ID: 1023842957

View in Genome Browser
Species Human (GRCh38)
Location 7:44107068-44107090
Sequence GCCCTCTCCCTACCCAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 175}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023842957_1023842959 -8 Left 1023842957 7:44107068-44107090 CCTCTTTTGGGTAGGGAGAGGGC 0: 1
1: 0
2: 0
3: 11
4: 175
Right 1023842959 7:44107083-44107105 GAGAGGGCTTGGCAGCCTTTTGG 0: 1
1: 0
2: 0
3: 12
4: 225
1023842957_1023842961 -4 Left 1023842957 7:44107068-44107090 CCTCTTTTGGGTAGGGAGAGGGC 0: 1
1: 0
2: 0
3: 11
4: 175
Right 1023842961 7:44107087-44107109 GGGCTTGGCAGCCTTTTGGGTGG 0: 1
1: 0
2: 0
3: 19
4: 195
1023842957_1023842964 13 Left 1023842957 7:44107068-44107090 CCTCTTTTGGGTAGGGAGAGGGC 0: 1
1: 0
2: 0
3: 11
4: 175
Right 1023842964 7:44107104-44107126 GGGTGGGACCTCTGTCCCTCAGG 0: 1
1: 0
2: 3
3: 14
4: 184
1023842957_1023842960 -7 Left 1023842957 7:44107068-44107090 CCTCTTTTGGGTAGGGAGAGGGC 0: 1
1: 0
2: 0
3: 11
4: 175
Right 1023842960 7:44107084-44107106 AGAGGGCTTGGCAGCCTTTTGGG 0: 1
1: 0
2: 4
3: 12
4: 187
1023842957_1023842962 -3 Left 1023842957 7:44107068-44107090 CCTCTTTTGGGTAGGGAGAGGGC 0: 1
1: 0
2: 0
3: 11
4: 175
Right 1023842962 7:44107088-44107110 GGCTTGGCAGCCTTTTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023842957 Original CRISPR GCCCTCTCCCTACCCAAAAG AGG (reversed) Intronic
900641257 1:3689088-3689110 GCCCGCCCCCAACCCAAGAGGGG + Intronic
900669676 1:3843278-3843300 GCCCTTTAGCTCCCCAAAAGTGG + Intronic
901763029 1:11482834-11482856 GCCCTCCCCCTACCCAAGCATGG + Intronic
903026135 1:20430923-20430945 GCCCTCTCCCAGCTGAAAAGGGG + Intergenic
908022764 1:59915357-59915379 GCCCCCTTCATACCTAAAAGTGG + Intronic
912941969 1:114053194-114053216 CCACTCTCCCAACCCCAAAGAGG - Intergenic
916419774 1:164626070-164626092 GCCTTCTCCCCACCCAAAACTGG - Intronic
920899888 1:210098231-210098253 GCACTCTCCCGACCTAAAATAGG + Intronic
922671015 1:227508810-227508832 GCCATATCCCTACCCAGAGGTGG - Intergenic
1062921497 10:1283785-1283807 TCCCAGTCCCTACCCAGAAGTGG - Intronic
1063577483 10:7274958-7274980 GCCCTTTCCCTACTCTGAAGAGG - Intronic
1065216491 10:23454132-23454154 TCCCTCTCCCTCCCCACCAGTGG - Intergenic
1067848651 10:49741256-49741278 GCCCTGTCCCAACTCACAAGAGG + Intronic
1070671223 10:78378664-78378686 GCCATCAACCTAACCAAAAGGGG - Intergenic
1072468929 10:95693809-95693831 GCCCTCTTCCTCCCCATCAGGGG - Exonic
1074111598 10:110426750-110426772 GCCCACTCCCTCCCCAAATGGGG - Intergenic
1076713321 10:132350953-132350975 TCCCTCTCCCTGCCCATGAGAGG - Intronic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1077999009 11:7478201-7478223 GCCCTCTCCCTCACCCCAAGTGG + Intergenic
1081245772 11:40764515-40764537 GCTCTCTCCCCAGCCAAAGGTGG - Intronic
1081644334 11:44779129-44779151 GGCCTCTCCCTTGCCAAAAAGGG - Intronic
1085389996 11:76177434-76177456 CCCCTCTCCCTACCAGAGAGGGG - Intergenic
1085663779 11:78394455-78394477 GTCCTCTCCCTACCCCACGGTGG + Intronic
1089298297 11:117482371-117482393 GGCCACTCCCTCCCCAGAAGAGG - Intronic
1089727423 11:120494701-120494723 GCCCTCTCCCTATGCATAGGAGG - Intergenic
1090659891 11:128874329-128874351 CCTTTCCCCCTACCCAAAAGTGG - Intergenic
1095262335 12:40110820-40110842 CAACTCTCCCTACCCAAAGGAGG - Intergenic
1095743968 12:45636701-45636723 GCCCTCTCCCCACCCAGCTGGGG + Intergenic
1096073649 12:48789170-48789192 CCCCTCCCCCTCCCCAGAAGTGG + Intergenic
1096114946 12:49050291-49050313 GTCCTCTCCCTTCCCCAATGGGG - Exonic
1096295688 12:50382001-50382023 CCCCACTCCCTACTCAAAAGGGG - Intronic
1097864340 12:64546953-64546975 GTCCTCTCCATATCAAAAAGTGG - Intergenic
1098596401 12:72276943-72276965 ACCATCTGGCTACCCAAAAGTGG - Intronic
1100242757 12:92726287-92726309 GCACTCTCCCACCCCCAAAGTGG - Intronic
1102595568 12:113990194-113990216 GCCTTCTCCCTACCCATATGTGG + Intergenic
1102768008 12:115450276-115450298 GCCCTCTTCCTGCCCAGCAGGGG - Intergenic
1103817685 12:123671627-123671649 ACCCCCACCCTCCCCAAAAGAGG - Intronic
1104329914 12:127835173-127835195 GCCCTCTCCCTGCCTCAAGGAGG + Intergenic
1106659129 13:31780065-31780087 CTGCTCTCCCTCCCCAAAAGGGG + Intronic
1113215564 13:108036957-108036979 GCCCCCTCCCTCCCCAACTGTGG - Intergenic
1116824388 14:49657989-49658011 GCCCCCTCCCCACACAAAACTGG + Intronic
1119132433 14:72186452-72186474 GACCTCTCCCCTCCCAAAGGAGG - Intronic
1119681198 14:76593442-76593464 GCCTCATCCCGACCCAAAAGTGG - Intergenic
1120708074 14:87765274-87765296 TCCCTCTCCCCACCAAAATGGGG - Intergenic
1120875441 14:89371208-89371230 GTCCTCTTCCTGCCCGAAAGTGG + Intronic
1121826066 14:97010634-97010656 GCACCCTCCCTGCCCAAATGTGG + Intergenic
1122422855 14:101588382-101588404 TCCCCCTCCCTCCCCACAAGGGG + Intergenic
1122808852 14:104277745-104277767 GCCCTTTCCCTCTCCAAAAGGGG + Intergenic
1122941766 14:104984725-104984747 GCCCTCCCCTTACCCAGAGGAGG + Intergenic
1124166295 15:27328714-27328736 GCCCTCTCCATCCCCACATGGGG + Intronic
1124890882 15:33731890-33731912 GCCCTCTCCCTTCCCCCAAAGGG - Intronic
1127861436 15:62997353-62997375 ATCCTCTCCCTCCCCAGAAGAGG - Intergenic
1129386523 15:75199295-75199317 TCCCTCTCCCCTCCCAGAAGAGG - Intronic
1130564453 15:84981804-84981826 GCGCTCTCCTTACCCAGGAGCGG - Intronic
1131575364 15:93584803-93584825 GTCCTCTCCCTACCCTAAGGTGG + Intergenic
1132285245 15:100657947-100657969 GCCCCCTCCCCACCCCACAGTGG + Intergenic
1135481987 16:22828298-22828320 GCCCTCTTCCAACCCAGAAAAGG + Intronic
1136229135 16:28876785-28876807 GCCATCCCCCTCCCCAAAAGTGG + Intergenic
1139974413 16:70797458-70797480 TCATTCTCCCTACCAAAAAGTGG + Intronic
1141164769 16:81653035-81653057 GCCTTCTGCCTAACCAACAGCGG - Intronic
1142585267 17:968316-968338 GGCCTCTCCCAGCTCAAAAGAGG + Intronic
1143110804 17:4551810-4551832 GAGCTCTCCCTGCCAAAAAGGGG - Intronic
1143322565 17:6077564-6077586 GCGCTCCCCCTTCCCAGAAGGGG - Intronic
1143355544 17:6325462-6325484 TCCCTATCCCTTCCCAAGAGTGG + Intergenic
1143676468 17:8436302-8436324 GCCCTCACCCTACCCGGAACGGG - Intronic
1143845378 17:9769541-9769563 GCCCTCTCCCTTCGCAATTGCGG + Intergenic
1145252804 17:21305587-21305609 GCCCTCACCCTACCCAAGCCAGG - Intronic
1145323770 17:21782322-21782344 GCCCTCACCCTACCCAAGCCAGG + Intergenic
1148379363 17:47182446-47182468 AACCTCTCCCTGCCCCAAAGAGG + Intronic
1151423074 17:74011362-74011384 ACCCTCTCTCTGCCCAACAGAGG + Intergenic
1151679168 17:75614753-75614775 ACCCTCTCCCTGCCCCACAGGGG + Intergenic
1154975560 18:21454069-21454091 CCCCTATCCCAACCCAGAAGTGG - Intronic
1160917865 19:1506372-1506394 GCCCCCTCCCTTGCCAGAAGAGG + Intronic
1161745624 19:6057980-6058002 GCCATCTCCTTGCCGAAAAGTGG + Intronic
1164087872 19:21920320-21920342 GCTCACTCCCTATCCAAAGGTGG + Intergenic
1166608364 19:44165643-44165665 ACCCTCTCCTTCCTCAAAAGAGG - Intronic
1167156625 19:47742891-47742913 GCCCTCTCCCCACCCCTAAAGGG + Exonic
1167302196 19:48684621-48684643 GCCCTGTCCCTCACCAGAAGGGG + Intergenic
924992768 2:328258-328280 GCCCCATCCCTAGGCAAAAGGGG - Intergenic
925033894 2:671894-671916 GCCCTCTCTTTAGCCATAAGCGG - Intronic
927246092 2:20958221-20958243 GACCTCTCCTTGCCCCAAAGCGG + Intergenic
927286250 2:21360102-21360124 GCCCTCTCCATTCCAAAGAGAGG - Intergenic
932369584 2:71176197-71176219 CCCCTCTCCCTACCCCATAAAGG + Intergenic
935754969 2:106269975-106269997 GCCCTCCCTCCACCCAAAGGCGG - Intergenic
936116011 2:109703845-109703867 GTCCTCCCTCTGCCCAAAAGTGG + Intergenic
936159228 2:110071434-110071456 GCCCTCTCACTGCACGAAAGTGG + Intergenic
936185433 2:110299898-110299920 GCCCTCTCACTGCACGAAAGTGG - Intergenic
938933998 2:136112616-136112638 GCTCTCTCCCTGCCCCAAAAGGG - Intergenic
940717975 2:157249407-157249429 ACCCTCTCCCTATTCATAAGAGG + Intergenic
947530317 2:230904982-230905004 GACCTCTCCCTCCCCAAGATGGG - Intergenic
1168883148 20:1224832-1224854 GCCCTTTCCTTATTCAAAAGGGG + Intergenic
1170320620 20:15093779-15093801 TCCCTCTACCCACACAAAAGGGG - Intronic
1171278570 20:23878637-23878659 GCCCTCTCCCTGCACAGGAGGGG - Intronic
1171283651 20:23921141-23921163 GCCCTCTCCCTGCACAGGAGGGG - Intergenic
1171295796 20:24015833-24015855 GCCCACTCCCTATACAAGAGTGG + Intergenic
1171522705 20:25787684-25787706 GCCCTTTCCCTCCCCTAGAGAGG - Intronic
1171554122 20:26068199-26068221 GCCCTTTCCCTCCCCTAGAGAGG + Intergenic
1173729012 20:45316186-45316208 GGCCTCTCCCTGCCCCAAGGAGG + Exonic
1176154440 20:63611184-63611206 GCCCTCTCCCCACGCAGAGGCGG - Intronic
1177469222 21:21535535-21535557 TCCCTCTGTCTACCCACAAGGGG + Intronic
1179227535 21:39468197-39468219 GCCCTCTCCCCACCCTAACTGGG - Intronic
1181630974 22:24151205-24151227 GCCCCCTCCCTGCACAAAGGGGG + Intronic
1182997055 22:34823370-34823392 GCCAGCTCCCTCCCTAAAAGGGG - Intergenic
1183358742 22:37372638-37372660 ACCCTCTCCCTGCCCTAGAGGGG + Exonic
1184229104 22:43148849-43148871 GCCCTCTGCCTGCCCCAGAGGGG + Intergenic
1185295862 22:50054425-50054447 GCACTCTCCCTCCCCAGGAGAGG - Intronic
950475741 3:13213965-13213987 GCCCTCTCCCAACCCCAACCTGG + Intergenic
953992553 3:47495435-47495457 GCCAGCTCCCCACCCAAAGGTGG - Intergenic
954346109 3:50000866-50000888 GTCATCTCCATACCCATAAGAGG - Intronic
955326172 3:58010450-58010472 GCCCTCCCCCTCCCCAAGGGTGG + Intronic
955337986 3:58102910-58102932 GCTGTCTCCTTCCCCAAAAGAGG - Intronic
955851719 3:63227147-63227169 GCCCTAGCCCCTCCCAAAAGTGG - Intergenic
956168732 3:66416114-66416136 GACCTCTCCCTGCACAAAAGTGG - Intronic
957673780 3:83340331-83340353 CCCCTCTCCCAACCCACAACAGG + Intergenic
962118841 3:132541089-132541111 CCCCTCTCCCATCACAAAAGTGG - Intergenic
965313743 3:167164423-167164445 GCCCTCTGCCTAGCCACAACAGG - Intergenic
968490912 4:890101-890123 GCCCCCTCCAGCCCCAAAAGGGG + Intronic
968912121 4:3481589-3481611 GCCCTCTCCATCCCCCAAGGTGG - Intronic
970820278 4:20204285-20204307 GGACTGTCCCTACCCAAAACTGG - Intergenic
971191625 4:24434092-24434114 CTGCTCTCTCTACCCAAAAGAGG + Intergenic
978532197 4:109726805-109726827 GCCTTTTTCCTACCCAAGAGAGG + Intronic
978836572 4:113157601-113157623 GCCCTGCCCCTAACCAAAAAAGG + Intronic
982063618 4:151629860-151629882 GCGCTCTCCTTACCCGAAACGGG - Exonic
983583628 4:169333596-169333618 ACTCTCCCCTTACCCAAAAGAGG + Intergenic
989384800 5:40844683-40844705 ACTCTCTTCCTACCCATAAGTGG - Intronic
994273559 5:97809411-97809433 GTGCTCCCCCTACCCGAAAGTGG + Intergenic
996737491 5:126771506-126771528 CCCCTCTCCCAAGACAAAAGTGG + Intergenic
996853500 5:127978806-127978828 GACCTCGCTCTACCCAGAAGAGG - Intergenic
997719609 5:136067014-136067036 GTCCTCTCCCCAACCACAAGTGG - Intergenic
998205147 5:140152511-140152533 CCCGCCCCCCTACCCAAAAGTGG - Intergenic
998252782 5:140563986-140564008 CCCCTCTCCATCCCCAAAATGGG + Intronic
1001333902 5:170782557-170782579 GCCCACTCCTTACCCACCAGCGG + Intronic
1001982384 5:176046087-176046109 GCCTTATGCCTACCCAAAAAGGG - Intergenic
1002235077 5:177797970-177797992 GCCTTATGCCTACCCAAAAAGGG + Intergenic
1003859701 6:10311174-10311196 GCCTTCTTCCTCCCCAACAGGGG + Intergenic
1005886397 6:30100998-30101020 GCCCTCTCCCTACCGGAGCGAGG + Intergenic
1007621068 6:43215029-43215051 GCCTGCTCCCTACATAAAAGTGG + Intronic
1008111099 6:47495449-47495471 GCCCTCTCGCCTCCCGAAAGAGG + Intronic
1008621824 6:53278523-53278545 GCCCTCTCCCCACCCATAAATGG + Intronic
1009556917 6:65182051-65182073 CCCCTACCCCTACCCAAAACAGG - Intronic
1010133380 6:72522274-72522296 GTCCTCTCCCTACAGAAGAGTGG + Intergenic
1011003337 6:82616129-82616151 GCCTTATCCCTACGCAAATGCGG - Intergenic
1013467471 6:110430258-110430280 GACCTATCCTTAACCAAAAGTGG + Intronic
1014380345 6:120733166-120733188 GCCCTCACACTACCCTATAGGGG - Intergenic
1015828182 6:137338125-137338147 GCCCTCACGCTACCCAGAAACGG - Intergenic
1018304833 6:162444028-162444050 ACCCCCTCCCTGCCAAAAAGAGG - Intronic
1019199912 6:170306241-170306263 CCCCGCTCCCTCCCCAAACGTGG + Intronic
1020179213 7:5908292-5908314 GCTCTGTCTCTACCAAAAAGTGG + Intronic
1020303720 7:6816564-6816586 GCTCTGTCTCTACCAAAAAGTGG - Intronic
1021599962 7:22355745-22355767 GACCCTTCCCTACCCAAAGGAGG + Intronic
1023842957 7:44107068-44107090 GCCCTCTCCCTACCCAAAAGAGG - Intronic
1024156672 7:46632921-46632943 GTCCTCTTCCTCCCCAAAAGTGG - Intergenic
1027239661 7:76318618-76318640 GCCCCCTCCCTACCCCAACCTGG - Intergenic
1027774051 7:82443480-82443502 GCCCCCTCCCTGCCCAAGCGGGG + Exonic
1030707044 7:112703531-112703553 GCTCTCTCCCTAGACAAATGGGG + Intergenic
1032611212 7:133416866-133416888 GCCCTCTTCCTACCAACAGGAGG - Intronic
1033677874 7:143561652-143561674 ACCCTGTCTCTACCCAAAACAGG + Intergenic
1034359435 7:150481041-150481063 TCCCACTCTCTAACCAAAAGAGG - Intergenic
1039088342 8:33802129-33802151 ATCCTCTCTCTACCCAAAACAGG + Intergenic
1041874009 8:62666934-62666956 TCCCTCTATCTCCCCAAAAGAGG + Intronic
1042967074 8:74365103-74365125 GCCCTCTTCATACACATAAGTGG + Exonic
1044751285 8:95418550-95418572 GCCCAATGCCTACCCACAAGTGG + Intergenic
1045063743 8:98427863-98427885 CCCCTCTCCCTACCCATTACTGG - Intronic
1047471022 8:125172515-125172537 GCTCTCCCCCTCCCCAAAAGGGG + Intronic
1048485940 8:134847698-134847720 GGCCTCCCCCTACCCAAAGTTGG - Intergenic
1051805630 9:20989976-20989998 GCCCTACCCCCACCCAGAAGAGG - Intronic
1052546566 9:29888525-29888547 CCCCTCTCCCCACACAAAGGAGG + Intergenic
1053020764 9:34692175-34692197 TCCCTCTCTCCATCCAAAAGAGG - Intergenic
1055718646 9:79146843-79146865 GCCCTCTGCCTACCTAAGATGGG - Intergenic
1055817133 9:80220008-80220030 TCCCTCTCCCTCCCCAGATGGGG + Intergenic
1056319802 9:85425279-85425301 TCTCTCTCCCTTCCCAAATGGGG + Intergenic
1056798736 9:89676694-89676716 GGGCTGTCCCTACCCAGAAGTGG - Intergenic
1057004890 9:91548463-91548485 ACGCACTCACTACCCAAAAGTGG - Intergenic
1185505579 X:630557-630579 GCGCTCTCCCTTCCAAAAATGGG + Exonic
1185855361 X:3529760-3529782 GACATCTGCCTACCCAAATGCGG + Intergenic
1186079878 X:5919502-5919524 GCCCAGTCCCTAACCAAAACTGG - Intronic
1186210224 X:7243063-7243085 GCCCTATCCAACCCCAAAAGAGG - Intronic
1187507540 X:19888813-19888835 GCCGACCCCCTACCCAAGAGAGG + Intergenic
1190595467 X:52049152-52049174 CCCCTCCCCCTACCCACAACAGG - Intergenic
1190613357 X:52204921-52204943 CCCCTCCCCCTACCCACAACAGG + Intergenic
1191958439 X:66672459-66672481 ACCCTCTCCCTACCTACATGAGG - Intergenic
1192274699 X:69616739-69616761 GCCCTCGCCCTACCCGCGAGGGG - Intronic
1192691792 X:73372816-73372838 TTCCTTTCCCTACCCAAAGGTGG + Intergenic
1193365240 X:80623604-80623626 CCCCACTCCCTAGCCAAAACAGG - Intergenic
1196929438 X:120666539-120666561 TCTCTCTCCCTACCTCAAAGTGG - Intergenic
1197193823 X:123678438-123678460 ACCCTGTCTCTACCCAAAAACGG - Intronic
1197437863 X:126455238-126455260 GCCCTCTCCCAACCCAGCACTGG + Intergenic