ID: 1023854395

View in Genome Browser
Species Human (GRCh38)
Location 7:44173271-44173293
Sequence CTCACTGCTCAGCAATGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 255}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023854392_1023854395 3 Left 1023854392 7:44173245-44173267 CCGTAGCACAGCCATACAGTGGA 0: 1
1: 0
2: 0
3: 12
4: 146
Right 1023854395 7:44173271-44173293 CTCACTGCTCAGCAATGGCAAGG 0: 1
1: 0
2: 1
3: 20
4: 255
1023854393_1023854395 -8 Left 1023854393 7:44173256-44173278 CCATACAGTGGAATACTCACTGC 0: 1
1: 0
2: 2
3: 15
4: 116
Right 1023854395 7:44173271-44173293 CTCACTGCTCAGCAATGGCAAGG 0: 1
1: 0
2: 1
3: 20
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023854395 Original CRISPR CTCACTGCTCAGCAATGGCA AGG Intronic
901727221 1:11251217-11251239 CACTCTGCTCAGCCATGGTAGGG + Intronic
902935807 1:19763818-19763840 CCCAGTGCTCAGCAATGGACAGG - Intronic
904830920 1:33306457-33306479 CTCACTGCTAAGCTAAGGGAAGG + Intergenic
905404428 1:37723418-37723440 CTCAGTGCTCTGTAATGGGAAGG - Intronic
906368061 1:45227561-45227583 CTCACAGAGCAGCAAAGGCAAGG - Intronic
906887030 1:49659871-49659893 ATCACTCCTCAGCAAATGCAAGG + Intronic
907259953 1:53210534-53210556 CTCACTGGTCAGGTATGCCAGGG - Exonic
907942829 1:59105770-59105792 CTCACTGCTCAGAAATCTGAAGG - Intergenic
912936099 1:114004912-114004934 CTCACTCCTCACCAAGGGGACGG + Intergenic
915890065 1:159765068-159765090 CTCACTGCACTGCAGTGGTAAGG - Intergenic
916251449 1:162742532-162742554 CTCACTTATCACCAAGGGCATGG + Intronic
918977376 1:191507174-191507196 TTCCCTGCTCACTAATGGCATGG + Intergenic
920298241 1:204973112-204973134 CACACAGCCCAGCAGTGGCAAGG + Intronic
921431049 1:215066513-215066535 CTCACTTTTGAGCACTGGCAAGG - Intronic
922799497 1:228358691-228358713 CTCAGTGCTCAGCAAGGTCAGGG + Intronic
924504833 1:244672249-244672271 CTCACTCATCAGCAAAGGGATGG - Intronic
1062948459 10:1478043-1478065 CTCACAGCTCAGTAAAGGCTCGG - Intronic
1063524372 10:6771042-6771064 CCGACTGCTCAGCTATGCCAAGG + Intergenic
1066034405 10:31467507-31467529 CCCACTCCACAGCAATGGCCAGG - Intronic
1068047092 10:51899873-51899895 CTCACTCATCACCAAGGGCATGG - Intronic
1068708777 10:60108577-60108599 TTCTCTGCTCAGCAAGTGCACGG - Intronic
1069627933 10:69879988-69880010 GTCACTGTTCAGCAGTTGCAGGG + Intronic
1070274568 10:74993161-74993183 CCCAGTGCTCAGCAGTGGCTGGG - Intronic
1071461881 10:85904536-85904558 CACTCTGCTCAGCATTGTCATGG - Intronic
1073785033 10:106879674-106879696 CTCCATCTTCAGCAATGGCAGGG - Intronic
1074557759 10:114507699-114507721 CTCAGTGTCCAGCCATGGCACGG - Intronic
1075973587 10:126675285-126675307 TTCACTGTTCAGCAATGGGACGG + Intergenic
1076987666 11:250935-250957 CACACTGCTCAGCACAGGCTTGG - Intronic
1077938516 11:6815293-6815315 GTCACTGCTCATAGATGGCATGG + Intergenic
1081214160 11:40373684-40373706 CTCACTGATCACCAAGGGGATGG - Intronic
1083304558 11:61755683-61755705 CTCACTGCCCAGCCCTGGGAAGG + Intronic
1084864068 11:72041521-72041543 CTCTCTGGACAGCAATGGAAGGG + Intronic
1085057896 11:73418294-73418316 CTCACTCATCAGCAAGGGGATGG - Intronic
1085264729 11:75230523-75230545 CTGACTGCCCAGCATTGGCTTGG - Intergenic
1085636520 11:78163466-78163488 CTCTCTGCTCAGGAATGGTGGGG + Intergenic
1085637095 11:78167336-78167358 CTCTCTGCTCAGGAATGGTGGGG + Intergenic
1090131300 11:124145278-124145300 CTGGCTGCACAGCAATGGTAAGG + Exonic
1090222003 11:125034651-125034673 TTCACTGCTCATGAAAGGCAAGG - Intronic
1090608877 11:128452393-128452415 CACAATGCTCAACAATGGCAGGG + Intergenic
1090871421 11:130753125-130753147 CTCACTTATCACCAAGGGCATGG - Intergenic
1091086683 11:132727848-132727870 ATGACAGCTCAGCAGTGGCAAGG + Intronic
1091207225 11:133830203-133830225 CACACAGCTCAGCAAAGGCATGG + Intergenic
1092241679 12:6839725-6839747 CTCCCTGAACAGAAATGGCAGGG + Exonic
1096829141 12:54300937-54300959 CTCAGCGCTCAGCAATGGCCCGG - Intronic
1098860848 12:75708358-75708380 CTCATTGCACCGCAGTGGCAGGG + Intergenic
1099238906 12:80115783-80115805 ACCACTGCTCAGCAAAGGCCCGG - Intergenic
1099717940 12:86320641-86320663 CTCACTGCTGATCAGTGGCAGGG + Intronic
1101477768 12:105066700-105066722 CCCAATGATCAACAATGGCATGG + Intronic
1104240960 12:126989082-126989104 CTCAATGCTCAGCACTGTCATGG + Intergenic
1106856758 13:33861703-33861725 ATCACTGCACTTCAATGGCAAGG + Intronic
1107021142 13:35752900-35752922 CTCACTTATCACCAAGGGCATGG + Intergenic
1107739057 13:43429600-43429622 TTCAATGACCAGCAATGGCAGGG + Intronic
1108731058 13:53236270-53236292 CTCACTGATCACCAAGGGGATGG - Intergenic
1108774351 13:53746088-53746110 CACTCTGCTCAGCTATGGCCAGG + Intergenic
1108893457 13:55293490-55293512 CTCACTTATCACCAAGGGCATGG - Intergenic
1111183065 13:84694117-84694139 CTGTCTGCCCAGCACTGGCAGGG - Intergenic
1112039717 13:95534894-95534916 CTCACAGCTCAGCAGGGACATGG + Intronic
1114744989 14:25137044-25137066 CTCAAACCTCAGCAATGGCGGGG - Intergenic
1115202498 14:30869872-30869894 CTCACTGCTAAACTATGGCCTGG - Intergenic
1116531847 14:45981260-45981282 TTCACTGCTCATGAAAGGCAAGG - Intergenic
1117824643 14:59688484-59688506 CTCCCTGCTCAGCCCTGGAAGGG - Intronic
1118486788 14:66221990-66222012 CTCACTGCTGAGCAAGGAGATGG - Intergenic
1119188901 14:72665297-72665319 GTGACTGCTCAGCACTGTCAAGG - Intronic
1120121111 14:80680894-80680916 CTCTCTGCTCAGCACTGGTGGGG - Intronic
1120400572 14:84025596-84025618 CTCACAGTTCAGCAATGACTAGG + Intergenic
1121278696 14:92685259-92685281 CTCACTGCTCCCCTAAGGCAGGG - Intronic
1122031434 14:98915367-98915389 CACATTGCACAGCAATGGTAAGG + Intergenic
1122204829 14:100143187-100143209 CTCACTCCTCAGGAGAGGCAGGG - Intronic
1124139296 15:27063438-27063460 CTCACTCATCAGCAAGGGGATGG - Intronic
1124150239 15:27171119-27171141 TTCACTGCTCAGCAGGGGCTGGG + Intronic
1124382981 15:29183362-29183384 CGCACTCCACAGCGATGGCAGGG - Intronic
1127241503 15:57120478-57120500 CTGAGAGCTCATCAATGGCAGGG - Intronic
1128175868 15:65555157-65555179 CACACTGCTAATAAATGGCAGGG - Intronic
1128438050 15:67675251-67675273 ATTACTGCTCAGCAATAGAAAGG + Intronic
1130120400 15:81042604-81042626 CTTAATGCTCTGTAATGGCATGG - Intronic
1132026812 15:98410900-98410922 ATCACTGTCCAGCACTGGCATGG - Intergenic
1134044293 16:11089885-11089907 CTCATTGATGAGCAAAGGCAGGG - Intronic
1134126577 16:11620286-11620308 CTCACTCATCAGCAAGGGGATGG - Intronic
1134703592 16:16285485-16285507 CCCACTGCTCAGAGATGGCGAGG + Exonic
1134915083 16:18062649-18062671 CTCCCAGCGCAGCAAAGGCAGGG + Intergenic
1134963951 16:18426629-18426651 CCCACTGCTCAGAGATGGCGAGG - Exonic
1134968238 16:18509165-18509187 CCCACTGCTCAGAGATGGCGAGG - Intronic
1136915142 16:34183094-34183116 CACACTGCTCATCAAAGGAAAGG + Intergenic
1138397740 16:56718907-56718929 AACACTACTCAGCAATGGAAAGG - Intronic
1138505149 16:57474824-57474846 CTCACTGCGCCGCTATGGCCGGG - Exonic
1139186741 16:64814811-64814833 CTAAGTGCTAATCAATGGCAGGG - Intergenic
1139848805 16:69938571-69938593 CTCACTGCAGAGCAGTGGCACGG - Intronic
1140067173 16:71621470-71621492 CTCACTTATCAACAATGGAATGG + Intergenic
1140490024 16:75327670-75327692 TTCACTACTGAGCCATGGCATGG - Intronic
1140885585 16:79239817-79239839 TTCAATGCCCAGCCATGGCAGGG + Intergenic
1141135544 16:81462821-81462843 CTCACTGCTCAGCTTTGCCCTGG + Intronic
1141876133 16:86825789-86825811 CACACAGCTCAAAAATGGCAAGG - Intergenic
1142034991 16:87857128-87857150 CTCTCTGGCCAGCAGTGGCAGGG - Intronic
1144455039 17:15412002-15412024 TTCACTGCTCAGCAAAGACAGGG - Intergenic
1146676327 17:34775997-34776019 CACACAGCTCATAAATGGCAGGG + Intergenic
1146683448 17:34824745-34824767 CTCATTGCTGAGCAGAGGCAGGG - Intergenic
1149407749 17:56371761-56371783 CTCACTGCTCAGCACAAGAAAGG + Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1151366926 17:73623581-73623603 CTCTCTGCTCTGCAAAAGCAGGG + Intronic
1151620784 17:75243633-75243655 CTCCCTCCACAGCAATGGCGTGG + Intronic
1156151316 18:34246779-34246801 CACACTTGTCAGCCATGGCAGGG + Intergenic
1156551628 18:38025205-38025227 CTCAAAGCTCAGCACTGGGAAGG - Intergenic
1157069571 18:44390279-44390301 CTCTAAGCTCAGCAAAGGCAGGG + Intergenic
1157426268 18:47586948-47586970 CCCACAGCTCAGCAGTGGTAGGG - Intergenic
1157475662 18:48021916-48021938 CTGACTACTCAGCAACAGCAGGG + Intergenic
1158446791 18:57529105-57529127 CTCACTGGTCACCAAGGGGATGG + Intergenic
1160131626 18:76230550-76230572 CTCACTGCTCTGGAAGGGTAGGG + Intergenic
1160147745 18:76378714-76378736 CTCTCAGCTCAGCAGTGGGATGG + Intronic
1161817838 19:6510747-6510769 CTCACTGCTAGGCAATGGGGTGG - Intergenic
1161829963 19:6595573-6595595 TTCACTGCTCAGCAAGTGCGTGG + Intronic
1164710723 19:30355325-30355347 CTCACTCATCACCAATGGGATGG + Intronic
1164915946 19:32052486-32052508 TTCACCTCCCAGCAATGGCAGGG + Intergenic
1165489064 19:36112958-36112980 CACACTGGTGAGCAGTGGCAGGG + Exonic
1165839227 19:38777476-38777498 GTCAATGCTCAGCAGTGGCCAGG - Intergenic
1166932974 19:46312501-46312523 CTCAGTGCTGAGCAAGGGCCAGG + Exonic
1167267261 19:48489766-48489788 CACACAGCTAAGAAATGGCAGGG + Intronic
925177597 2:1796394-1796416 CTCCCTGGTCAGCACGGGCATGG - Intronic
925312301 2:2893759-2893781 GTCCCTGCCCACCAATGGCATGG - Intergenic
927625994 2:24719115-24719137 AACACTGCTCAGCAATGAAAAGG + Intronic
930202621 2:48559661-48559683 GTCACTGCTAGGCAGTGGCAGGG + Intronic
930485495 2:52006905-52006927 CTCACTGCCCGGCACCGGCAGGG - Intergenic
932063074 2:68527682-68527704 CTCACTGCCCAGACAGGGCAGGG + Intronic
932430487 2:71671208-71671230 GTCACTCCACAGCAATGGCTCGG - Intronic
933202438 2:79466337-79466359 CTCAAACCTCAGCAATGGCGGGG - Intronic
933490365 2:82978403-82978425 CTCACTCATCACCAATGGGATGG - Intergenic
936946328 2:117934248-117934270 CTTCCTGCAGAGCAATGGCAAGG + Intronic
937040975 2:118820386-118820408 CTCTCTGCCCACCAGTGGCAGGG - Intergenic
938657714 2:133451641-133451663 CTCTCTGCCCTGCAATGGGAAGG - Intronic
938749008 2:134310911-134310933 CTGGCTGCTCAGCCATGGCTGGG - Intronic
939067026 2:137495699-137495721 CTCACTGCTCAGAAATGTATGGG - Intronic
939688274 2:145226481-145226503 CTCACTATTCAGCACTGGAAAGG - Intergenic
940649385 2:156426261-156426283 CTCACTGTTCAGCATGGCCAGGG + Intergenic
941571869 2:167180723-167180745 GGCACTGCTCAACAATGGTAAGG - Intronic
942592414 2:177560213-177560235 CTCACTCATCAGCAAGGGGATGG + Intergenic
946476611 2:220012022-220012044 CTCACTTCTCAGTCATGACATGG - Intergenic
948650936 2:239443294-239443316 CAAACTGCCCAGCAATGCCAGGG - Intergenic
1169419419 20:5447928-5447950 CTCACTGCTGAACAATGCCCTGG + Intergenic
1171373434 20:24676120-24676142 CTCACAACTCAGGCATGGCAGGG - Intergenic
1171819106 20:29817174-29817196 CTCAAGCCTCAGCAATGGCAGGG - Intergenic
1171898720 20:30836009-30836031 CTCAAGCCTCAGCAATGGCAGGG + Intergenic
1174441739 20:50561087-50561109 CACCCTGCACAGCAAAGGCATGG - Intronic
1176692538 21:9933514-9933536 TTCCTTGCTCAGCATTGGCAGGG + Intergenic
1179097066 21:38325388-38325410 GCCACAGCTCAGCAATGGGAAGG + Intergenic
1180323088 22:11341871-11341893 CTCAAGCCTCGGCAATGGCAGGG - Intergenic
1181302344 22:21889807-21889829 CTCACTCCTCAGGAATTGCTGGG - Intergenic
1181483854 22:23218460-23218482 GTCCCTGCTCAGCCTTGGCACGG + Intronic
1182747017 22:32613964-32613986 CACACAGCTCAGCAGTGGTAGGG - Intronic
1184373419 22:44097107-44097129 CACACAGCTCAGAGATGGCATGG + Intronic
949519479 3:4836808-4836830 ATCACTGCTGACCAATGACATGG - Exonic
953784051 3:45897124-45897146 CTCAGTGCACAGCCAGGGCAAGG - Intronic
954590165 3:51776265-51776287 CTCAATCCTCAGCAATAGTAAGG + Intergenic
955626399 3:60924017-60924039 CTCAAGCCTCGGCAATGGCAGGG - Intronic
959740032 3:109707865-109707887 CTCACTGGTCATCTAGGGCACGG - Intergenic
962652825 3:137513549-137513571 CACACTGGTCATCAATGGGAAGG + Intergenic
962925441 3:139988985-139989007 CTCCCTCCTCAGCAAGGGCAGGG + Intronic
963060321 3:141220242-141220264 CTTTCTTCTTAGCAATGGCAAGG - Intergenic
963849357 3:150194784-150194806 CTCACTTATCACCAATGGGATGG + Intergenic
964127597 3:153252059-153252081 CTCACTGATCACCAAGGGGATGG + Intergenic
964564476 3:158034588-158034610 CTCAAGCCTCAGCAATGGCAGGG - Intergenic
967451324 3:189626626-189626648 CTCTCTGCTCAGTCATGGTAGGG + Intergenic
968439056 4:612428-612450 TTAACTGCTCAGCGAAGGCAGGG + Intergenic
968698978 4:2045897-2045919 GTCACTGCTCGGCCATGCCAGGG - Intergenic
970628525 4:17916409-17916431 CTCACTTATCAGCAAGGGGATGG - Intronic
970845528 4:20533446-20533468 TTCACTGCCCAGCACTGCCAGGG - Intronic
971372685 4:26030877-26030899 GACACGGCGCAGCAATGGCATGG - Intergenic
971618750 4:28828102-28828124 CTCACTGCCCAGGGCTGGCAGGG - Intergenic
971970219 4:33609827-33609849 AACACTCCTCAGCAAAGGCAAGG + Intergenic
973012339 4:45092719-45092741 CTCACTGATCACCAAGGGGATGG + Intergenic
975477819 4:74843442-74843464 CTCACTGCTGAGTATTGGAAGGG - Intergenic
976117897 4:81747783-81747805 CTCACTGGGCAGCAATGGGCTGG - Intronic
980002074 4:127501363-127501385 CTCACAGCACAGCAGTGCCAGGG + Intergenic
980365123 4:131793729-131793751 TTCCTTGCTCAGCATTGGCAGGG + Intergenic
980666026 4:135936609-135936631 CTCACAGCTCACAAGTGGCAAGG + Intergenic
981048238 4:140285722-140285744 CTAACTGCTTAGCAATGTCTTGG - Intronic
981719399 4:147786412-147786434 CTTAGTTCTTAGCAATGGCAGGG + Intronic
984673183 4:182516069-182516091 GTCACAGCTGACCAATGGCATGG - Intronic
985392741 4:189507438-189507460 CACACTCCTCAGCAATGCCTGGG + Intergenic
985997818 5:3606501-3606523 CTCACTGCCCAGAAAGGGCCAGG - Intergenic
987186895 5:15430667-15430689 ACCACTGCTCAGCAATAACAAGG - Intergenic
988646864 5:33104764-33104786 CTCCCTGCTCAGCACTGGGGAGG + Intergenic
990188120 5:53229815-53229837 CTCAAGCCTGAGCAATGGCAGGG + Intergenic
991136468 5:63187445-63187467 CTCACTGATCACCAAGGGGATGG + Intergenic
991209468 5:64087631-64087653 CTCAAGCCTCTGCAATGGCAGGG - Intergenic
991307776 5:65198615-65198637 CTAACTGCTCACCACTGTCATGG - Intronic
993791391 5:92215842-92215864 TTCACTGCTCATGAAAGGCAAGG + Intergenic
993956077 5:94234727-94234749 CTCACTTATCACCAATGGGATGG + Intronic
994502519 5:100597967-100597989 CTTACTGATCAGGAATGACAAGG + Intergenic
995373434 5:111447010-111447032 ATCACAGCTTAGAAATGGCAAGG + Intronic
997576023 5:134977978-134978000 CTCACTTATCACCAATGGAATGG + Intronic
998673578 5:144381660-144381682 CTCACTTATCACCAATGGGATGG + Intronic
1000223687 5:159237667-159237689 TTCACTGCTCTGCAGAGGCAAGG - Intergenic
1003132026 6:3402810-3402832 CTCAACACTCAACAATGGCAAGG + Intronic
1005345413 6:24884585-24884607 CTCACTCCTCAGCAAGGGGATGG + Intronic
1007078631 6:39083595-39083617 CACACAGCTCGGCAGTGGCAGGG - Intronic
1007733318 6:43965059-43965081 CCGACAGCTCAGCAATGACATGG - Intergenic
1008725356 6:54411426-54411448 CTCTGTGCTGAGCAGTGGCAAGG + Intergenic
1009390750 6:63140471-63140493 CCCACTGCCCTGAAATGGCAAGG + Intergenic
1010553516 6:77251965-77251987 CTCACGCCTCAGCAATGGCAGGG - Intergenic
1011699500 6:89942521-89942543 CTCACTTCCCAGCAGTGGCTTGG + Intronic
1012857818 6:104523841-104523863 CTCATAGCAAAGCAATGGCAAGG + Intergenic
1013126388 6:107188688-107188710 CTCACTCGTCACCAAGGGCATGG - Intronic
1013308931 6:108875295-108875317 CACACTACTCTGCAATGGAAAGG - Intronic
1014001084 6:116367168-116367190 CTGAATGCTCAGAAATGGAAGGG + Intronic
1014127032 6:117788473-117788495 GTTACTGCTCAGCAACAGCAAGG - Intergenic
1014507751 6:122280688-122280710 CTCATTGCCCAGGACTGGCAGGG - Intergenic
1014947940 6:127518574-127518596 CTCACTTCTCAGCAGAGGCGAGG + Exonic
1015014811 6:128399256-128399278 TACACTGCTCACCAATGACAGGG + Intronic
1015418329 6:132976281-132976303 TTCCCTTCTCAGCAATGGCAAGG - Intergenic
1015429507 6:133113865-133113887 CTTACTGCTCATCAATGTAATGG - Intergenic
1016838958 6:148506908-148506930 CCCATTTCACAGCAATGGCAGGG - Intronic
1017220375 6:151959520-151959542 CCCACTGCACAGCGTTGGCACGG - Intronic
1017340528 6:153316665-153316687 CTCCCTGCTCAGCTATGGAAAGG + Intergenic
1017585381 6:155915711-155915733 TTCACTACTCAGCAAAGTCATGG - Intergenic
1018063688 6:160110287-160110309 CTCACTGCTCATCAACGGTGTGG - Intronic
1019749787 7:2721765-2721787 CCCACTTCTCAGCAGTGGCGGGG + Intronic
1021612825 7:22474814-22474836 CTCACCACTCACCACTGGCATGG - Intronic
1021621892 7:22557082-22557104 CACCCTGCTCAGCAGTGTCAGGG - Intronic
1022226540 7:28369334-28369356 CTCACTACTGAGCAATGACGTGG + Intronic
1023127926 7:36973845-36973867 CTCATTGCTCGGCAACGGCAGGG - Intronic
1023475325 7:40571996-40572018 CTCACTCCTCACTAATTGCAGGG + Intronic
1023854395 7:44173271-44173293 CTCACTGCTCAGCAATGGCAAGG + Intronic
1024686745 7:51754077-51754099 CGCAGGGCTCAGCATTGGCATGG + Intergenic
1025035711 7:55591485-55591507 CTCATTGCTCTGAAGTGGCAGGG - Intergenic
1026188837 7:68105865-68105887 CCCACTGGGCAGCAATGGCCAGG + Intergenic
1026924785 7:74183253-74183275 GACACTGCTCAGTAGTGGCAGGG + Intronic
1027853020 7:83472992-83473014 CTCACAGTTCAGCATTGCCAGGG - Intronic
1030995852 7:116357587-116357609 CTAACTGCCCAGCACTGGCCTGG - Intronic
1031142304 7:117956698-117956720 GACCCTGCTAAGCAATGGCATGG + Intergenic
1031410744 7:121437798-121437820 CTCACTGGAGTGCAATGGCACGG - Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1033118833 7:138649098-138649120 CTCCCTGCTCATCATTGGCTTGG - Exonic
1034040264 7:147870408-147870430 CTCCCTGCTCAGCATTGCCTGGG + Intronic
1035119558 7:156555027-156555049 CACACTGCTCAGCAATAAAAAGG + Intergenic
1035839156 8:2792072-2792094 CCCAAAGCTGAGCAATGGCAAGG - Intergenic
1036927957 8:12925656-12925678 CGGACTGCTCAGGAATGGCTTGG + Intergenic
1037647656 8:20808058-20808080 CTCACTTATCACCAAGGGCATGG - Intergenic
1037760788 8:21740155-21740177 CTGGCTCCTCTGCAATGGCAGGG + Intronic
1038486525 8:27939248-27939270 CTCCCTGCTCATGAATGGCTGGG + Intronic
1039729749 8:40261703-40261725 CTCATTTCTCAGCAAGGACAAGG - Intergenic
1041308471 8:56489041-56489063 CTCACTCATCACCAAGGGCATGG - Intergenic
1043257624 8:78156319-78156341 TTCACTGCTCATGAGTGGCAAGG + Intergenic
1044431108 8:92108504-92108526 CTCACAGCACAGCAGTGGGAAGG + Intergenic
1045776763 8:105813097-105813119 CTCACAGTTCAGCAAGGGCTGGG + Intergenic
1046819396 8:118619609-118619631 CTCAATGCTCATGAATTGCATGG - Intronic
1047304298 8:123640486-123640508 CTCACTGCTTTGCACTGGCATGG + Intergenic
1048235906 8:132690438-132690460 CTCACTGTTCGGCAAGGGTAGGG - Intronic
1049395176 8:142396904-142396926 CTACCTGGTCAGCCATGGCACGG - Intronic
1050195677 9:3080782-3080804 TTCATTGCTCAGCACTAGCAAGG + Intergenic
1052161916 9:25272919-25272941 CTCACTTATCACCAAGGGCATGG - Intergenic
1053444038 9:38137719-38137741 CTCACAGTTCAGCTATGGCCAGG - Intergenic
1053629482 9:39919582-39919604 TTCCTTGCTCAGCATTGGCAGGG + Intergenic
1053776286 9:41543968-41543990 TTCCTTGCTCAGCATTGGCAGGG - Intergenic
1054214405 9:62331120-62331142 TTCCTTGCTCAGCATTGGCAGGG - Intergenic
1054365448 9:64334519-64334541 TTCCTTGCTCAGCATTGGCAGGG + Intergenic
1054673077 9:67824238-67824260 TTCCTTGCTCAGCATTGGCAGGG + Intergenic
1055831008 9:80378753-80378775 GCCACTGCTCAGCCATGACAAGG + Intergenic
1056950911 9:91040010-91040032 GTCCCTGCTCAGAAATAGCAGGG + Intergenic
1057936556 9:99244381-99244403 CCCACCCTTCAGCAATGGCATGG - Intergenic
1059261008 9:112976582-112976604 CTCACTTCTCACCAAGGGGATGG - Intergenic
1060769894 9:126325653-126325675 TTCACTACTCAGAAATGCCATGG - Intergenic
1060792823 9:126497485-126497507 CTCACTCCCCAGTAGTGGCAAGG + Intronic
1062036094 9:134383243-134383265 CTCACTGATGAGCCATGTCAGGG + Intronic
1062266783 9:135690196-135690218 CTCACAGTTCAGCATTGGCTGGG - Intergenic
1203370768 Un_KI270442v1:302441-302463 CTCAAGCCTCGGCAATGGCAGGG - Intergenic
1186189881 X:7057777-7057799 CTCACCGCACAGAAATGCCAGGG - Intronic
1186211600 X:7255985-7256007 TTCACTGTAAAGCAATGGCATGG - Intronic
1186847606 X:13545965-13545987 CTCAGTCATCAGCAAGGGCAAGG - Intergenic
1187388828 X:18872571-18872593 CTCAGTGCTCAGCGATGCCGCGG + Intergenic
1187856753 X:23644335-23644357 CTCCCTGCTCAGCTATGGCTAGG - Intergenic
1190818199 X:53947821-53947843 CTCACTGCTCAGCAGCCTCAAGG - Intronic
1191674104 X:63777137-63777159 CTCACAGTTCAGCATTGGCTGGG + Intronic
1193069944 X:77296697-77296719 GTCTCTTCTCAGCAAAGGCAAGG - Intergenic
1193832557 X:86307046-86307068 TTCACTGCTCATGAAAGGCAAGG + Intronic
1201067552 Y:10112628-10112650 CTCAAGCCTCAGCAATGGCAGGG + Intergenic
1201516163 Y:14820421-14820443 CTCACTTCTCATCAATGAAAAGG + Intronic
1202360751 Y:24107647-24107669 CTCACTGCTCAGAAATACAACGG + Intergenic
1202510027 Y:25562471-25562493 CTCACTGCTCAGAAATACAACGG - Intergenic