ID: 1023845724

View in Genome Browser
Species Human (GRCh38)
Location 7:44119120-44119142
Sequence CTTTGTTTACCCAGGGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023845719_1023845724 -1 Left 1023845719 7:44119098-44119120 CCATTCCCGTGGAGTCAGGTGGC 0: 1
1: 0
2: 1
3: 5
4: 105
Right 1023845724 7:44119120-44119142 CTTTGTTTACCCAGGGCACCTGG No data
1023845715_1023845724 5 Left 1023845715 7:44119092-44119114 CCCATTCCATTCCCGTGGAGTCA 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1023845724 7:44119120-44119142 CTTTGTTTACCCAGGGCACCTGG No data
1023845712_1023845724 11 Left 1023845712 7:44119086-44119108 CCTCCACCCATTCCATTCCCGTG 0: 1
1: 0
2: 1
3: 20
4: 201
Right 1023845724 7:44119120-44119142 CTTTGTTTACCCAGGGCACCTGG No data
1023845710_1023845724 13 Left 1023845710 7:44119084-44119106 CCCCTCCACCCATTCCATTCCCG 0: 1
1: 0
2: 4
3: 41
4: 343
Right 1023845724 7:44119120-44119142 CTTTGTTTACCCAGGGCACCTGG No data
1023845711_1023845724 12 Left 1023845711 7:44119085-44119107 CCCTCCACCCATTCCATTCCCGT 0: 1
1: 0
2: 1
3: 19
4: 202
Right 1023845724 7:44119120-44119142 CTTTGTTTACCCAGGGCACCTGG No data
1023845716_1023845724 4 Left 1023845716 7:44119093-44119115 CCATTCCATTCCCGTGGAGTCAG 0: 1
1: 0
2: 0
3: 35
4: 416
Right 1023845724 7:44119120-44119142 CTTTGTTTACCCAGGGCACCTGG No data
1023845721_1023845724 -7 Left 1023845721 7:44119104-44119126 CCGTGGAGTCAGGTGGCTTTGTT 0: 1
1: 0
2: 3
3: 12
4: 197
Right 1023845724 7:44119120-44119142 CTTTGTTTACCCAGGGCACCTGG No data
1023845714_1023845724 8 Left 1023845714 7:44119089-44119111 CCACCCATTCCATTCCCGTGGAG 0: 1
1: 0
2: 0
3: 11
4: 144
Right 1023845724 7:44119120-44119142 CTTTGTTTACCCAGGGCACCTGG No data
1023845709_1023845724 21 Left 1023845709 7:44119076-44119098 CCTCAGATCCCCTCCACCCATTC 0: 1
1: 0
2: 4
3: 37
4: 386
Right 1023845724 7:44119120-44119142 CTTTGTTTACCCAGGGCACCTGG No data
1023845720_1023845724 -6 Left 1023845720 7:44119103-44119125 CCCGTGGAGTCAGGTGGCTTTGT 0: 1
1: 0
2: 1
3: 8
4: 145
Right 1023845724 7:44119120-44119142 CTTTGTTTACCCAGGGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023845724 Original CRISPR CTTTGTTTACCCAGGGCACC TGG Intronic
No off target data available for this crispr