ID: 1023853335

View in Genome Browser
Species Human (GRCh38)
Location 7:44163050-44163072
Sequence CCCCTCCCTAGGCAATGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 156}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023853335_1023853342 25 Left 1023853335 7:44163050-44163072 CCTGTGCATTGCCTAGGGAGGGG 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1023853342 7:44163098-44163120 GCTGAGAGGCAGGATAACACTGG 0: 1
1: 0
2: 1
3: 12
4: 180
1023853335_1023853344 27 Left 1023853335 7:44163050-44163072 CCTGTGCATTGCCTAGGGAGGGG 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1023853344 7:44163100-44163122 TGAGAGGCAGGATAACACTGGGG 0: 1
1: 0
2: 2
3: 23
4: 293
1023853335_1023853341 15 Left 1023853335 7:44163050-44163072 CCTGTGCATTGCCTAGGGAGGGG 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1023853341 7:44163088-44163110 AAGACTCTGTGCTGAGAGGCAGG 0: 1
1: 0
2: 1
3: 35
4: 285
1023853335_1023853343 26 Left 1023853335 7:44163050-44163072 CCTGTGCATTGCCTAGGGAGGGG 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1023853343 7:44163099-44163121 CTGAGAGGCAGGATAACACTGGG No data
1023853335_1023853339 11 Left 1023853335 7:44163050-44163072 CCTGTGCATTGCCTAGGGAGGGG 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1023853339 7:44163084-44163106 ATCCAAGACTCTGTGCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023853335 Original CRISPR CCCCTCCCTAGGCAATGCAC AGG (reversed) Intronic
902301886 1:15507751-15507773 CCCAACCCTAGGCAGTGCAGTGG - Intronic
904533134 1:31182093-31182115 CCCCGCCCCAGGCCCTGCACGGG - Intronic
906087529 1:43148619-43148641 CCCCTCCCTGGACAACCCACAGG + Intronic
906565487 1:46798215-46798237 ACCCTCCCCAGGCAAGGCAGTGG + Intronic
906729826 1:48071380-48071402 CCCATCCCTAGAGAATGTACAGG - Intergenic
908602951 1:65761173-65761195 CCCTTCCTTAGGCAATTCGCTGG + Intergenic
912727261 1:112069233-112069255 CCCCTCCCTAGGCTCAGCTCAGG + Intergenic
913963024 1:143353910-143353932 CCCCTCACTGGGCAACGCCCGGG - Intergenic
914057379 1:144179495-144179517 CCCCTCACTGGGCAACGCCCGGG - Intergenic
914121767 1:144786871-144786893 CCCCTCACTGGGCAACGCCCGGG + Intergenic
915587859 1:156854043-156854065 CCTCTTCCTGGGCTATGCACTGG - Exonic
916147254 1:161750603-161750625 CTCCTCCCTAGGCAAAGCCCAGG - Intronic
918418324 1:184335808-184335830 CCCCTCCTTAGGCAATCTAATGG - Intergenic
919836884 1:201581032-201581054 CCTTTCCCTATGCCATGCACCGG - Intergenic
919920372 1:202163558-202163580 CCCCTCCCTAGCCCAGGCCCGGG + Intergenic
923063277 1:230496446-230496468 TCACTCCATAGACAATGCACTGG + Intergenic
924815380 1:247437084-247437106 CATCTCCTAAGGCAATGCACTGG - Intronic
1065917656 10:30366344-30366366 GCACTCCCTAGGCAAGGTACAGG - Intronic
1067459198 10:46444929-46444951 CCCCTAACTAGGCAATTCAGTGG + Intergenic
1067627998 10:47939701-47939723 CCCCTAACTAGGCAATTCAGTGG - Intergenic
1069705053 10:70453821-70453843 CCCATCCCTAGGCAACCCATTGG - Intergenic
1071073934 10:81729138-81729160 CCCTTCCCTAGTCAAGGCAGAGG - Intergenic
1076215233 10:128687874-128687896 CCCCTCCCTAGGAAGTCCATTGG - Intergenic
1076561767 10:131371656-131371678 TCCCTCCCCAGGAAGTGCACGGG + Intergenic
1077528473 11:3083483-3083505 CCCCTCCCTAGGAAGTGGCCAGG - Intergenic
1078656657 11:13246942-13246964 CCCCTCCAAGGGCAATCCACTGG + Intergenic
1079117922 11:17652292-17652314 CCCCTCCCTGGGCAGAGCACAGG - Intergenic
1083638112 11:64131157-64131179 CCCCGCCCCAGGCACTGCAGAGG + Intronic
1085298863 11:75446720-75446742 AGCCCCCCAAGGCAATGCACAGG + Intronic
1089681165 11:120119760-120119782 CCCCACCCTAGACATAGCACTGG - Intronic
1092409045 12:8240229-8240251 CCCCACCCTGGGCAAAGCAAGGG + Intergenic
1096875871 12:54630045-54630067 CCCCTCCCCAGGCCAGGCACAGG - Intergenic
1103560654 12:121791878-121791900 CCCCTCCCTGGCTACTGCACAGG + Intronic
1104091191 12:125519123-125519145 CCCCTCCCCAGCCCAGGCACGGG - Intronic
1104458804 12:128937367-128937389 TCCCTCCCAAGGCCATGCACAGG - Intronic
1105287038 13:19012896-19012918 CCCTTCCCTGGACAATCCACAGG + Intergenic
1105590724 13:21790698-21790720 CCCCTCCTTAGGCAATCTAGTGG - Intergenic
1113798771 13:113075709-113075731 CCCCGCCCTGGGTAATTCACTGG + Intronic
1115783928 14:36802976-36802998 CACCTAGCTAAGCAATGCACAGG - Intronic
1120928487 14:89822493-89822515 CCCCACCCTTGGCACTCCACTGG + Intronic
1120929480 14:89834489-89834511 CCCTTCTCCAGGCAAGGCACTGG + Intronic
1121244376 14:92451519-92451541 CCCCACCCAAAGGAATGCACGGG + Intronic
1121521649 14:94590192-94590214 CCCCTACCAAGGCAATGCCACGG + Exonic
1122759692 14:104013798-104013820 CCCCTCCTTAGGCAACACAGTGG - Intronic
1122982557 14:105198221-105198243 CCCCTCCCTCAGCAAGCCACTGG + Intergenic
1123443723 15:20306886-20306908 CCCCTCCTTTGGCCCTGCACTGG + Intergenic
1124371826 15:29108423-29108445 CCCCTCCCTGGGCCCTGCAGTGG - Intronic
1124911105 15:33921589-33921611 ACCATCTCAAGGCAATGCACAGG - Intronic
1127310832 15:57750875-57750897 CCCAACTCTAGGAAATGCACAGG - Intronic
1129903946 15:79172860-79172882 CCCCTCTCTAGGCACTGCCGTGG + Intergenic
1132545368 16:530631-530653 CACCTCCCTGGGCCACGCACCGG - Intronic
1133350013 16:5095037-5095059 CCCCACCCTGGGCAAAGCAAGGG + Intronic
1134470719 16:14522794-14522816 CCCCACCCCAGGCCATGGACAGG - Intronic
1136707461 16:32201703-32201725 CCACTCCCAAGGGAAGGCACTGG + Intergenic
1136760450 16:32727714-32727736 CCACTCCCAAGGGAAGGCACTGG - Intergenic
1136807653 16:33142672-33142694 CCACTCCCAAGGGAAGGCACTGG + Intergenic
1137755808 16:50901209-50901231 ACCCTCCCATGGCCATGCACAGG - Intergenic
1138420788 16:56897835-56897857 CCCTTGCCTAGGCACTGCCCAGG + Intronic
1140583839 16:76263595-76263617 CCCCTCCCTATACCATGGACTGG - Intergenic
1141196224 16:81863671-81863693 ACCTTCCCAAGGCAGTGCACAGG + Intronic
1203062603 16_KI270728v1_random:988029-988051 CCACTCCCAAGGGAAGGCACTGG - Intergenic
1142510097 17:387464-387486 CCCCACCCTAGACCAGGCACCGG + Intergenic
1142510111 17:387518-387540 CCCCACCCTAGACCAGGCACCGG + Intergenic
1143162718 17:4881813-4881835 CCCCTCCCTAGCCTGGGCACTGG + Intronic
1147163380 17:38580311-38580333 CCCCTCCCTGGGCAATGGTTGGG + Intronic
1149991196 17:61384562-61384584 CTCCTCCCTGGGCCATCCACAGG + Intronic
1150128625 17:62654136-62654158 CCCCTCCCCAGGCCACGCAGAGG - Intronic
1151516824 17:74601785-74601807 TCCCTCCCTGGGCACTGCCCAGG - Intergenic
1151597786 17:75088517-75088539 CTCCTCCCTAGGCCAACCACAGG + Intronic
1159672306 18:71236814-71236836 CCTTTCCCTAGTCAATGCACTGG + Intergenic
1160788913 19:913690-913712 CCCCTCCCTCGTCGATGCTCAGG - Intergenic
1163635460 19:18435201-18435223 CCCCTGGCTAAGCTATGCACAGG - Intronic
1202696863 1_KI270712v1_random:132168-132190 CCCCTCACTGGGCAACGCCCGGG - Intergenic
928260090 2:29758638-29758660 TCCCTCCCCAGGCACTGCTCAGG + Intronic
928287574 2:30006660-30006682 CCCCTCTCCAGGCAACTCACAGG - Intergenic
929141563 2:38671064-38671086 CCCTTTCCTGGGCAAGGCACTGG - Intronic
931285941 2:60831771-60831793 CCCCTCCTTAGGCAACCCAGTGG + Intergenic
934278021 2:91589182-91589204 CCCCTCACTGGGCAACGCCCGGG - Intergenic
935943119 2:108262169-108262191 CTCCTGCCTAGTCAATGCACTGG + Intronic
937042368 2:118832615-118832637 TCCCACCTTAGCCAATGCACAGG - Intergenic
939928265 2:148201072-148201094 CCCCTCCCCAGGCCTTGCTCAGG + Intronic
944539808 2:200744334-200744356 CCCCTCCATAGGCGATGCTCAGG - Intergenic
947821684 2:233075844-233075866 ACCCTGCATAGCCAATGCACAGG - Intronic
948444339 2:238020429-238020451 CCCATCCCTAGGCTCCGCACTGG - Intronic
1172441683 20:34970673-34970695 CCCCTCTGTAGACAATGCTCAGG - Intergenic
1175970527 20:62684582-62684604 ACCCTCCCTAGGGACTGAACTGG - Intronic
1175987774 20:62772422-62772444 TGCCTCTCTAGGCATTGCACTGG + Intergenic
1176020234 20:62958980-62959002 CGCCTCCCCAGGCACTGCCCAGG + Intronic
1179595071 21:42437947-42437969 CCCTTCCCAGGGCAATGCACTGG + Intronic
1180198871 21:46213154-46213176 CCCCTCCCGAGGCCTGGCACTGG + Intronic
1180258216 21:46648877-46648899 CCCCGCCCCACGCAATTCACGGG - Intronic
1181051585 22:20240610-20240632 CCCCTCCCCAGCCACTGCCCTGG + Intergenic
1181758326 22:25040816-25040838 CCTCTCCCGAGGCAACGTACTGG - Exonic
1184191776 22:42899739-42899761 CCTCTCCCTGGGGAATGCACAGG + Intronic
952847824 3:37702939-37702961 CCTGTCCCTGGGGAATGCACAGG + Intronic
953718452 3:45335403-45335425 GCCCTCCCTGGGCCATGCCCTGG - Intergenic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
957054314 3:75432395-75432417 CCCCACCCTGGGCAAAGCAAGGG + Intergenic
957089870 3:75718862-75718884 CCCATCCCTGGGCCATGGACAGG - Intronic
959824625 3:110778983-110779005 GCCCTCCTTTGGCAAAGCACAGG + Intergenic
961887976 3:130108770-130108792 CCCCACCCTGGGCAAAGCAAGGG + Intronic
962150175 3:132884048-132884070 CCCTTCCCTAGGAAATCCCCAGG - Intergenic
962807752 3:138939050-138939072 CCCCTCCCTCGGGATTCCACAGG + Intergenic
968997119 4:3952701-3952723 CCCCACCCTGGGCAAAGCAAGGG + Intergenic
969032720 4:4227154-4227176 CCCCTCACTGGGCAACGCCCGGG + Intergenic
969448897 4:7261798-7261820 CCCTTCCCCAGGCAAAGCCCAGG - Intronic
969816855 4:9693552-9693574 CCCCACCCTGGGCAAAGCAAGGG - Intergenic
975844302 4:78508793-78508815 CCCCTCCCCAGGCTACCCACTGG + Intronic
977142158 4:93387053-93387075 CCCTGCCCTAGGCAATACAAAGG - Intronic
980690461 4:136290048-136290070 CCCCTCCTGAGGCTATGCTCTGG - Intergenic
982248673 4:153381844-153381866 CCCCTGCTTAGGCAATCCAGTGG + Intronic
986408181 5:7447857-7447879 CCCCTCCCCAGGCTCTGCTCCGG - Intronic
988354138 5:30151257-30151279 CCCCACCCTGGGCATTGCCCTGG + Intergenic
988438112 5:31200306-31200328 CCCCTCTCAATGCAATGAACAGG - Intronic
988978067 5:36535444-36535466 CCTCTCCCCAGGCAATACACAGG + Intergenic
990382095 5:55228127-55228149 CCCCTCCCTAGGAGATGCCTCGG - Intergenic
991037117 5:62138677-62138699 CCCCTCCCTGTGCATTGTACAGG + Intergenic
996085412 5:119300015-119300037 CCCCTTCCTAGGCAAAGAAAGGG - Intronic
996212694 5:120831650-120831672 CCCCTTCCTAGGCAAAGAAAGGG + Intergenic
1001917206 5:175571705-175571727 CCCCTCCCTCTGCATTGCAGAGG + Intergenic
1001943091 5:175754396-175754418 CCCCTCCAAAGGCATTGCATTGG + Intergenic
1002699095 5:181109915-181109937 CCCCTCTGTAGGCATTGCCCTGG - Intergenic
1004178111 6:13358494-13358516 CCCTCCCCTGGGCAAGGCACAGG + Exonic
1006425750 6:33961948-33961970 CCCCTCCCCAGGCACACCACTGG + Intergenic
1007375081 6:41451108-41451130 GCCCTCTCTAGGGAAAGCACTGG - Intergenic
1007665073 6:43509121-43509143 CCCCTCCCTGTGCAATGTCCTGG - Intronic
1010741609 6:79512378-79512400 CCCGTCCCTGGGCATGGCACTGG + Intronic
1011255328 6:85414832-85414854 CCCCTCTCTAGGCATTACCCTGG + Intergenic
1013112735 6:107077399-107077421 CCCCTCCTTAGGCAACCCAGTGG + Intronic
1015726960 6:136309101-136309123 CACCACCCCAGGCAAGGCACAGG + Intergenic
1019797086 7:3058338-3058360 CCCCCCCATTGGCAGTGCACAGG - Intergenic
1020463438 7:8449281-8449303 CCCCTTCCAAGGCATTGCCCTGG + Intronic
1022683995 7:32577607-32577629 CTCCTCCCTGGGCCCTGCACTGG + Intronic
1023366936 7:39474163-39474185 CCCGTCCCTTGGCAAAGCAACGG + Intronic
1023853335 7:44163050-44163072 CCCCTCCCTAGGCAATGCACAGG - Intronic
1026382939 7:69817589-69817611 CCCCTCCCTCAGCAACCCACTGG - Intronic
1031331706 7:120473824-120473846 TCCCTCCCTAAGCAAATCACTGG + Intronic
1033661649 7:143407260-143407282 TCCCTCCCCAAGCAAAGCACTGG + Intronic
1035100298 7:156390783-156390805 CACCTCCCCTGGCAGTGCACGGG - Intergenic
1035117912 7:156540215-156540237 CCCCTGCCAGGGCAACGCACAGG + Intergenic
1035302117 7:157904378-157904400 CCCCTCCCGTGGCCCTGCACAGG + Intronic
1036380127 8:8231295-8231317 CCCCACCCTGGGCAAAGCAAGGG - Intergenic
1036849432 8:12191367-12191389 CCCCACCCTGGGCAAAGCAAGGG + Intronic
1036870794 8:12433640-12433662 CCCCACCCTGGGCAAAGCAAGGG + Intronic
1038039839 8:23715236-23715258 CCCCTCCCTAGGCAAGAGGCTGG - Intergenic
1038243755 8:25834595-25834617 CCAATCCCTAGGCCATGGACTGG + Intergenic
1038341672 8:26691386-26691408 CCCCACCTGAGGCACTGCACAGG - Intergenic
1040523137 8:48194795-48194817 GCCTTCCCTATGCAATGCTCTGG - Intergenic
1041114830 8:54525229-54525251 TCCCTTCCAAGGCAATGCAGAGG + Intergenic
1042334981 8:67620508-67620530 CCCTTCTAGAGGCAATGCACAGG + Intronic
1046916125 8:119680094-119680116 ACCCTCCGTAGGCAATCTACTGG + Intergenic
1048971110 8:139645388-139645410 CCCCTCCCTGGGCCATGCTGAGG - Intronic
1049633392 8:143672088-143672110 CCCCGCCCTGCGCAAGGCACAGG - Intergenic
1051438100 9:17054063-17054085 CCCCTCCTTAGGCAACCCAGTGG - Intergenic
1057849619 9:98555226-98555248 CACCTCCCTAGGGAAGGCAGGGG + Intronic
1058724939 9:107793584-107793606 CCCTTCCAAAGGCAATGCACAGG + Intergenic
1059226941 9:112681154-112681176 CCCCTCACTGGGCATTCCACAGG + Intergenic
1059341206 9:113598516-113598538 CCCCACCCTGGGCCATGCCCTGG - Intergenic
1060881700 9:127122381-127122403 CCCCTCCAGAGGCCATGGACAGG - Exonic
1061078380 9:128355387-128355409 CCCCTCCCTAGGTGATGTGCTGG + Exonic
1061880959 9:133568599-133568621 CCCCACACTTGGCAGTGCACTGG - Exonic
1061922803 9:133791351-133791373 CCCCTCCAGGGGCAATGGACAGG - Intronic
1062389160 9:136327314-136327336 CCCCACCCCAGGGAATGCAGGGG - Intergenic
1188015669 X:25105185-25105207 CCCAGCCCTATGCAAAGCACTGG + Intergenic
1188626364 X:32289896-32289918 CCACTCCGTAGGCAGTGCAGTGG - Intronic
1192218821 X:69182912-69182934 CCCCACCCCCAGCAATGCACAGG - Intergenic
1198784664 X:140273989-140274011 CCCCACCCTAGCCAAGGCTCTGG - Intergenic
1200902253 Y:8444636-8444658 ACCCTCCCTAGGCAGGGTACAGG + Intergenic