ID: 1023855064

View in Genome Browser
Species Human (GRCh38)
Location 7:44177908-44177930
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 80}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023855064_1023855070 4 Left 1023855064 7:44177908-44177930 CCTAACACAGTATACCAGGGGTG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1023855070 7:44177935-44177957 TAGAAATCAGCCTATGAGGGCGG 0: 1
1: 0
2: 0
3: 12
4: 186
1023855064_1023855071 5 Left 1023855064 7:44177908-44177930 CCTAACACAGTATACCAGGGGTG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1023855071 7:44177936-44177958 AGAAATCAGCCTATGAGGGCGGG 0: 1
1: 0
2: 2
3: 20
4: 186
1023855064_1023855067 0 Left 1023855064 7:44177908-44177930 CCTAACACAGTATACCAGGGGTG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1023855067 7:44177931-44177953 GTCCTAGAAATCAGCCTATGAGG No data
1023855064_1023855072 12 Left 1023855064 7:44177908-44177930 CCTAACACAGTATACCAGGGGTG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1023855072 7:44177943-44177965 AGCCTATGAGGGCGGGACTCTGG 0: 1
1: 0
2: 1
3: 6
4: 87
1023855064_1023855068 1 Left 1023855064 7:44177908-44177930 CCTAACACAGTATACCAGGGGTG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1023855068 7:44177932-44177954 TCCTAGAAATCAGCCTATGAGGG 0: 1
1: 0
2: 2
3: 11
4: 133
1023855064_1023855074 18 Left 1023855064 7:44177908-44177930 CCTAACACAGTATACCAGGGGTG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1023855074 7:44177949-44177971 TGAGGGCGGGACTCTGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023855064 Original CRISPR CACCCCTGGTATACTGTGTT AGG (reversed) Intronic