ID: 1023846324

View in Genome Browser
Species Human (GRCh38)
Location 7:44122847-44122869
Sequence CAATAACAGTTGAAGTACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023846324 Original CRISPR CAATAACAGTTGAAGTACTG GGG (reversed) Intronic
902475406 1:16681716-16681738 ATATAACAGTTGAAGAACAGTGG - Intergenic
907507796 1:54934058-54934080 CAAAAACAAATGAAGTACCGAGG - Intergenic
908386045 1:63642989-63643011 CAATAGAAGGTGAAGTACAGGGG + Intronic
908429645 1:64043360-64043382 CAATAACACATGAAGTGCTGAGG + Intronic
910093257 1:83490743-83490765 CAACTAAAGTAGAAGTACTGAGG - Intergenic
912329802 1:108808476-108808498 CAATAACTGTTATAGTGCTGAGG + Intronic
912792925 1:112670899-112670921 CAAGAACTGCTGACGTACTGTGG + Exonic
913983042 1:143541218-143541240 TCATAACAGTTGAAGAACAGAGG + Intergenic
916152169 1:161805071-161805093 CAATTAACGTTGAAGAACTGGGG - Intronic
917951557 1:180042916-180042938 CACTAATAGATGAAATACTGTGG - Intronic
923651286 1:235876335-235876357 AAATAACAATAGAAATACTGTGG - Intronic
924108443 1:240673429-240673451 CAATCACAGTTGAAATAATGTGG + Intergenic
924667430 1:246087837-246087859 GGTTAACAGTTGGAGTACTGAGG - Intronic
1063294198 10:4786338-4786360 TAATAAGAGTAGAAGAACTGAGG - Intergenic
1064672236 10:17727524-17727546 CAATGAAAGTTAAAGTACTATGG - Intergenic
1064953363 10:20879562-20879584 AAATAACAGTTGCCGTTCTGCGG + Intronic
1065635001 10:27722712-27722734 AAATCACAGTTGAAGGAGTGGGG + Intronic
1065974809 10:30833138-30833160 CCACCACAGTTAAAGTACTGTGG + Intronic
1066597255 10:37064416-37064438 CAAGAACAGGTGAAGAATTGGGG + Intergenic
1067323304 10:45243119-45243141 TAATAAAAGATGAAGTTCTGGGG + Intergenic
1069335177 10:67340695-67340717 CAATTAGAGTAGAAGTTCTGGGG - Intronic
1071861298 10:89675511-89675533 GAATAACAGTAAAAGTACTCAGG + Intergenic
1073980113 10:109144673-109144695 CAAGAACATGTAAAGTACTGCGG - Intergenic
1074213773 10:111364146-111364168 CTATACCACTTGAAGCACTGAGG - Intergenic
1076910994 10:133389526-133389548 CAAAAACAGTTGCAGACCTGTGG + Intronic
1080998378 11:37634521-37634543 CAATTACATTTAAAGTATTGAGG + Intergenic
1081951460 11:47047351-47047373 CCATAATACTTGAATTACTGTGG - Intronic
1082143222 11:48634179-48634201 AAATAACAATTGAAGTGCTTAGG + Intergenic
1082788745 11:57332661-57332683 CAAAAACAGACGCAGTACTGTGG + Exonic
1085892351 11:80596124-80596146 CAAGAACAGGTGAAGAATTGGGG - Intergenic
1088241690 11:107779751-107779773 AAAAAACGGTTGAAGAACTGGGG - Intergenic
1088733695 11:112707518-112707540 CAAAAACAGTACAAGTTCTGAGG - Intergenic
1093113962 12:15186783-15186805 CAGTGACAGTTGCAGCACTGGGG + Intronic
1100452546 12:94721471-94721493 GAGTAACAGTTGAAGAACTGGGG - Intergenic
1100622758 12:96295391-96295413 CAGTAACAGTTGATTTACTGTGG + Intronic
1101235478 12:102784813-102784835 GAATAACAGTTGAAGAACTTTGG + Intergenic
1106165323 13:27240278-27240300 CAATGACAGCTAAAGTAATGAGG - Intergenic
1111223951 13:85244919-85244941 CAATAAAAGCTCAAGAACTGGGG + Intergenic
1112729270 13:102341773-102341795 CAACAATAGTTGACCTACTGAGG + Intronic
1113231945 13:108221412-108221434 CAATCACATGTGAAGTAATGTGG - Intronic
1116529526 14:45951825-45951847 CAAAAGCAGTTTAAATACTGAGG - Intergenic
1117220763 14:53603047-53603069 CAATTTCAGTAGAAATACTGGGG - Intergenic
1121896812 14:97656427-97656449 CATTAACTGTTCACGTACTGTGG + Intergenic
1122671397 14:103375360-103375382 CAATTAAAGTTGAAGTTGTGTGG - Intergenic
1124940658 15:34214378-34214400 CCATAACAGGTGAAGTACAGAGG + Intergenic
1126740451 15:51771780-51771802 CAATAACATCTCAAATACTGGGG - Intronic
1126967582 15:54072893-54072915 AAATTATAGTTTAAGTACTGAGG + Intronic
1129914386 15:79255501-79255523 AAATGACAGATGATGTACTGGGG - Intergenic
1131306490 15:91248425-91248447 TAATGAAAGATGAAGTACTGTGG - Intronic
1135301988 16:21338176-21338198 CAATATAAGGTGAATTACTGGGG + Intergenic
1139219779 16:65169363-65169385 CAATAACAATTAATGTATTGAGG + Intergenic
1142754843 17:2010110-2010132 AATTAACAGTTGAAGAACAGAGG - Intronic
1143578839 17:7812060-7812082 CAATAGCATTTGAGGTAATGAGG + Intronic
1147031904 17:37645152-37645174 GAACAACAGATGAAGTACTTGGG - Intergenic
1148623528 17:49052368-49052390 CAATCACATTTCAGGTACTGTGG - Exonic
1149818282 17:59748507-59748529 CATTTACAGTTGAATGACTGAGG - Intronic
1154016623 18:10624638-10624660 CATTAAGAGTTGAATTACTCTGG - Intergenic
1154188892 18:12211022-12211044 CATTAAGAGTTGAATTACTCTGG + Intergenic
1155999281 18:32366858-32366880 CAATAAAAGCTGTATTACTGAGG - Intronic
1158119623 18:54034161-54034183 CAACAACATTAGATGTACTGAGG + Intergenic
1163098058 19:15074890-15074912 CAGCAAGAGTTGAAGTACTGGGG + Intergenic
1164684230 19:30156593-30156615 AAATAACAGTTGAATGAATGAGG + Intergenic
1165277148 19:34764210-34764232 CAAGAACACTTTAAGTGCTGTGG + Intronic
1202709646 1_KI270714v1_random:10770-10792 ATATAACAGTTGAAGAACAGTGG - Intergenic
928956502 2:36874768-36874790 CAATAACAGTTGACCCACTCAGG + Intronic
929459295 2:42090325-42090347 CAATCCCAGCTGAAGTGCTGTGG + Intergenic
929537751 2:42794013-42794035 CAATGACACATGAAGCACTGAGG + Intergenic
930576780 2:53160188-53160210 CAATAACATGTATAGTACTGTGG - Intergenic
933032086 2:77341462-77341484 CAATAGCAGCTGAAATAATGTGG - Intronic
939505909 2:143047026-143047048 CAATAAAATTAGAAGTACTTAGG - Exonic
940603726 2:155893566-155893588 CAATAATAGTTAATGTACTTTGG - Intergenic
941251357 2:163168609-163168631 AAACAACAGTAGAGGTACTGTGG + Intergenic
941951909 2:171164392-171164414 CAAAAACACTGGAAGTACTCAGG + Intronic
942349254 2:175035905-175035927 GAATAACAGATGAAGAATTGGGG + Intergenic
942516478 2:176758729-176758751 TAATAAAACTTGAAGTACAGTGG - Intergenic
945304477 2:208245875-208245897 CAATACTAATTGTAGTACTGAGG + Intronic
945499559 2:210554514-210554536 ATATGACAGTGGAAGTACTGAGG - Intronic
945917827 2:215722725-215722747 AAATAACAGTAGAAGTATTATGG - Intergenic
946793476 2:223324721-223324743 GAATAACACATGAAGTACTTAGG + Intergenic
1169784643 20:9346503-9346525 CAAAAACTGTTGAAGCAATGTGG - Intronic
1170297012 20:14838867-14838889 AAAGGACAGTTGAAGTTCTGGGG - Intronic
1173172169 20:40736226-40736248 CCAAAACAGATGAAGTATTGAGG - Intergenic
1183761649 22:39825232-39825254 CAATACCATTTGAAATACTTAGG - Intronic
950728253 3:14933690-14933712 CAATAACAGATGGAATCCTGTGG + Exonic
950743916 3:15072006-15072028 GACCAACAGTTTAAGTACTGTGG + Exonic
951085406 3:18507220-18507242 TAACAGCAGTTGAAGCACTGTGG - Intergenic
953140324 3:40223720-40223742 CAATAATTGTTGAAGAAGTGGGG - Intronic
955666279 3:61352401-61352423 CAAGAACAGTTTAATTTCTGTGG - Intergenic
960732231 3:120739949-120739971 TAAGAACAGTTGAAGTGCTAGGG + Intronic
961171490 3:124800826-124800848 CAGTATCAGTTGAAGTTCTCAGG - Intronic
965462753 3:168988825-168988847 CAATAACTGCTGAAAAACTGTGG + Intergenic
972059098 4:34845711-34845733 CAATGACAGATGAAGTAAAGTGG + Intergenic
974898987 4:67973439-67973461 AAATAAAAGTTGAAGAAATGGGG - Intergenic
976228926 4:82820299-82820321 ATATAACAGTGGAAGTAGTGTGG - Intronic
977099554 4:92793362-92793384 CAGTAACAGTTGAAGTGTTTGGG + Intronic
977925372 4:102694616-102694638 CAAAAATGGATGAAGTACTGGGG + Intronic
978344575 4:107753711-107753733 CAAGAAAAGTTTAAGGACTGTGG + Intergenic
978930424 4:114304298-114304320 CATTCACAGTTGAAGTAAGGTGG - Intergenic
979756121 4:124341189-124341211 AATAAACAGTTGAAGTGCTGTGG + Intergenic
981295233 4:143123990-143124012 CAATACCAGTTGTAGTAATAGGG + Intergenic
982732451 4:158970803-158970825 CAATTACTGTTAAAATACTGGGG + Intronic
991612168 5:68460729-68460751 CCTTAACAGTTGATGAACTGTGG + Intergenic
993014935 5:82524682-82524704 CAATGAAAGTGGAAGTGCTGAGG + Intergenic
995036315 5:107538295-107538317 AAATAACAATTTAATTACTGAGG + Intronic
1001741933 5:174060435-174060457 CAAGAACAGTTGGAGGACTGTGG + Intronic
1002662163 5:180798594-180798616 CAGTTACAGTTGAGGAACTGTGG - Intronic
1004406042 6:15334769-15334791 CAATAAAACTTGGGGTACTGTGG + Intronic
1004559673 6:16736059-16736081 CAATAACAGTTTGAGTATTTAGG - Intronic
1007893632 6:45322934-45322956 CAATAACAGCTGTAGCACTGTGG - Exonic
1007918823 6:45587439-45587461 CAATAACATCTGAAGAACTGTGG - Intronic
1009651059 6:66479039-66479061 TAAGAAAAATTGAAGTACTGTGG - Intergenic
1010184054 6:73122379-73122401 AAATAATAGTTGATTTACTGGGG - Intronic
1011160804 6:84388359-84388381 CACTAGCAGTTGAGGTAGTGAGG - Intergenic
1011526592 6:88272033-88272055 CAATAACAGTTTTTGTGCTGTGG + Intergenic
1011774177 6:90709552-90709574 CAGTGACAGTTTGAGTACTGCGG + Intergenic
1013906088 6:115221748-115221770 AAATAACAATTAAAGTAATGTGG - Intergenic
1015283808 6:131462314-131462336 CATTGACAGTTGAAGTACAGAGG + Intergenic
1015564207 6:134550409-134550431 GAATAAAAGTTGAAGGATTGTGG + Intergenic
1015914132 6:138198089-138198111 CAATAAAAGTTGATGTCTTGAGG + Intronic
1019854409 7:3589904-3589926 CAATAACAGATGGAATATTGAGG + Intronic
1021179083 7:17485096-17485118 GAAAAGCAGATGAAGTACTGGGG + Intergenic
1021263280 7:18485889-18485911 CAATAACATTTCAAATAATGTGG - Intronic
1021900208 7:25277789-25277811 CAATAACAGTTGACTTTCTATGG - Intergenic
1022717300 7:32910180-32910202 CAATAGCAGTACAAGTAGTGTGG + Intergenic
1023846324 7:44122847-44122869 CAATAACAGTTGAAGTACTGGGG - Intronic
1024902333 7:54334099-54334121 CAACAACAGTTGCAGTGTTGAGG + Intergenic
1027516727 7:79151073-79151095 CAATAACAGAAGCAGCACTGAGG - Intronic
1027624033 7:80526515-80526537 CAGAAACAGTTGAACTACAGTGG + Intronic
1028008724 7:85613410-85613432 CAATAACAAATGCAGTAATGTGG + Intergenic
1031405379 7:121379398-121379420 CAAAAACAGTGGAACTTCTGGGG + Intronic
1035877785 8:3210810-3210832 CAATTACAGTTGAATTTGTGGGG - Intronic
1036579725 8:10062635-10062657 CCATAACTGTTGGAGTAATGGGG + Intronic
1037443600 8:18942516-18942538 CAGTTACATTTGAGGTACTGGGG - Intronic
1043632793 8:82357531-82357553 CAATAACAGGTCAAGTCCTCAGG + Intergenic
1044107839 8:88234352-88234374 TAATAAAAGTTGAAGTATTTTGG + Intronic
1046026846 8:108734584-108734606 AAATATGAGTTGAAGTAGTGGGG - Intronic
1046190184 8:110784949-110784971 CAATGTCAGTTGAAGTCATGGGG - Intergenic
1046423948 8:114021501-114021523 TAATAAGAGTTGAAGTTCTACGG - Intergenic
1052045373 9:23787915-23787937 CAAAAACAGTGGAGGTGCTGAGG + Intronic
1058020999 9:100088537-100088559 TAATAACAATTTAAGTACTGTGG - Intronic
1059084740 9:111287982-111288004 AGATAACAGATGAAGTAATGAGG + Intergenic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1187419992 X:19125676-19125698 CAATTACATTTGAAGTTCTAAGG - Intergenic
1191234172 X:58120736-58120758 CACTATCATTTGAAGTCCTGGGG - Intergenic
1191587969 X:62849681-62849703 CAATTACAGTTCATTTACTGTGG - Intergenic
1191674074 X:63776846-63776868 TGATGACAGTTGAAGTTCTGAGG - Intronic
1193139442 X:78011071-78011093 TAAGAACAGTTCAATTACTGAGG - Intronic
1193214004 X:78840714-78840736 CTAGCACAGTTGAAGTAGTGTGG + Intergenic
1194081634 X:89474034-89474056 TAAAAACAGTTGCAGTAATGGGG - Intergenic
1195718998 X:107847836-107847858 CAATGACAGTGGAAGAACAGGGG + Intronic
1196600867 X:117600497-117600519 CAATCTCAGTTGCAGTACAGTGG - Intergenic
1196787529 X:119434020-119434042 TAGTAACAGTTGTAGTAGTGTGG + Intronic
1198301721 X:135339948-135339970 CTATCACTGTTTAAGTACTGTGG - Intronic
1200434301 Y:3130224-3130246 TAAAAACAGTTGCAGTAATGGGG - Intergenic
1201092549 Y:10503735-10503757 AAAGATCAGTTCAAGTACTGTGG - Intergenic
1201561731 Y:15324331-15324353 CCATACCAATAGAAGTACTGAGG + Intergenic