ID: 1023855066

View in Genome Browser
Species Human (GRCh38)
Location 7:44177922-44177944
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 159}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023855066_1023855074 4 Left 1023855066 7:44177922-44177944 CCAGGGGTGGTCCTAGAAATCAG 0: 1
1: 0
2: 3
3: 12
4: 159
Right 1023855074 7:44177949-44177971 TGAGGGCGGGACTCTGGAGTTGG No data
1023855066_1023855071 -9 Left 1023855066 7:44177922-44177944 CCAGGGGTGGTCCTAGAAATCAG 0: 1
1: 0
2: 3
3: 12
4: 159
Right 1023855071 7:44177936-44177958 AGAAATCAGCCTATGAGGGCGGG 0: 1
1: 0
2: 2
3: 20
4: 186
1023855066_1023855070 -10 Left 1023855066 7:44177922-44177944 CCAGGGGTGGTCCTAGAAATCAG 0: 1
1: 0
2: 3
3: 12
4: 159
Right 1023855070 7:44177935-44177957 TAGAAATCAGCCTATGAGGGCGG 0: 1
1: 0
2: 0
3: 12
4: 186
1023855066_1023855072 -2 Left 1023855066 7:44177922-44177944 CCAGGGGTGGTCCTAGAAATCAG 0: 1
1: 0
2: 3
3: 12
4: 159
Right 1023855072 7:44177943-44177965 AGCCTATGAGGGCGGGACTCTGG 0: 1
1: 0
2: 1
3: 6
4: 87
1023855066_1023855075 20 Left 1023855066 7:44177922-44177944 CCAGGGGTGGTCCTAGAAATCAG 0: 1
1: 0
2: 3
3: 12
4: 159
Right 1023855075 7:44177965-44177987 GAGTTGGATCACTTCCCAGCTGG 0: 1
1: 0
2: 6
3: 11
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023855066 Original CRISPR CTGATTTCTAGGACCACCCC TGG (reversed) Intronic