTGG - Intergenic
1004312186 6:14555351-14555373 CACAGGAGGCCCTGCTGCCCCGG - Intergenic
1009641608 6:66344478-66344500 CAAAAGCAGCCCTGCCTTCATGG + Intergenic
1015519339 6:134115106-134115128 CAACAGGGGCCCTGCCGCGGTGG + Intergenic
1019335392 7:480321-480343 GAACAGCGCCCCTGCCCCCCAGG - Intergenic
1020086515 7:5313439-5313461 CTAAAGAGGCCCTGCTGCTCCGG - Exonic
1023842521 7:44105114-44105136 CAAAAGCGGCCCTGCCGCCCGGG - Intronic
1025207799 7:57003699-57003721 CTAAAGAGGCCCTGCTGCTCCGG + Intergenic
1025664139 7:63573173-63573195 CTAAAGAGGCCCTGCTGCTCTGG - Intergenic
1025932509 7:66007590-66007612 AAAAAGCGGAGCTGCCGACCTGG - Intergenic
1030018091 7:105244616-105244638 CAAAGGCGGCCCTGGCGCGCTGG - Intronic
1037113458 8:15194716-15194738 CAAAGGCGGCCTTGGCTCCCTGG - Intronic
1037819913 8:22130585-22130607 CTAGAGCGCCCCCGCCGCCCCGG - Exonic
1038740307 8:30211373-30211395 GAAAAGTGGCCCTGCTGCCGGGG + Intergenic
1039790511 8:40872308-40872330 CAAAAGCTGCCCAGCCCTCCAGG + Intronic
1041108817 8:54466994-54467016 CAGAAGAGGCCCCGCGGCCCGGG + Intergenic
1042040107 8:64580999-64581021 CAACAGCAGCCCTGCCCCCTCGG - Exonic
1045293109 8:100850605-100850627 CAAAAGCTCCCCTGCTCCCCTGG - Intergenic
1049220182 8:141425493-141425515 CAACAGGGCCCCAGCCGCCCAGG - Intronic
1049389716 8:142361455-142361477 AAGAAGCGGCGCTGCCTCCCAGG + Intronic
1055044686 9:71911603-71911625 CAAACGCAGCCTTTCCGCCCCGG - Exonic
1056702863 9:88925289-88925311 CAAAAGCGGGCCTCCGCCCCTGG + Intergenic
1057280943 9:93711157-93711179 CAGAAGTGGCCCTGCCTCACTGG - Intergenic
1057624897 9:96668284-96668306 CAAAACCAGTCCTGCTGCCCTGG + Intergenic
1060978783 9:127780608-127780630 CAGAAACTGCCCTGGCGCCCGGG - Intergenic
1062242603 9:135548299-135548321 CACTGGCTGCCCTGCCGCCCTGG - Intronic
1186226308 X:7402500-7402522 CAGCAGCAGCCCTGCCCCCCAGG - Intergenic
1187169210 X:16834937-16834959 CACAAGCGATCCTGCCGCCTCGG - Intronic
1189316135 X:40057923-40057945 CAACAGAGGCACTGCCGCCCAGG - Intronic
1200113939 X:153761424-153761446 CTCAAGCGGCCCTCCCGCCTTGG - Intergenic