ID: 1023850804

View in Genome Browser
Species Human (GRCh38)
Location 7:44149301-44149323
Sequence GGTGTGGAAGACCCCTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023850800_1023850804 4 Left 1023850800 7:44149274-44149296 CCGGAACTTCTGAGAAAGGTCCG 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1023850804 7:44149301-44149323 GGTGTGGAAGACCCCTCTGCTGG 0: 1
1: 0
2: 4
3: 13
4: 122
1023850799_1023850804 7 Left 1023850799 7:44149271-44149293 CCTCCGGAACTTCTGAGAAAGGT 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1023850804 7:44149301-44149323 GGTGTGGAAGACCCCTCTGCTGG 0: 1
1: 0
2: 4
3: 13
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023850804 Original CRISPR GGTGTGGAAGACCCCTCTGC TGG Intronic
900196201 1:1376857-1376879 AGTGAGGAAGACCACTCTGTTGG + Intergenic
902593830 1:17494429-17494451 GGTGCGGAGGCGCCCTCTGCTGG - Intergenic
905018705 1:34794110-34794132 GGCGTGGCAGACCTCCCTGCAGG + Intronic
905481494 1:38265044-38265066 GATGTGGGAGACTCCTCTCCAGG + Intergenic
911189941 1:94938193-94938215 GGCCTGGAAGAGCCCTATGCAGG - Intergenic
911598022 1:99818444-99818466 GGTGTGGAAGAACACTATGTTGG - Intergenic
911777163 1:101829119-101829141 GGTGCGGTTGGCCCCTCTGCTGG - Intronic
918893094 1:190300740-190300762 GGTGTGGATGTCCTTTCTGCTGG - Intronic
920065495 1:203266706-203266728 GGGGTGGGGGGCCCCTCTGCCGG - Intronic
920403242 1:205690454-205690476 GGTGGGAAGGGCCCCTCTGCTGG + Intergenic
1067684387 10:48457989-48458011 GGTGGGGAGGGCCCCTCTGTGGG + Intronic
1067802372 10:49367975-49367997 GGTGGGGAAGTCCCAGCTGCTGG - Intronic
1067804063 10:49381279-49381301 GGTGTGGCAGACCAGTCTGCAGG - Intronic
1070370479 10:75777557-75777579 GGTGTGTGAGCCACCTCTGCTGG + Intronic
1072080380 10:92023911-92023933 GGTGTATAAGCCCCCACTGCCGG + Intronic
1077285081 11:1762014-1762036 GGTGTGGAGGGCCCATCTGATGG - Intronic
1079367568 11:19822688-19822710 GGAGGGGAAGAGCCATCTGCTGG - Intronic
1083961251 11:66016173-66016195 TGTGTGGAGGACCCTGCTGCTGG - Intergenic
1087166973 11:95014627-95014649 GGTGTCCAAGGCCCCTGTGCTGG + Intergenic
1088095891 11:106101252-106101274 GGTGTGGTATACCCCTCTGCAGG + Intergenic
1089512936 11:119011957-119011979 GGTGCTGAAGAGCCCTCTTCTGG - Exonic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1092385486 12:8033115-8033137 GGCGAGGAAGACCCCTGTACTGG + Exonic
1093887058 12:24474396-24474418 GGTGTGGATGACCCCCCCACCGG + Intergenic
1096538438 12:52289798-52289820 GGTGGGGAGGAAGCCTCTGCAGG - Intronic
1096540341 12:52303566-52303588 GGTGGGGAGGAAGCCTCTGCAGG + Intronic
1096578040 12:52566896-52566918 GGTGTGGCAGACACCTTTGGGGG + Exonic
1103567728 12:121825269-121825291 GGTGTAGAAGCCCTCACTGCGGG - Exonic
1103860357 12:124007392-124007414 GCTCTGGAAGACACCCCTGCTGG + Intronic
1112076182 13:95915845-95915867 GGTGTGGCTGAAGCCTCTGCAGG - Intronic
1112591271 13:100765192-100765214 GTTGGGGAAGGCCCTTCTGCCGG + Intergenic
1113483264 13:110637040-110637062 GGTGTGGAAGGCCGCACGGCAGG - Intronic
1117325247 14:54662848-54662870 GGTGTCCAAGACCTCTCTGGGGG - Intronic
1118448136 14:65870432-65870454 GGTCTGGAAGACCTCACTGGAGG + Intergenic
1119784832 14:77305189-77305211 GTTGAGAAAGACCCCTCTGAAGG + Intronic
1122100899 14:99408914-99408936 GCCTTGGAAGGCCCCTCTGCAGG - Intronic
1124668526 15:31616113-31616135 GTTGTGCAAGACCCCATTGCTGG - Intronic
1125157459 15:36604159-36604181 GGTGTGTAACTCCCCTCTTCAGG - Intronic
1126404951 15:48314126-48314148 GGTGTGGAAGGGCCCTGAGCAGG - Intergenic
1126518198 15:49558449-49558471 GGAGGGGAAGATCCCTCAGCTGG - Intronic
1126917611 15:53483462-53483484 GGGGTGGAGCACCCCTCAGCTGG + Intergenic
1127484632 15:59407760-59407782 AGTGGGGAAGTCCCCTTTGCTGG + Intronic
1128753981 15:70168980-70169002 GCTGGTGAAGACCGCTCTGCTGG - Intergenic
1132878337 16:2149964-2149986 TGTGGGGAAGACCTGTCTGCTGG + Exonic
1132933554 16:2470401-2470423 GCTGTTGAGGACCCCTCTGCAGG - Intergenic
1133210658 16:4261757-4261779 GGTGAGGCAGCGCCCTCTGCTGG - Exonic
1137753682 16:50885105-50885127 GGTGTCAAAGCCCCCTCTGCAGG + Intergenic
1139966831 16:70750452-70750474 GGTGGGGAAGGCCCATCAGCTGG + Intronic
1141033936 16:80612127-80612149 GGAGGGGAAGACGCCCCTGCCGG + Intronic
1143820072 17:9553957-9553979 AGTGTAGAAAACTCCTCTGCTGG + Intronic
1147491332 17:40870208-40870230 GCTGCAGAAGATCCCTCTGCAGG - Intergenic
1148212852 17:45818641-45818663 GGGCTGGAAGACCCCTTTCCAGG + Intronic
1151239291 17:72745259-72745281 GGTTTGGCAGAGCCCGCTGCTGG + Intronic
1151255671 17:72874506-72874528 GGAGGGGAAAACCCCGCTGCTGG + Intronic
1161498369 19:4599268-4599290 GGCATGGAAGACCCCACTGTGGG - Intergenic
1164778597 19:30873894-30873916 GGTGTGGCAGCCATCTCTGCAGG + Intergenic
1167501981 19:49853722-49853744 GGTCTGTGAGACCCCTCTGGGGG + Intronic
1168678372 19:58295477-58295499 GGGGTGGAAGAGCCTTCTGTGGG + Exonic
928287674 2:30007753-30007775 CAGGTGGAAGACCCCACTGCAGG + Intergenic
933778548 2:85786503-85786525 GGGGTGGCAGGCTCCTCTGCAGG - Intronic
933814484 2:86054727-86054749 TGGGTGGATGACCCCTCTGAGGG - Intronic
935099731 2:99982042-99982064 GCTGAGGAAGAGCCCTGTGCAGG - Intronic
936270231 2:111043456-111043478 GGAGTGGCAGACAGCTCTGCAGG + Intronic
936364996 2:111845496-111845518 AGTGTGTGAGAACCCTCTGCAGG + Intronic
938709928 2:133967500-133967522 AGTGTGAAAGACACCTCGGCAGG - Intergenic
939444089 2:142286792-142286814 GCTGTGGAAGAGCCCTCTAGTGG - Intergenic
940122303 2:150280459-150280481 GTTGTGAAAGAACCCTCTGAAGG - Intergenic
941755798 2:169184438-169184460 TGTGGGGAAGAGCCCTCTGGAGG + Intronic
941824421 2:169877592-169877614 GGTGTGCAGGAGCCATCTGCTGG + Exonic
948231830 2:236354748-236354770 GGTGTGGAAACACACTCTGCAGG - Intronic
1174696577 20:52565580-52565602 TGTGTGGGAGACTCTTCTGCAGG + Intergenic
1180626078 22:17194366-17194388 GGTGTGGGAGGCCCCTAGGCTGG - Intronic
1181063197 22:20291806-20291828 GGGGTGCAAGACCCCTTTGCTGG - Intergenic
1181466983 22:23115594-23115616 GGTGTGGGAGGCCACCCTGCAGG - Intronic
1182082407 22:27538670-27538692 GGGGTGGAGGGCCCCTCAGCTGG + Intergenic
1182132552 22:27867357-27867379 GGTGGGGAAGTCCCATCTGGTGG + Intronic
1182576812 22:31278456-31278478 GCTGTAGAACACCCCCCTGCAGG - Intronic
1183413826 22:37671492-37671514 GGTGTGGATGGCGCCTCTGTGGG + Intergenic
1184869040 22:47221935-47221957 GGTGTGGAAGGATCCTCTCCTGG + Intergenic
1185066146 22:48632630-48632652 GCTGGGGAAGCCCCCTCTGGAGG + Intronic
1185314289 22:50172008-50172030 GGGGTGGAGGAGGCCTCTGCTGG + Intronic
950399614 3:12760015-12760037 GGTATGGAAGACCCCTCTTCAGG - Intronic
954136900 3:48586052-48586074 GGTTTGGAAGAGGCCTCTGGGGG - Exonic
954637545 3:52079409-52079431 GGTGAGGAGGAGCGCTCTGCAGG + Intronic
958603692 3:96331528-96331550 GGTGAGGGAGAGCCCTCTCCTGG - Intergenic
959103570 3:102040872-102040894 GGTGTGGATGTCCTCTCTGTTGG - Intergenic
961377137 3:126474869-126474891 GGTCTGGCAGGCCCCTCTGTGGG + Intronic
964620494 3:158716088-158716110 GGTGTCGCTGACTCCTCTGCAGG - Intronic
966891927 3:184413486-184413508 GGACTGGAAGAGCCATCTGCAGG - Intronic
967037112 3:185656160-185656182 AGTGTGGAAGACCCCCTGGCTGG - Intronic
967992078 3:195138973-195138995 AGTGTGGAAGACACCTGTGTGGG + Intronic
968951825 4:3699433-3699455 GGTGTGGCCGGCCCCCCTGCTGG - Intergenic
970518655 4:16861044-16861066 GGTATGGAGGACTTCTCTGCTGG + Intronic
971336388 4:25727573-25727595 AGTGTGGAAAACCCCCTTGCAGG + Intergenic
985621996 5:960686-960708 GGTGGGGAGGAGGCCTCTGCAGG - Intergenic
988268750 5:28986562-28986584 GGTGGTGAAGCCACCTCTGCTGG + Intergenic
992718157 5:79531770-79531792 GGTTTCAAAGATCCCTCTGCTGG - Intergenic
993575949 5:89600984-89601006 GGCCTGGAAGACCCCGCAGCTGG - Intergenic
998946298 5:147343105-147343127 CATGTGTAATACCCCTCTGCTGG - Intronic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1006235039 6:32622626-32622648 AGTGTGGAAGAGCCCCCTGCTGG - Intergenic
1006451757 6:34109451-34109473 GGGGTGGGTGGCCCCTCTGCAGG - Intronic
1006461865 6:34163993-34164015 GGTGTTGGAGTGCCCTCTGCTGG - Intergenic
1011219468 6:85038480-85038502 GGTGTGGAAAACCCATCTGCTGG - Intergenic
1017466257 6:154696717-154696739 GGAGTGGAAGATGCCTGTGCTGG + Intergenic
1017966459 6:159271097-159271119 GGTGGGGAAGACCCCACCCCAGG + Intronic
1019269021 7:135528-135550 TGTGGGGAAGGACCCTCTGCAGG + Intergenic
1020010924 7:4805449-4805471 GGTGTGGGGGACCTCTCTCCTGG - Intronic
1021364577 7:19760925-19760947 GGTGTGGAAGAAAGCTCTGCGGG - Intronic
1023850804 7:44149301-44149323 GGTGTGGAAGACCCCTCTGCTGG + Intronic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1026127288 7:67590037-67590059 GGTGTGGATGGCCCTTCTCCTGG + Intergenic
1026709247 7:72722909-72722931 GGTGTGGAAGACTCCACTGCAGG - Intronic
1027532575 7:79354128-79354150 GGAGTTGGAGACCCCTTTGCTGG - Intronic
1028461670 7:91100884-91100906 AGTGTTGAAGAGCCCTCAGCAGG - Intronic
1029609917 7:101621406-101621428 GCTGTGGTCGACCCCTGTGCAGG - Intronic
1035205916 7:157293694-157293716 GATGAGGAAGTCCCCTCTGCTGG + Intergenic
1035208546 7:157310848-157310870 GATGAGGAAGTCCCCTCTGCTGG - Intergenic
1037931650 8:22884162-22884184 TGTGTGGGAGCCCTCTCTGCAGG - Intronic
1038026894 8:23598961-23598983 GGTGTGCAAGCCCCATCTCCCGG + Intergenic
1039466359 8:37788064-37788086 GGGGTGGGAACCCCCTCTGCCGG - Intronic
1039792858 8:40889216-40889238 AGTGTGCAAGATCCCTGTGCAGG - Intronic
1040531402 8:48269341-48269363 GATGTGGCATTCCCCTCTGCTGG - Intergenic
1048848437 8:138621269-138621291 GGTGTGGAAGGCCCAAGTGCAGG + Intronic
1049020836 8:139956791-139956813 GGTGTGGGAGGCCACTCTGTAGG - Intronic
1052714569 9:32099432-32099454 GGTGTGGATGTCCTTTCTGCAGG - Intergenic
1056789537 9:89616635-89616657 GGAGTGGAACATCCCTGTGCAGG - Intergenic
1057141553 9:92729563-92729585 TGTGTGGGAGCTCCCTCTGCCGG - Intronic
1059679501 9:116572333-116572355 GGTGTGGGAGCGCCCTCTGTTGG + Intronic
1061731529 9:132618270-132618292 GGTGGGGGAGAGCACTCTGCTGG + Intronic
1062412757 9:136433254-136433276 GGAGTGGGAGACTCGTCTGCAGG - Exonic
1062602540 9:137324292-137324314 GGTGGTGAGGAGCCCTCTGCCGG + Intronic
1062656025 9:137605069-137605091 GGTGAGGGAGACCCCTGGGCGGG + Intergenic
1186664507 X:11704080-11704102 GCTGTGGAACACCCCCCTGCAGG + Intergenic
1187087024 X:16051332-16051354 GGTGTGGAAAACACCTGGGCAGG + Intergenic
1187246735 X:17559672-17559694 GATGGAGAAGACCCCTCTGCTGG + Intronic
1188399589 X:29728446-29728468 GGTGTTGTAGACCCCACTGGGGG + Intronic
1189222705 X:39385920-39385942 GGTGAGGATGACCCCACTCCTGG + Intergenic
1195318965 X:103705818-103705840 GGTGTGGAAGAGCCCACTTCAGG - Intergenic
1199659672 X:150036382-150036404 GGTGAGGAAGAACTCTCTGCTGG - Intergenic