ID: 1023846922

View in Genome Browser
Species Human (GRCh38)
Location 7:44127046-44127068
Sequence AAGCAGACTAATACCCATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023846922_1023846924 -7 Left 1023846922 7:44127046-44127068 CCACAATGGGTATTAGTCTGCTT No data
Right 1023846924 7:44127062-44127084 TCTGCTTGATGGTGTCCCGCAGG No data
1023846922_1023846925 2 Left 1023846922 7:44127046-44127068 CCACAATGGGTATTAGTCTGCTT No data
Right 1023846925 7:44127071-44127093 TGGTGTCCCGCAGGTCTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023846922 Original CRISPR AAGCAGACTAATACCCATTG TGG (reversed) Intergenic
No off target data available for this crispr