ID: 1023855071

View in Genome Browser
Species Human (GRCh38)
Location 7:44177936-44177958
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023855066_1023855071 -9 Left 1023855066 7:44177922-44177944 CCAGGGGTGGTCCTAGAAATCAG 0: 1
1: 0
2: 3
3: 12
4: 159
Right 1023855071 7:44177936-44177958 AGAAATCAGCCTATGAGGGCGGG No data
1023855064_1023855071 5 Left 1023855064 7:44177908-44177930 CCTAACACAGTATACCAGGGGTG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1023855071 7:44177936-44177958 AGAAATCAGCCTATGAGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr