ID: 1023844822

View in Genome Browser
Species Human (GRCh38)
Location 7:44114656-44114678
Sequence TCCCATAGCCAGAGTGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023844813_1023844822 27 Left 1023844813 7:44114606-44114628 CCGGCTGGTGGGTGCATGGGCTA 0: 1
1: 0
2: 1
3: 36
4: 478
Right 1023844822 7:44114656-44114678 TCCCATAGCCAGAGTGCCCAGGG 0: 1
1: 0
2: 3
3: 15
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023844822 Original CRISPR TCCCATAGCCAGAGTGCCCA GGG Intergenic
900644506 1:3702875-3702897 TCCCACAACCAGAGGGCCCCCGG - Intronic
902840589 1:19071550-19071572 TCCCAGCTCCAAAGTGCCCATGG - Intergenic
903232117 1:21928197-21928219 TCCCTTGACCACAGTGCCCAGGG + Intronic
906717195 1:47979090-47979112 TCCCAAAGCCAAAGCACCCAAGG + Intronic
912325942 1:108762607-108762629 TCCCATAGGAAGGGTGCCAATGG + Intronic
912604982 1:110980983-110981005 TCACATAGGAAGAGTGCCAAGGG + Intergenic
920555594 1:206901885-206901907 TCCCAAAGCCTGAGAGCCCAGGG - Intronic
923331992 1:232934015-232934037 TCCCATAGCCAGAATTCCTGGGG + Intergenic
923459524 1:234196339-234196361 CCCCACAGGCAGTGTGCCCAGGG - Intronic
924257191 1:242194082-242194104 TGCCATACCTAGAATGCCCATGG - Intronic
924848187 1:247794332-247794354 ACTCATAGGCAGTGTGCCCAGGG - Intergenic
1064168238 10:13004780-13004802 GCCCATAAACAGAGTGGCCATGG - Intronic
1066509743 10:36083215-36083237 TCCCTGGGGCAGAGTGCCCAGGG - Intergenic
1066575532 10:36820284-36820306 TCCCATCGACTGAATGCCCAAGG + Intergenic
1067065143 10:43100147-43100169 ACCCAGAGCCAGAGTGTTCAAGG - Intronic
1067179967 10:43977767-43977789 TCCATCAGCCAAAGTGCCCAGGG - Intergenic
1067449940 10:46376039-46376061 TCCCAGGCCTAGAGTGCCCACGG + Intronic
1067587304 10:47483724-47483746 TCCCAGGCCTAGAGTGCCCACGG - Intronic
1069741778 10:70689507-70689529 TACCAGAGCCACAGTTCCCATGG - Intronic
1072008540 10:91282630-91282652 GCCCATAGCATGAGTTCCCAAGG - Exonic
1072534673 10:96353127-96353149 TCCCAGAGCCAGACTGCCCGGGG - Intronic
1073936113 10:108634336-108634358 GCCCATAGGCAGACTGCCTATGG - Intergenic
1077154411 11:1084993-1085015 TCCCATCCCCAGGGTGGCCAGGG - Intergenic
1078556662 11:12332704-12332726 TCCCATAGCTAGGGAGCCCCAGG + Intronic
1080442184 11:32305059-32305081 TCCCAGAGCCAGAGGGCCAAGGG + Intergenic
1082926315 11:58551103-58551125 TGGCATTGCCACAGTGCCCAAGG - Exonic
1083399158 11:62411943-62411965 TCCCACAGAAAGAGTCCCCAGGG + Intronic
1083745835 11:64736018-64736040 GCCCACAGCCACAGAGCCCAGGG + Intronic
1084683377 11:70679878-70679900 TCCCAAATCCACAGAGCCCAGGG + Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1092560425 12:9607458-9607480 ACCAATAGGCAGTGTGCCCAGGG + Intronic
1093756782 12:22861730-22861752 ACCCATAGCCAGAGTATCCATGG - Intergenic
1093981416 12:25479365-25479387 TCCCATAGCCAGGATTCACAGGG - Intronic
1095883564 12:47164927-47164949 CCCCATAGGCACACTGCCCAGGG - Intronic
1097041016 12:56155968-56155990 TCCCATAGCCTCAGTCCTCAAGG - Intronic
1097314368 12:58156135-58156157 TCCCAAAGCCTGAGAACCCAAGG + Intergenic
1099819769 12:87695025-87695047 TCCCACAGCCATAGTACTCATGG - Intergenic
1101159022 12:101955038-101955060 TCCCATAGCCAGATTGCAAGAGG - Intronic
1103761515 12:123253732-123253754 TCCCAAAGCCGGAGTCCCCATGG - Exonic
1104805415 12:131586471-131586493 TCCCATGGCCCCAGTGCTCAGGG - Intergenic
1105068022 12:133216956-133216978 TCCCATTGTCAGAGAGGCCAGGG + Intergenic
1105655068 13:22427913-22427935 AGCCATAGCCAGAGAGCTCATGG + Intergenic
1105818963 13:24062952-24062974 TCGCACAGCCAAAGTGCCCCTGG + Intronic
1107637209 13:42404785-42404807 TCCAATAGCCAGTGTTCCCTCGG + Intergenic
1113714324 13:112492616-112492638 TCCCATAGCCAGAGCGTCTCAGG - Intronic
1113714343 13:112492692-112492714 TCCCATAGCCAGGGTGTCTCAGG - Intronic
1113714368 13:112492806-112492828 TCCCATAGCCAGAGCGTCTCAGG - Intronic
1113714389 13:112492919-112492941 TCCCATAGCTAGAGTGTCTCAGG - Intronic
1113714431 13:112493109-112493131 TCCCAAAGCCAGAGTGTCTCAGG - Intronic
1113714477 13:112493336-112493358 TCCCATAGCCAGAGCGTCTCAGG - Intronic
1113714486 13:112493374-112493396 TCCCATAGCCAGAGCGTCTCAGG - Intronic
1113714494 13:112493412-112493434 TCCCATAGCCAGAGTGTCTCAGG - Intronic
1113714547 13:112493678-112493700 TCCCATAGCCAGAGTGTCTCAGG - Intronic
1113714555 13:112493716-112493738 TCCCATAGCCAGAGTGTCTCAGG - Intronic
1113714581 13:112493868-112493890 TCCTATAGCCAGAGTGTCTCAGG - Intronic
1113714621 13:112494058-112494080 TCCCATAGCTAGAGTGTCTCAGG - Intronic
1115331359 14:32201796-32201818 TCCCTTACCCAGGGTGCCCCGGG + Intergenic
1121406034 14:93719920-93719942 TCCCAGAGTCCTAGTGCCCACGG - Exonic
1125725837 15:41867713-41867735 TGCCATACCCAGAGTGCCCATGG - Intronic
1126403758 15:48301745-48301767 TCCCTGAGCCACTGTGCCCATGG + Intronic
1127052987 15:55104031-55104053 TCCCATTGCCACAGTGCACATGG - Intergenic
1128925175 15:71648773-71648795 TCCCATGGCCAGACTGCCAAGGG + Intronic
1129889826 15:79064548-79064570 TCCAATTACCAGAGTGTCCATGG + Intronic
1129964691 15:79723793-79723815 CCCCATAGGCAGTGTGCTCAGGG + Intergenic
1132882802 16:2169927-2169949 TCCAAGAGCCACACTGCCCAAGG - Intronic
1135891984 16:26365655-26365677 TCCCATCTCCGCAGTGCCCAGGG - Intergenic
1141441961 16:84034841-84034863 TCCCATAGCCAGGATCCTCAGGG + Intronic
1144080396 17:11758923-11758945 TCCCAAGGCCACAGAGCCCATGG - Intronic
1144168255 17:12633501-12633523 TCCCAGATCCAGAGTTCCCTGGG + Intergenic
1146317411 17:31818946-31818968 ACCCATAGGCAGTGTGACCAGGG - Intergenic
1146677911 17:34786069-34786091 TCCCAGAGGCAGCCTGCCCATGG - Intergenic
1148211318 17:45810551-45810573 ACTCAGAGCCAGGGTGCCCAGGG + Intronic
1148987761 17:51638510-51638532 TAACAAAGCCACAGTGCCCAGGG + Intronic
1152554359 17:81045682-81045704 ACCCATGGCCAGGCTGCCCAGGG + Intronic
1152694932 17:81739250-81739272 TCCGAAAGCCAGAGTGCAGACGG - Intergenic
1153491692 18:5655971-5655993 TTCCCTAGCCAGAGGTCCCAGGG + Intergenic
1153789308 18:8563329-8563351 TTCCCTTGCCAGTGTGCCCATGG - Intergenic
1154391679 18:13941943-13941965 TCCTAGAGCCAAAGGGCCCATGG + Intergenic
1156523066 18:37738188-37738210 TCCAATATCCACAGTGCCCAAGG - Intergenic
1159429969 18:68338341-68338363 TCCCAAAACCAGAGGGCCCGAGG + Intergenic
1161067610 19:2246411-2246433 TCCCAGAGCCAGGGTGCCGAGGG + Intronic
1161148384 19:2693580-2693602 TCCGATGTCCACAGTGCCCAGGG - Intronic
1161319211 19:3633286-3633308 CCTCAGAGCCAGAGAGCCCAGGG + Intronic
1161854414 19:6755041-6755063 GCCCAGAGCCAGAGGCCCCATGG - Exonic
1162249016 19:9426877-9426899 TCCCATTGTCATAGTACCCATGG + Intronic
1162854780 19:13459918-13459940 TGCCATACCCAGAGAGCCCTGGG - Intronic
1164670685 19:30070473-30070495 TCCCAGAGCCAGAGGACCGAGGG + Intergenic
1166069955 19:40381220-40381242 TGCCACAGCAGGAGTGCCCAGGG - Intronic
1166233836 19:41441873-41441895 TAACATAGTCACAGTGCCCAGGG - Intergenic
1166817146 19:45553222-45553244 TTCATTTGCCAGAGTGCCCACGG + Intronic
1168406123 19:56111558-56111580 TTCCATAGCCAGAGGGGCCGGGG + Intronic
925126567 2:1461417-1461439 CACCATAGCCACAGTGCCTAGGG - Intronic
925222861 2:2156438-2156460 TCGCATAGCAAGAGAGCACAAGG + Intronic
925882903 2:8367897-8367919 TCCCAGAGCCAGCTTGCCCTGGG - Intergenic
926927641 2:18003749-18003771 ACCTATAGCCAGACTGCCCAAGG - Intronic
927072033 2:19540804-19540826 TGCCATAGACAGAGTTCACAGGG + Intergenic
930053575 2:47235429-47235451 GGCCAGAGCCAGAGAGCCCATGG - Intergenic
930066381 2:47330970-47330992 ACCCATACCCAGAGCCCCCAAGG + Intergenic
932577204 2:72969247-72969269 TCCCATACTCAGTGTGCACAGGG + Intronic
933719738 2:85390309-85390331 TCCCAGGTCCAGAGAGCCCAAGG + Exonic
934489944 2:94755574-94755596 TCTCATGGCCCGAGTTCCCAAGG + Intergenic
936411134 2:112259377-112259399 TCCCATAGCCAGTATACACAGGG + Intergenic
937347601 2:121136215-121136237 CCCCAGAGGCAGTGTGCCCAGGG + Intergenic
941525676 2:166603769-166603791 ATCCATATCCAGAGTGTCCATGG + Intergenic
941721772 2:168820178-168820200 TTCCCCAGCCAGACTGCCCAGGG + Intronic
941756456 2:169191734-169191756 CCCCGTGGCCACAGTGCCCAGGG - Intronic
943369639 2:187001660-187001682 TCCCTGGGCCAGAGTGCCCTGGG - Intergenic
945562175 2:211352707-211352729 TCCTATCTCAAGAGTGCCCAAGG + Intergenic
948176835 2:235950215-235950237 TCTCATGGCCAGAGTGCCCAGGG + Intronic
1169735365 20:8832041-8832063 TCCCATAGGCAGGGTGCCCAGGG + Intronic
1171879804 20:30610340-30610362 TCTCACAGCCCGAGTTCCCATGG + Intergenic
1174505346 20:51014167-51014189 TCTCAAAGCCAGAGTCCCCTGGG + Intronic
1174582852 20:51584883-51584905 TCCCATAGCCAGAGACATCAAGG - Intergenic
1175112355 20:56657585-56657607 TCCCTTAGCGAGAGTGGTCAGGG + Intergenic
1178715738 21:34962851-34962873 TCCCATAGCCAAACTCACCAAGG - Intronic
1181067900 22:20315293-20315315 TGCCCTAGCCCGAGTGCCCCGGG - Intronic
950032931 3:9863766-9863788 TCCCATGGCCACCGTGACCAGGG - Intergenic
950446573 3:13042241-13042263 TCCCATTGCCCTAGTGGCCAAGG + Intronic
952673682 3:36000805-36000827 TCCCTGAGACAGAGTGCCCAGGG - Intergenic
956427052 3:69146839-69146861 TCCTACAGCCAGAGAGACCAGGG + Intergenic
961663029 3:128480471-128480493 AGCCAAAGCCAGAGTGGCCACGG - Exonic
966855114 3:184188595-184188617 GCCCATTTCCATAGTGCCCAAGG + Intronic
968511217 4:996783-996805 GCCCAGAGGCTGAGTGCCCAGGG + Intronic
969097332 4:4743556-4743578 CCCCATAGCCATGGAGCCCATGG + Intergenic
970300891 4:14680447-14680469 TCCCATAGTCAAAGGGGCCATGG - Intergenic
973134246 4:46686330-46686352 TCTCACAGCCACAGTGTCCATGG + Intergenic
973279404 4:48342497-48342519 TCCTACATCCAGAATGCCCAGGG - Intronic
975946736 4:79715381-79715403 TCCCATGCCCAGAGTCCCCTCGG - Intergenic
977489894 4:97698650-97698672 TCCCATAGCCAGGATTCACAGGG - Intronic
984766845 4:183406429-183406451 CCCCATAGGCAGTGTGCCCTGGG - Intergenic
990266626 5:54084010-54084032 TTCCATAGCCAGGGTGCCATGGG + Intronic
990533400 5:56696058-56696080 TCACACAGCCACAGTGCCAAGGG + Intergenic
990981396 5:61605362-61605384 TCCCAGAGGCAGAGAGACCATGG + Intergenic
991387925 5:66110480-66110502 TCCTATGGCCATACTGCCCAAGG + Intergenic
993243132 5:85415870-85415892 TCCCAGAGACAGAGTTCTCAGGG - Intergenic
996767222 5:127046626-127046648 TTCCATAGCCAGTTGGCCCAGGG + Exonic
999552398 5:152703689-152703711 TCCCATCCCCAGAGTGTCTATGG - Intergenic
1004342329 6:14818634-14818656 TCCCAGAGGCACATTGCCCAGGG + Intergenic
1007241573 6:40430405-40430427 TCACACAGCCAAAGGGCCCATGG - Intronic
1007999810 6:46348551-46348573 TCCCATAGACAGAATGATCAGGG - Intronic
1010657021 6:78523781-78523803 CCCCACAGCTAAAGTGCCCAAGG + Intergenic
1010748272 6:79588866-79588888 TCATATAGCCATTGTGCCCAGGG + Intergenic
1011142272 6:84171952-84171974 TCCCAAAGCCAAAGGGCCTAAGG + Intronic
1011262504 6:85483983-85484005 TGTCATAGACAGAGTACCCACGG - Intronic
1013649782 6:112182800-112182822 TCCCAGAGCCACTGTGCTCAAGG - Intronic
1017121422 6:151027840-151027862 GCCCATGGCCAGAGTGCTCTTGG - Intronic
1018465002 6:164035823-164035845 TCCCAGAGCCACAGTGGTCAGGG + Intergenic
1019004160 6:168782449-168782471 CCCCATGGCCAGCATGCCCAGGG - Intergenic
1019571790 7:1716268-1716290 TCCCACAGCCAGAGGGTCTAGGG + Intronic
1019883659 7:3885061-3885083 CCCCTTAGCCATAGTCCCCAGGG - Intronic
1020091876 7:5346235-5346257 ACCCCTAGCCTGAGTCCCCAGGG - Intronic
1020684950 7:11283355-11283377 TCCCATGTCCACAGTGCCCAAGG + Intergenic
1021803874 7:24335844-24335866 TGCAATACACAGAGTGCCCAAGG - Intergenic
1023806588 7:43877123-43877145 TCCCATGAGCAGAGTGGCCAAGG + Exonic
1023844822 7:44114656-44114678 TCCCATAGCCAGAGTGCCCAGGG + Intergenic
1024058540 7:45681914-45681936 GTCCAGAGCCAGGGTGCCCAGGG + Intronic
1029173546 7:98647499-98647521 TCCCTGAGTCAGAGTCCCCAGGG - Intergenic
1029347349 7:99988027-99988049 CCTCACAGCCAGAGTGGCCATGG - Intergenic
1030123376 7:106132482-106132504 TCCCATTGCCTAAGTGTCCAGGG + Intergenic
1034295516 7:149968715-149968737 TCCAATAGCCATAGTCCACAGGG + Intergenic
1034810540 7:154128215-154128237 TCCAATAGCCATAGTCCACAGGG - Intronic
1034970612 7:155417109-155417131 CCCCATAGGCAGTGCGCCCAGGG - Intergenic
1037659432 8:20914094-20914116 TCCCAGAGCCAGATTTCCAAAGG - Intergenic
1038162192 8:25050378-25050400 TCTCAAAGCCAGAGAGACCAAGG + Intergenic
1039322866 8:36452246-36452268 CCCCAAACCCAGACTGCCCATGG + Intergenic
1039427773 8:37500923-37500945 TACCACATCCAGAGAGCCCAAGG + Intergenic
1039598225 8:38809886-38809908 TCCCAGAGCCAGAATATCCAGGG - Intronic
1039991689 8:42493395-42493417 TCCCCTAGCCAGTGTTTCCAGGG - Intronic
1041964310 8:63657479-63657501 TCCCATATCCACAGTGTCAAGGG + Intergenic
1042062794 8:64839427-64839449 TCCCAAAAGAAGAGTGCCCAGGG - Intergenic
1043610200 8:82053739-82053761 TCCCAGAGCCATAGTGTCCGTGG + Intergenic
1045318504 8:101063668-101063690 TCACTAAGCCAGAGTTCCCAGGG + Intergenic
1047885969 8:129250534-129250556 TCCCACATCCAGTGAGCCCAAGG + Intergenic
1048504424 8:135007957-135007979 TCCCACAGCCAGAGTGGGAATGG - Intergenic
1049037547 8:140088069-140088091 TTGTATAGCCAGAGTGACCAAGG - Intronic
1049319134 8:141986731-141986753 ACCCACAGCCAGCCTGCCCAGGG + Intergenic
1049429636 8:142554543-142554565 CCCCATAGGCAGTGAGCCCAGGG + Intergenic
1049627369 8:143631311-143631333 CCCCATAGGCAGTGAGCCCAGGG + Intergenic
1051003608 9:12315180-12315202 TCCCAGAGCCTGAGTCCCTAGGG - Intergenic
1052100919 9:24445521-24445543 GGCCATAGCCAGATTGGCCATGG + Intergenic
1052117890 9:24670926-24670948 TACAATAGCAACAGTGCCCACGG - Intergenic
1052881773 9:33605033-33605055 TCTCACAGCCCGAGTTCCCATGG - Intergenic
1053494537 9:38540805-38540827 TCTCACAGCCCGAGTTCCCATGG + Exonic
1055640871 9:78317990-78318012 TCCCAAAGCCTGAGAGCCCCAGG - Intronic
1057428176 9:94971093-94971115 CCCCAGAGCCAGAGGGCTCAGGG - Intronic
1058259152 9:102808868-102808890 TCCCATGAACAAAGTGCCCATGG - Intergenic
1059290794 9:113221840-113221862 TGGCATAGCCAGAGTGACCTTGG + Intronic
1059320511 9:113464809-113464831 TTTCAAAGACAGAGTGCCCAAGG + Intronic
1062514642 9:136926457-136926479 TCCCACAGCCAGCCTGGCCAAGG - Exonic
1188862091 X:35270275-35270297 GCCCAAAGCCTGAGAGCCCAAGG + Intergenic
1197083026 X:122441174-122441196 TCCCATAGCCCTAGGACCCAGGG - Intergenic
1201507025 Y:14713036-14713058 TCCCATAGGCAAATTGCCCCGGG + Intronic