ID: 1023846918

View in Genome Browser
Species Human (GRCh38)
Location 7:44127018-44127040
Sequence CCAGAAAGAAAAGAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023846918_1023846921 -8 Left 1023846918 7:44127018-44127040 CCTTCACTCTCTTTTCTTTCTGG No data
Right 1023846921 7:44127033-44127055 CTTTCTGGAATTTCCACAATGGG No data
1023846918_1023846920 -9 Left 1023846918 7:44127018-44127040 CCTTCACTCTCTTTTCTTTCTGG No data
Right 1023846920 7:44127032-44127054 TCTTTCTGGAATTTCCACAATGG No data
1023846918_1023846925 30 Left 1023846918 7:44127018-44127040 CCTTCACTCTCTTTTCTTTCTGG No data
Right 1023846925 7:44127071-44127093 TGGTGTCCCGCAGGTCTCTTAGG No data
1023846918_1023846924 21 Left 1023846918 7:44127018-44127040 CCTTCACTCTCTTTTCTTTCTGG No data
Right 1023846924 7:44127062-44127084 TCTGCTTGATGGTGTCCCGCAGG No data
1023846918_1023846923 10 Left 1023846918 7:44127018-44127040 CCTTCACTCTCTTTTCTTTCTGG No data
Right 1023846923 7:44127051-44127073 ATGGGTATTAGTCTGCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023846918 Original CRISPR CCAGAAAGAAAAGAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr