ID: 1023852660

View in Genome Browser
Species Human (GRCh38)
Location 7:44158909-44158931
Sequence GGCCTTGGGGGTCCTGGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023852660_1023852667 -4 Left 1023852660 7:44158909-44158931 CCCTAGCCAGGACCCCCAAGGCC 0: 1
1: 0
2: 2
3: 31
4: 245
Right 1023852667 7:44158928-44158950 GGCCCATGTGCCTCCTTCCAAGG 0: 1
1: 0
2: 0
3: 18
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023852660 Original CRISPR GGCCTTGGGGGTCCTGGCTA GGG (reversed) Intronic
900472850 1:2863242-2863264 GCCATGGGGGGTCCTGGCCATGG + Intergenic
900491263 1:2950275-2950297 GGCCTTGGGGGTGCTGTCGAGGG - Intergenic
900752189 1:4405562-4405584 GGCCTTGGGGGGCCTGGGCAGGG + Intergenic
901325086 1:8360863-8360885 GGCCTTGGGAGGCCTGGGGAGGG + Exonic
901641695 1:10695868-10695890 GGCCTTGGGCAGCCTTGCTAAGG + Intronic
902258876 1:15208831-15208853 GGGCTTGAGGGTCATGGCCAAGG + Intronic
902728369 1:18352154-18352176 GGCCTGGGGTAGCCTGGCTAAGG + Intronic
904040140 1:27579259-27579281 GGTCTTGTGGGTTCTGGCTTTGG + Intronic
905976307 1:42176449-42176471 GGACTCTGGGGTCCTGGCTGTGG + Intergenic
906205085 1:43982323-43982345 GCCTTTGGTGGACCTGGCTAGGG + Intronic
909172405 1:72314010-72314032 GGACTTGTGAATCCTGGCTATGG + Intergenic
909811136 1:79932787-79932809 AGACCTGGGGATCCTGGCTATGG - Intergenic
912401652 1:109398079-109398101 GGCTTCGGGGGTCCTGGATTCGG + Intergenic
912733125 1:112127372-112127394 GGACCTGTGGATCCTGGCTATGG + Intergenic
915648031 1:157287836-157287858 GGCCTTGGGGTTCGTGGCAGTGG - Intergenic
915662636 1:157416664-157416686 GGCCTTGGGGTTCATGGCAGTGG + Intergenic
917281973 1:173386164-173386186 GGCCTTGGGGCTCATGCCCAGGG + Intergenic
920128408 1:203712134-203712156 GGCGAGGTGGGTCCTGGCTAGGG + Exonic
922960598 1:229642558-229642580 GGCCTTGAGTGCCCTGGCTTTGG + Intronic
923052275 1:230396987-230397009 CGCCTTGGGGGTCCTTTCTAAGG + Intronic
923094158 1:230761406-230761428 GGCCTTGGGGTTCCTGAGCAGGG - Intronic
923706343 1:236347883-236347905 GGGCTTGGGGGTCCTGGGTGGGG + Intergenic
924623172 1:245679926-245679948 GGGTTGGGGGGCCCTGGCTATGG - Intronic
1064085179 10:12340420-12340442 GGCCTCGGGGGTCCTTCCTTTGG - Intergenic
1064938275 10:20704593-20704615 GCCCTTGGGGCTGCTGTCTATGG - Intergenic
1067440392 10:46306025-46306047 GGCCTTGTGGGCCCTGGAAAGGG - Intronic
1067448431 10:46367075-46367097 GGCCGTGGTGGGCCTGGCTCTGG + Intergenic
1067588944 10:47493691-47493713 GGCCATGGTGGGCCTGGCTCTGG - Intergenic
1067636070 10:48001782-48001804 GGCCGTGGTGGGCCTGGCTCTGG - Intergenic
1067769351 10:49112142-49112164 GGCCTTGGGGAACCTGACTGGGG - Intronic
1069145946 10:64891878-64891900 GGACCTGTGGATCCTGGCTATGG - Intergenic
1069192118 10:65504921-65504943 GGACTTGTGAATCCTGGCTATGG + Intergenic
1072669759 10:97420690-97420712 AGCCTTTGGGGTCCTTGCAATGG + Intronic
1072739799 10:97902522-97902544 GGCCTTGGGGGACCAGGCAAAGG + Intronic
1074603551 10:114938408-114938430 GGCCTTGGAGACCCTGGCTTCGG - Exonic
1074831745 10:117254466-117254488 CGCCTTGGGAGGCCTGGCCATGG + Exonic
1077068369 11:655253-655275 GGCCGTGGGGGTGTTGGCTGGGG - Intronic
1077117627 11:892374-892396 GGCGTTGGGGGTCCTGTCCCAGG - Intronic
1077499101 11:2901288-2901310 GGCCTTGGGCCACCTGGCTCTGG + Intronic
1078081160 11:8205699-8205721 GCCCATGGGGGTCCTGCCCAGGG - Intergenic
1078357626 11:10644119-10644141 GGCCTCTGGTGTCCTAGCTAGGG + Intronic
1079984846 11:27189540-27189562 TGCTTTTGGGGTCCTGACTAGGG - Intergenic
1080600861 11:33819703-33819725 GGGCTTGGGGGTCTTGGCAATGG - Intergenic
1080606002 11:33865196-33865218 GCCCTTGGGTGTCCAGGTTATGG - Intronic
1082964856 11:58956602-58956624 GGCCTTGGGGGTCTCTGCTATGG + Exonic
1083424295 11:62575159-62575181 GGCCTTGGGGATCCTGGAGCGGG + Exonic
1083441287 11:62678482-62678504 GGCCTTGAAGGTCCTGACTGAGG - Exonic
1083618529 11:64037744-64037766 TGCCTTGGGGGTGTGGGCTACGG - Intronic
1083657464 11:64236366-64236388 GGCTTGGGGGGTGCTGGGTATGG + Intronic
1083712164 11:64556181-64556203 GGCCTTGGGGGTCATGTTTGTGG - Exonic
1083825753 11:65202875-65202897 GGGCTGGGGAGTCATGGCTAAGG - Intronic
1084193341 11:67508866-67508888 GGCCTTGGGGGTGCGGGTAAAGG - Intergenic
1084273538 11:68040901-68040923 GGCCAGTGGGGTCCTGTCTAGGG + Intronic
1084400831 11:68942018-68942040 GTCCTTGCGGGACCTGGCTCCGG + Intergenic
1084420702 11:69059151-69059173 GTCCTTGGTGGTCCTGCCTTTGG + Intronic
1087065754 11:94026533-94026555 GGCCTTGGGGGTCCATCATATGG - Intronic
1088971460 11:114778322-114778344 GGTCTTGGTAGTCCTTGCTAAGG + Intergenic
1090221418 11:125030181-125030203 GGACTTGTGAATCCTGGCTATGG + Intronic
1090419707 11:126566069-126566091 GGCTTTGGGGGTGCTGTCTTTGG + Intronic
1091112715 11:132985108-132985130 GGCCATGGGTGTCTTGGCTAGGG - Intronic
1091837520 12:3596088-3596110 GTCCATGGAGGGCCTGGCTAAGG - Intergenic
1094853080 12:34390962-34390984 GGCCCACGGGGTCCAGGCTAAGG + Intergenic
1096552894 12:52385218-52385240 GGCTTTGGTGGCCCTGGCTTTGG - Exonic
1096593657 12:52679930-52679952 GGCTTTGGGGGTGGTGGATATGG - Exonic
1096593674 12:52679990-52680012 GGCATTGGGGGTGGTGGCTTTGG - Exonic
1098526282 12:71490733-71490755 GGCCTTGGGAGTCCTGGCTCAGG - Intronic
1104013340 12:124947303-124947325 GACCTTGAGGGGCCTGGCTGGGG - Exonic
1104415280 12:128592740-128592762 GAGCCTGGGGGTCCTCGCTATGG - Intronic
1104482944 12:129124270-129124292 AGTCTTGGGGGTCCTGGATGTGG - Intronic
1109005700 13:56872601-56872623 AGCCTTGGAGGTCAAGGCTACGG + Intergenic
1111241171 13:85476635-85476657 ACCCTTTGGAGTCCTGGCTATGG + Intergenic
1113324939 13:109271835-109271857 GGGCATGGGAGTCCTGGGTAAGG + Intergenic
1113326003 13:109282026-109282048 GGCCTCGGAGGTCCTTCCTATGG + Intergenic
1114615338 14:24065153-24065175 GGCTTGGGGGGTCTGGGCTAGGG - Exonic
1114743223 14:25119415-25119437 GGAGGTGGGGGTCCTGCCTACGG + Intergenic
1117735715 14:58766238-58766260 TGCCCTGGGGGCCCTGGCTGAGG + Intergenic
1118480737 14:66162667-66162689 GGCCTTGAGCTCCCTGGCTATGG + Intergenic
1118861402 14:69667081-69667103 GGCCTTGTTGACCCTGGCTATGG + Intronic
1121011756 14:90524019-90524041 GGCCTTGGGAGTCCAGGCCTTGG + Intergenic
1121485722 14:94312854-94312876 GGCATGAGGGGTCCTGGCTGGGG + Intronic
1121758217 14:96421050-96421072 GTCCTTAGGGGTCCTGGCCCAGG + Intronic
1121777447 14:96599836-96599858 GGCCTTGGCTGTCCTGGCTTTGG - Intergenic
1122150327 14:99722076-99722098 GGCCCTGGGGGTCCTGGGGTGGG + Intronic
1122971355 14:105153545-105153567 GGCCCTGGGGCTGCTGGCTGGGG - Intronic
1124845956 15:33290286-33290308 GGGTTTGGGGGCCCAGGCTAAGG - Intergenic
1126106608 15:45150945-45150967 GATCTTGGGGGTCCTCGCTAAGG - Intronic
1126449377 15:48789166-48789188 GGCCTGGAGGGTCCCAGCTAGGG - Intronic
1128342936 15:66835236-66835258 GGCCCTGGGGGCCCTGTCTTGGG + Intergenic
1128709051 15:69858315-69858337 GGTCCTGGAGCTCCTGGCTAGGG + Intergenic
1129856986 15:78831538-78831560 GGCTATGGCCGTCCTGGCTACGG + Intronic
1131646462 15:94350196-94350218 GGCCTTGGAGGCCATGGCTCTGG + Intronic
1132331018 15:101012686-101012708 GCCCGTGGGGGTCCTGGCAGTGG - Intronic
1132504118 16:298205-298227 GGCCCTGGGGGCCCTGACGATGG + Exonic
1134513550 16:14868296-14868318 GGCCTTGGGAGTCATGACCATGG - Intronic
1134701187 16:16266791-16266813 GGCCTTGGGAGTCATGACCATGG - Intronic
1134970641 16:18527855-18527877 GGCCTTGGGAGTCATGACCATGG + Intronic
1136584418 16:31174773-31174795 GGCCTTGGGGGTCCTGGGGGTGG - Intergenic
1139432414 16:66918235-66918257 GGCCTTGGTGGGCCTGGCCGAGG - Intronic
1139789808 16:69424588-69424610 GGCCTTATGGGCCCTGGTTACGG + Exonic
1141111876 16:81276490-81276512 TGCCTTGGTTGTGCTGGCTAGGG + Intronic
1141186742 16:81793074-81793096 GGCCTTGGGGGTCCTCACCAGGG - Intronic
1141322059 16:83020412-83020434 GGCTTTGGGGATCCTGGAGATGG - Intronic
1141396086 16:83706089-83706111 GGCCTTGGGGATTCCAGCTAAGG - Intronic
1141441963 16:84034843-84034865 GGCCCTGAGGATCCTGGCTATGG - Intronic
1141639594 16:85333510-85333532 GGGCTTGGGGGGCCTGGGTCAGG + Intergenic
1141706913 16:85670942-85670964 GGCCTTCGGGCTCCTGCATACGG + Intronic
1141724211 16:85775660-85775682 GAACTTGGGGGTCCTGCCTCCGG + Intronic
1141831227 16:86510903-86510925 GGCCTTGGGCGGCCCGGCAAGGG + Exonic
1142055781 16:87995032-87995054 GGCCTTGGGGGTCCTCAGTCTGG + Intronic
1142242414 16:88953576-88953598 GGCCTGGGGGCTCCCGGCTGGGG + Intronic
1142352054 16:89585024-89585046 GGCCCTGGGGGCCGTGGCTGTGG + Intronic
1142480776 17:216946-216968 TGCCTTGGGGGTCCTGTCTTGGG - Intronic
1145273354 17:21416256-21416278 GGCCTGGGTGGTCATGGCTGTGG - Exonic
1145311543 17:21703700-21703722 GGCCTGGGTGGTCATGGCTGTGG - Exonic
1145711310 17:26981833-26981855 GGCCTGGGTGGTCATGGCTGTGG - Intergenic
1145881151 17:28353653-28353675 GGGCTTGGGGGTCCTCTCCATGG - Intronic
1145991436 17:29081470-29081492 GGCCTTGGGGGAGCTGGAGAAGG + Intronic
1146857237 17:36264361-36264383 GGACTTGGGGGCAGTGGCTACGG - Intronic
1146863378 17:36324014-36324036 GGACTTGGGGGCAGTGGCTACGG + Intronic
1146873149 17:36388271-36388293 GGACTTGGGGGCAGTGGCTACGG - Intronic
1147066238 17:37924602-37924624 GGACTTGGGGGCAGTGGCTACGG + Intronic
1147076032 17:37988896-37988918 GGACTTGGGGGCAGTGGCTACGG - Intronic
1147077771 17:38004163-38004185 GGACTTGGGGGCAGTGGCTACGG + Intronic
1147087557 17:38068442-38068464 GGACTTGGGGGCAGTGGCTACGG - Intronic
1147093708 17:38128098-38128120 GGACTTGGGGGCAGTGGCTACGG + Intergenic
1147103499 17:38192391-38192413 GGACTTGGGGGCAGTGGCTACGG - Intergenic
1147911800 17:43860448-43860470 GGCCTTGGGAGTCTTGGCTGGGG + Intronic
1148634876 17:49141350-49141372 GGACTTGGGAGTTCTGGCTTGGG - Exonic
1150139485 17:62716219-62716241 GGCCCTGCGGGTCTTGGGTACGG + Intronic
1150289979 17:63975536-63975558 GGCCTTGGGAGCCCTGGGTAGGG - Intergenic
1150993673 17:70290965-70290987 GGCCCTGAGTGTCCTGGCTTTGG - Intergenic
1151947813 17:77329110-77329132 GGCCTTGGAGGCCCTGGTGAGGG + Intronic
1152426880 17:80222825-80222847 GGCCATGGGGGTCCTGCGTTTGG + Exonic
1152634061 17:81423276-81423298 GGCCTTGGGGGCCCTGGGCTGGG + Intronic
1152814270 17:82398151-82398173 GGGCGTGGGGCTCCTGGCTCAGG - Intronic
1154963184 18:21330086-21330108 GAACATGTGGGTCCTGGCTATGG + Intronic
1157594919 18:48858641-48858663 GGCCTGGGGGGCACTGGCCAGGG + Intronic
1160738751 19:676459-676481 GCCCTGGGGGGCCCTGGCTTGGG + Exonic
1160983686 19:1827862-1827884 GGCTTTGGGGGTGCTGGCCGTGG + Exonic
1161057141 19:2196255-2196277 TGCCTTGGGCGTCCTGGCTGTGG + Intronic
1161261592 19:3340779-3340801 GGCCCTGGGGCTCCAGGCCAGGG - Intergenic
1162481364 19:10928793-10928815 CGTCTTGGGGGTCCTTGCTCCGG - Exonic
1163375448 19:16927582-16927604 GGCCTGGGGGGTCTTGGTGATGG - Intronic
1163468994 19:17486174-17486196 GACCCTGGGGGTCCTGGTTAGGG + Intronic
1164502427 19:28831270-28831292 GGCCCAGGGAGTCCTGGCCAGGG + Intergenic
1164995711 19:32719652-32719674 GGCCCTGGGAGGCCCGGCTAGGG - Intergenic
1166139168 19:40796684-40796706 GGCCTGGTGGGGCCTGGCTTTGG + Exonic
1166812560 19:45522824-45522846 TGACTTGGGGGTCCAGGCTCAGG - Intronic
1167093430 19:47360089-47360111 GTCCTTGGGGGTGGTGGGTAGGG - Intronic
1168112519 19:54201535-54201557 GGCCTTGCGGATCTTGGCCAGGG - Exonic
927554533 2:24022755-24022777 GGCCTTGGGGTCCCAGGCAAAGG + Intronic
930066384 2:47330972-47330994 GCCCTTGGGGGCTCTGGGTATGG - Intergenic
930724911 2:54673582-54673604 GGCCTTGTGGGTGCCGGGTAAGG - Intergenic
931748895 2:65313911-65313933 GGCCTTTGGGGTCCTCGCCTAGG + Exonic
932606634 2:73169867-73169889 GGCATTGGGGCTCCTGCCTATGG + Intergenic
933810748 2:86031425-86031447 GCCCCTGGGGCTCCTGGCTGTGG + Exonic
933925791 2:87090568-87090590 GGCATTGGGGCTCCTGCCTATGG - Intergenic
934571203 2:95374448-95374470 GGCCTTGGAGACCCTGGCTCAGG + Intronic
936089087 2:109489368-109489390 GGCCTGGGGGGACTTGGCTGGGG + Intronic
937089760 2:119198390-119198412 GGCCTTGGTGGGGCTGGCTAGGG - Intergenic
937910696 2:127074195-127074217 GGGCTTGGGGGCCCTGGGAAAGG - Intronic
938092305 2:128441664-128441686 GGCCTGGGTGGCCCTGCCTATGG - Intergenic
941164824 2:162073852-162073874 GGCCTTGGGGCTTCCGCCTAAGG + Intronic
941221842 2:162791792-162791814 AGCATTGGAAGTCCTGGCTAGGG - Intronic
942915054 2:181294888-181294910 GGCCTGGGTGGTGGTGGCTAAGG + Intergenic
944078764 2:195760658-195760680 TGCCTTGGTGGTCTTGGATAAGG - Intronic
946225381 2:218261606-218261628 GGCCTTGGAGGCCCAGGCTCAGG + Intronic
947452509 2:230221516-230221538 GGCCTTGCGGGTAATGGCTGTGG + Intronic
947729169 2:232418715-232418737 ACCCTTGGGGTTCCTGGCTTTGG + Intergenic
947773522 2:232689649-232689671 GGGCTGGGGGGTGCAGGCTAAGG + Intergenic
948505145 2:238423258-238423280 GGCCCTGGGAGTCCTGCCAAGGG - Intergenic
1169893112 20:10474632-10474654 GGCCTTGGGGGCCTGGGCTGGGG + Intronic
1171810839 20:29743426-29743448 GGCGTTGGGCCTCCTGGCCATGG - Intergenic
1172780041 20:37431212-37431234 TGACTTGGGGCTCCTGGCTGTGG - Intergenic
1174067297 20:47874917-47874939 GGCCTTGGGGGACCTGACCTGGG + Intergenic
1174157002 20:48521956-48521978 GGCCTTGGGGGACCTGACCTGGG - Intergenic
1175216360 20:57393388-57393410 GGCCTTGGGCTTCCTGGGTCTGG + Intronic
1175403013 20:58711229-58711251 GGCCATGGGGCTCCAGGCCATGG - Intronic
1175749400 20:61484823-61484845 GGGCTGTGGGGTCCTGGATAAGG - Intronic
1175767316 20:61600409-61600431 GTCCTTCGGGGTCCTGGCTCTGG + Intronic
1176071196 20:63227257-63227279 GGCCTTACGGGTCCTGGGTGGGG + Intergenic
1177913371 21:27057649-27057671 GGACTTGTGAATCCTGGCTAGGG - Intergenic
1178211687 21:30541763-30541785 GGCTTTGGTGGTCTGGGCTATGG - Exonic
1179947644 21:44688883-44688905 GCCTTTAGGGGTCCTGGCCAGGG - Intronic
1182460490 22:30480292-30480314 GGTCTTGGGAGTCCTGGCTGAGG - Intergenic
1183744845 22:39686282-39686304 GGCCGGGGGGGTCCTTGCTGCGG - Exonic
1183908928 22:41064197-41064219 GGCCTTGCGGATCTTGGCCAGGG - Intergenic
1184101275 22:42342860-42342882 GGCCTTGGGTGTCCAGCCTAGGG - Intronic
1184406867 22:44305379-44305401 GGCCATGAGGGTCCTGGCCAGGG + Intronic
1184866035 22:47202358-47202380 CGCTTTGGGGGACCTGGCCAGGG - Intergenic
1185109052 22:48890649-48890671 GGCCTTGGGGCTCCAGCCTGGGG + Intergenic
1185217101 22:49607585-49607607 GGCCTTGGGAGTCCTGGCTGAGG - Intronic
951086734 3:18520694-18520716 GGACTTGCGAATCCTGGCTATGG - Intergenic
953165257 3:40459074-40459096 GGCCTTGGGGGTGCTGAGTTGGG + Intronic
953641293 3:44710920-44710942 GGCCTTAGGTGTCCTGGATGAGG - Intergenic
955393270 3:58536514-58536536 GGCTGTGGGGGTGCTGGCAAGGG + Intronic
959717074 3:109444536-109444558 GGCCTTGGGGGTGGTGGATATGG + Intergenic
960986121 3:123282206-123282228 AGCCTTGGGGGTGCTGGGGAGGG - Intergenic
961381615 3:126499437-126499459 GGCCATGGGTGTCCTGCCTTGGG - Intronic
961457431 3:127031185-127031207 GAGCTTGGGGGTCCTGAGTAAGG - Intronic
962041085 3:131708085-131708107 TGGCTTAGGGGTCCTGGCTGTGG + Intronic
963970118 3:151420524-151420546 GGACTTGTGAATCCTGGCTATGG + Intronic
965849690 3:173009408-173009430 GGCCTTTGTAGTCCTGGCCATGG + Intronic
966837297 3:184059044-184059066 GGCCTTGGGGATCCTGCTTCAGG - Intronic
968666283 4:1823977-1823999 GGCCCTTGGGGTCCTCGCTGTGG - Intronic
968934372 4:3602264-3602286 TGCCTTGGGGGCCCTGCCTGGGG + Intergenic
969728376 4:8939198-8939220 CGCCTTGGGGGACCTGGGTGGGG - Intergenic
976135018 4:81926446-81926468 GGCAGTGGGGGTCCTGGGGATGG - Intronic
976507410 4:85864247-85864269 GGCCATGGGAGTCCTTGGTAAGG - Intronic
977489892 4:97698648-97698670 GGCCCTGTGAATCCTGGCTATGG + Intronic
982317245 4:154044186-154044208 GGCCTCCAGGGTCCTGGCCACGG - Intergenic
986717150 5:10532978-10533000 AGCCTTGGCGCTCCTGGCTGTGG - Intergenic
994591960 5:101784486-101784508 TGCCTTGGTGGTCCTGGGAATGG + Intergenic
996835456 5:127787008-127787030 GGCCATGGGGGTTCTGGCTCCGG + Intergenic
998008849 5:138676882-138676904 GACCTTGGTGGTCCTGCCTCAGG - Intronic
999108310 5:149093395-149093417 GGGCTTGCAGGTGCTGGCTATGG - Intergenic
999218218 5:149954049-149954071 GACATCGGGGGTCCTTGCTATGG + Intergenic
1001276066 5:170352683-170352705 GTCCTTGTGGGCCCTGGCCATGG - Intergenic
1002171122 5:177375090-177375112 GGCATTGGTGGTCCTGGCAGGGG + Intergenic
1002998176 6:2306194-2306216 GGACCTGTGAGTCCTGGCTATGG - Intergenic
1005835069 6:29702628-29702650 AGCCTGGGAGGTCCTGGCTAGGG + Intergenic
1005946877 6:30601983-30602005 GGCCATGATGGTCCTGGCCACGG - Exonic
1006362905 6:33597091-33597113 GGCCTTGGAGGCCCTGCCTCTGG + Intergenic
1006503578 6:34473609-34473631 GGGGTTGGGGGTCCAGGCTGAGG + Intronic
1006945115 6:37779582-37779604 GACCTTGGGGGGCCTGGCCCAGG - Intergenic
1007108148 6:39297341-39297363 GGCTTTGGGTGGCCTGGCTGAGG + Intergenic
1013067771 6:106700228-106700250 GACCATGGGGGTCCTGGGTCTGG + Intergenic
1014060638 6:117067578-117067600 GGCCTTTGGGGGCGGGGCTAGGG + Intergenic
1015527493 6:134187449-134187471 GGACCTGTGGATCCTGGCTATGG + Intronic
1018168783 6:161127133-161127155 GGCCTTTTGGGACCTGGGTAAGG - Intergenic
1018673145 6:166195950-166195972 CGCCTTGGGGCTCCCTGCTAGGG - Intergenic
1019492994 7:1323771-1323793 GTCCCTGGGTGTCCTGGCTGCGG + Intergenic
1021791644 7:24211847-24211869 GGCCTTGGGGTACCTGGCTGAGG - Intergenic
1022516537 7:30978274-30978296 GGCCCTGGGGGTCCTGGGAGGGG + Intronic
1023852660 7:44158909-44158931 GGCCTTGGGGGTCCTGGCTAGGG - Intronic
1028979010 7:96946053-96946075 AGCTTTGGAGGTCCTGGCCAAGG - Intergenic
1029131242 7:98332902-98332924 GGCTTTGAGAGTCCTGGCAAGGG - Intronic
1031682205 7:124688690-124688712 GGACTTGTGAATCCTGGCTATGG - Intergenic
1032076829 7:128840017-128840039 GGCGTTGGGGTTACAGGCTAGGG - Exonic
1033651486 7:143346804-143346826 GGCATCGGTGGTCCTGGCCAGGG + Intronic
1033691373 7:143740653-143740675 GGCCTGGGTGGTGGTGGCTATGG + Intergenic
1034132212 7:148730134-148730156 GGCCGTGGGGGTTCTGGCTCCGG - Exonic
1035383017 7:158452446-158452468 GGCCTTGAGGAGCCTGGCGACGG - Intronic
1035661522 8:1351889-1351911 GGCCGTGCGGGTCCTGACTGTGG + Intergenic
1036008316 8:4692441-4692463 GTCCTTGAAGCTCCTGGCTATGG + Intronic
1037630743 8:20653449-20653471 GGCCTTGGGGGTGATGCCCATGG + Intergenic
1037961760 8:23103120-23103142 GGTCTTGGGGATCCGGGCCATGG - Exonic
1043946436 8:86259186-86259208 AGCATTGGGTGTCCTGGCTGTGG - Intronic
1046903350 8:119545750-119545772 GGCGCTGGGGGTCCTGGCCATGG - Intergenic
1049185115 8:141246408-141246430 GGCCCTGGGGGTGTTGGCTGAGG + Intronic
1049331956 8:142059369-142059391 GACCTTGGAGGCCCTGGCTCAGG - Intergenic
1049475357 8:142794667-142794689 GGCCTCGGGGGCCGTGGCTGGGG - Intergenic
1049592515 8:143469021-143469043 GGCCCTGGGGAGCCTGGCCAGGG - Intronic
1049706975 8:144047547-144047569 GGCCTTGGGTGTCTTGGGAAGGG - Intergenic
1051368205 9:16336069-16336091 GGGGTTGGGGGTGCTGGCCAAGG + Intergenic
1052994708 9:34545691-34545713 GGCCTGAGGGTGCCTGGCTAGGG + Intergenic
1053446764 9:38158857-38158879 GGCCATGGGGGTCCCTGCTGAGG - Intergenic
1059424924 9:114215060-114215082 AGCCTTGGCAGTCCTGGCCAGGG - Intronic
1060413262 9:123413737-123413759 GGAGTTGGGGGTGCTGCCTAGGG + Intronic
1060597636 9:124857740-124857762 GGCCTGGAGAGTCCTGGCCATGG - Exonic
1061370773 9:130196166-130196188 GGGCTGGGGGGTCCTGCCCAAGG - Intronic
1061881165 9:133569820-133569842 GGACTTGGGGGCCCAGGCTGGGG - Intronic
1062459338 9:136656400-136656422 GGTCTTGGGAGTCCTGGGGAGGG - Intergenic
1062518328 9:136947001-136947023 GGCCTTGGTGGTACTGGCGCCGG - Intronic
1062538587 9:137031678-137031700 AGGCTTGGGGGTCCTGGCCGGGG - Exonic
1203361477 Un_KI270442v1:221370-221392 GGCATTGGGCCTCCTGGCCATGG - Intergenic
1190625179 X:52330457-52330479 GGACTTGTGAATCCTGGCTATGG + Intergenic
1190928757 X:54931047-54931069 ATCCCTGTGGGTCCTGGCTATGG - Intronic
1191576818 X:62715346-62715368 GGTCTTAGGTGTCATGGCTATGG + Intergenic
1192554996 X:72082191-72082213 GGGCTTGGGAGTCTGGGCTAGGG + Intergenic
1193555737 X:82951663-82951685 GCCCTTGGTGGTGGTGGCTATGG - Intergenic
1197214661 X:123856867-123856889 TGGCTTGGGGGTTCTGGCTCTGG + Intergenic
1200705867 Y:6442006-6442028 GGCCTAGGGTTTCCTGGGTATGG - Intergenic
1200709063 Y:6467716-6467738 AGCCTAGGGGTTCCTGGGTATGG - Intergenic
1201025049 Y:9696993-9697015 AGCCTAGGGGTTCCTGGGTATGG + Intergenic
1201028244 Y:9722702-9722724 GGCCTAGGGTTTCCTGGGTATGG + Intergenic
1201245047 Y:11995196-11995218 GGGCTTGGGTGTCCTGTGTAGGG + Intergenic
1202183029 Y:22155851-22155873 GACCTAGGGGTTCCTGGGTATGG - Intergenic
1202208330 Y:22430550-22430572 GACCTAGGGGTTCCTGGGTATGG + Intergenic