ID: 1023846924

View in Genome Browser
Species Human (GRCh38)
Location 7:44127062-44127084
Sequence TCTGCTTGATGGTGTCCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023846922_1023846924 -7 Left 1023846922 7:44127046-44127068 CCACAATGGGTATTAGTCTGCTT No data
Right 1023846924 7:44127062-44127084 TCTGCTTGATGGTGTCCCGCAGG No data
1023846918_1023846924 21 Left 1023846918 7:44127018-44127040 CCTTCACTCTCTTTTCTTTCTGG No data
Right 1023846924 7:44127062-44127084 TCTGCTTGATGGTGTCCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023846924 Original CRISPR TCTGCTTGATGGTGTCCCGC AGG Intergenic
No off target data available for this crispr