ID: 1023857104

View in Genome Browser
Species Human (GRCh38)
Location 7:44190709-44190731
Sequence TTCTGCCAACACGAGAAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023857101_1023857104 11 Left 1023857101 7:44190675-44190697 CCACGTGGCCTCTTCACATGGCT 0: 2
1: 0
2: 2
3: 43
4: 244
Right 1023857104 7:44190709-44190731 TTCTGCCAACACGAGAAGTTTGG No data
1023857102_1023857104 3 Left 1023857102 7:44190683-44190705 CCTCTTCACATGGCTTCACCAGT 0: 1
1: 0
2: 3
3: 22
4: 326
Right 1023857104 7:44190709-44190731 TTCTGCCAACACGAGAAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023857104 Original CRISPR TTCTGCCAACACGAGAAGTT TGG Intronic
No off target data available for this crispr