ID: 1023857664

View in Genome Browser
Species Human (GRCh38)
Location 7:44194648-44194670
Sequence TGTCAGAGCAAGGGAGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 332}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023857664_1023857673 20 Left 1023857664 7:44194648-44194670 CCTGTTCCTCCCTTGCTCTGACA 0: 1
1: 0
2: 0
3: 34
4: 332
Right 1023857673 7:44194691-44194713 AGTGGCAGAGCTCAAACCTTTGG 0: 1
1: 0
2: 1
3: 12
4: 133
1023857664_1023857674 23 Left 1023857664 7:44194648-44194670 CCTGTTCCTCCCTTGCTCTGACA 0: 1
1: 0
2: 0
3: 34
4: 332
Right 1023857674 7:44194694-44194716 GGCAGAGCTCAAACCTTTGGTGG 0: 1
1: 0
2: 1
3: 7
4: 124
1023857664_1023857670 2 Left 1023857664 7:44194648-44194670 CCTGTTCCTCCCTTGCTCTGACA 0: 1
1: 0
2: 0
3: 34
4: 332
Right 1023857670 7:44194673-44194695 CCCTATTGCTTCGTAGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023857664 Original CRISPR TGTCAGAGCAAGGGAGGAAC AGG (reversed) Intronic
900404514 1:2486545-2486567 TGGCAGAGCCAGGCAGGCACAGG - Intronic
901324584 1:8358999-8359021 TGTCAGAGCAGGCCAGGAGCAGG - Intronic
902290216 1:15430408-15430430 TGTCAGAGCCTGGGAGGGAAGGG + Intergenic
903337933 1:22637252-22637274 TGTCCGTGCAAGTGAGGGACAGG + Intronic
903344981 1:22678120-22678142 TGGCAGAGTAAGGAAGGAGCTGG + Intergenic
904809326 1:33153067-33153089 TGCCAGAGCAGGGGAGTGACAGG + Intronic
905206970 1:36348467-36348489 GGTTAGTGCTAGGGAGGAACGGG - Intronic
906278041 1:44532890-44532912 TGTCACAGCAGGGGAGGAAGAGG + Intronic
906542402 1:46597439-46597461 TTTTAGAGCAAGGAAGTAACAGG - Intronic
906786171 1:48617933-48617955 AGTCAGAGGCAGAGAGGAACAGG - Intronic
907287376 1:53390505-53390527 AGTCACAGCCAGGGAGGAGCTGG - Intergenic
908823436 1:68111887-68111909 TGTCAGAACAAGGGAGCAAATGG - Intronic
911335113 1:96573111-96573133 CGTCAGAGAAAGGGAGTAAGTGG + Intergenic
915358896 1:155273602-155273624 TGTCAGAGCCTCGGAGGTACTGG + Intronic
915916370 1:159943290-159943312 TGTGAGGGCAGGGGAGGAATAGG - Intronic
915953458 1:160205316-160205338 TGTCAGAGCCGGGGAGGGGCGGG - Exonic
918045322 1:180937741-180937763 TGTGTAAGCAAGGGAGGAAGAGG - Intronic
918150065 1:181790710-181790732 TGTCAGAGCACATGAGAAACTGG - Intronic
918777084 1:188647017-188647039 TGTCAGAGAAAGGAAGAAAATGG + Intergenic
919824554 1:201494172-201494194 TGGCATAGGAAGGAAGGAACAGG - Intronic
919948707 1:202342189-202342211 TGCCAGACCAAGGAAGGAGCTGG + Intergenic
921049803 1:211502934-211502956 GGACAGAGCCAGGGAGGAAAGGG + Intergenic
921865048 1:220080085-220080107 TGTCAAAGCATAGGAGAAACTGG + Intronic
921877495 1:220214911-220214933 TGTAAGAAAAAGGGAGGAAAAGG - Intronic
922158792 1:223062456-223062478 TCTCCCAGCAAGGGAGGAAAGGG + Intergenic
922203681 1:223428566-223428588 TGTGAGAGCAAGGGAGCAGGAGG + Intergenic
922413240 1:225395924-225395946 TGTCAGAAGAAGGATGGAACTGG + Intronic
923362390 1:233224517-233224539 TGTAAGAGCTAGGCAGGAAGCGG - Intronic
923436912 1:233975806-233975828 TGCCAGGGCAGGGGTGGAACTGG + Intronic
923761568 1:236849918-236849940 TGTCAGGTCAAGAGAGGAAGGGG + Intronic
923914507 1:238486867-238486889 TGTCAGGGCAAGGAAGGAGAAGG - Intergenic
1062974417 10:1672767-1672789 TGTTAGAGGGAGGGAGGAAGGGG - Intronic
1062984111 10:1751169-1751191 TGGAAGAGGAAGGGATGAACAGG + Intergenic
1063154202 10:3363369-3363391 TGTCAGAGCTTGGGAGGAATGGG - Intergenic
1063522222 10:6751333-6751355 TGTCTGAGCAATGGAGTATCTGG + Intergenic
1063721246 10:8583851-8583873 TGGAGGAGGAAGGGAGGAACAGG + Intergenic
1064255222 10:13737789-13737811 TCTCAGATCCAGAGAGGAACAGG - Intronic
1064470078 10:15626961-15626983 TGGGAGAGGAAGGGAAGAACAGG + Intronic
1064898914 10:20272084-20272106 TGTCAGAGCAAGAGGGCTACAGG + Intronic
1065176807 10:23085021-23085043 TATCAGAGCCAGGGAGGAGTGGG + Intergenic
1065556125 10:26917328-26917350 TGTCAGGGCAAAGGAGAAAATGG + Intergenic
1066678591 10:37914219-37914241 TTCCAGAGGAAAGGAGGAACAGG + Intergenic
1067067212 10:43110858-43110880 TGTCTGAGTGAGGGAGGAAAGGG + Intronic
1068499299 10:57822727-57822749 TGCTAGAGCAAGGGATGAATAGG - Intergenic
1068972739 10:62976746-62976768 TGTCAGATAAAGGGAGGAAAGGG - Intergenic
1069245852 10:66204649-66204671 TGTAAGTACAAGGGAGGAAGTGG - Intronic
1069624882 10:69861408-69861430 TGTACGAGCAAGGAAGGGACAGG - Intronic
1070696812 10:78569995-78570017 TGTTAGAGCAAAGGAGCAGCAGG - Intergenic
1070868123 10:79722436-79722458 AGCCAGAGCAAGAGAGGAAGTGG - Intergenic
1071635033 10:87244637-87244659 AGCCAGAGCAAGAGAGGAAGTGG - Intergenic
1071660207 10:87493359-87493381 AGCCAGAGCAAGAGAGGAAGTGG + Intergenic
1072896036 10:99367659-99367681 TGTCAGAGCAAAGGATTATCAGG + Intronic
1075084160 10:119403061-119403083 TGTCAGGGCCTGGGAGGAAAGGG - Intronic
1075090388 10:119441155-119441177 TCTTAGACCAAGGGAGGCACCGG - Intronic
1075902059 10:126051113-126051135 TGTCAGAGCAGGGAAGGATGGGG + Intronic
1076576703 10:131474316-131474338 TCTCAGAGCAGGGCTGGAACAGG + Intergenic
1077010944 11:379097-379119 TTTCTGAGCAAGGGGGTAACAGG + Intronic
1077323492 11:1953189-1953211 TGTCAGAGCATGGGAGGCCCCGG + Intronic
1078039782 11:7849251-7849273 TGTCAGAGCAGGAGAGGGCCAGG - Intergenic
1078582118 11:12546792-12546814 TGCCTGAGCCAGGGAGGAGCTGG + Intergenic
1079160764 11:17991535-17991557 TGTAAAAGGAAGGGAGGAACTGG + Intronic
1079546903 11:21643645-21643667 GGCCAAAGCAAGGGGGGAACAGG - Intergenic
1081727677 11:45342570-45342592 GGTCACAGCAAGGCAGGCACAGG + Intergenic
1083143136 11:60738043-60738065 TGTCAGAGCAAGAGAGGACTAGG - Intronic
1083194623 11:61078063-61078085 TCTGAGAGCCAGGGAGCAACAGG - Intergenic
1083837515 11:65281302-65281324 GGTCAGAGCATGGGGGAAACAGG - Intronic
1084381991 11:68818410-68818432 CGCCAGAGCAAGGGAGGAGCTGG + Intronic
1084913977 11:72414012-72414034 GGTCAGAGCAAGAGAGCCACAGG + Intronic
1085547720 11:77335763-77335785 TAACAGAGTAATGGAGGAACAGG - Intronic
1088517753 11:110656943-110656965 TGGAAGAGCATGGGAGGAAGAGG - Intronic
1088756340 11:112888393-112888415 TGTAATAGCATGGGAGGCACAGG + Intergenic
1089374815 11:117986647-117986669 TGCCAGAGTAAGGGAGCACCCGG - Intronic
1090881698 11:130838556-130838578 TGTCAGAGGAAGGAGGGAAAGGG + Intergenic
1091264567 11:134260680-134260702 TTTCAGAGCCAGAGAGGAACTGG + Intronic
1202806480 11_KI270721v1_random:8384-8406 TGTCAGAGCATGGGAGGCCCCGG + Intergenic
1091775927 12:3184825-3184847 TGGCAGAGCAGGGTTGGAACAGG + Intronic
1092021033 12:5202330-5202352 TTTCAGAGCAGGGGATGATCTGG - Intergenic
1093095960 12:14972705-14972727 TGTCAGAGAAAGGGAAGAAATGG + Intergenic
1096021610 12:48329894-48329916 TGCCAGAGCCAAGGAGGAAGCGG + Exonic
1096797572 12:54087486-54087508 TGCCAGAGCAAGGGAGGGGAGGG + Intergenic
1097239817 12:57567470-57567492 TGCAGGAGCAAGGGAGAAACAGG - Intronic
1097349912 12:58537325-58537347 AGCCAGAACCAGGGAGGAACAGG - Intergenic
1099682449 12:85845061-85845083 TGTGAGAGCAAGGGAGCATGGGG - Intergenic
1100453194 12:94727417-94727439 AGTCAGAGAAAGTGAGGAAGAGG - Intergenic
1100460060 12:94790570-94790592 TGTGAGAACATGGGAGGAAATGG - Intergenic
1102524220 12:113499799-113499821 TGTTTGAGCAGGGGAGGAACTGG + Intergenic
1103207906 12:119144497-119144519 TGTAAGAGAAAGGGAAGAGCGGG - Intronic
1103231218 12:119332308-119332330 TGTCAGAGCCATGTAAGAACTGG - Intergenic
1106161410 13:27204326-27204348 TGACCCAGCAAGGGAGGAATTGG - Intergenic
1107507557 13:41049666-41049688 TGTAAGAGAAAGGGAGAAAAGGG - Intronic
1108065614 13:46574465-46574487 TGTCAATGCAAGGGAAGAACGGG + Intronic
1109372181 13:61437207-61437229 ACTCAGAGCAAGGGAACAACAGG + Intergenic
1111606350 13:90545234-90545256 TGAGTGAACAAGGGAGGAACTGG + Intergenic
1112146436 13:96705547-96705569 TCTGAGTGCAAGGGAGGAAGAGG - Intronic
1113316219 13:109182261-109182283 TGTCAAAGCAGGGGAGGAAGAGG - Intronic
1114665369 14:24374384-24374406 TGTGAGAGGAGGCGAGGAACTGG + Exonic
1115623860 14:35169949-35169971 TGACAGAACAAAGGAGGAACAGG - Intronic
1118447686 14:65866727-65866749 TGTCAGAGCAGGGGAGGACATGG + Intergenic
1119408180 14:74411634-74411656 GGACAGAGCAAGGGAGGAGTGGG + Intronic
1119878573 14:78081260-78081282 TATCAGGGCAAGGCAGGAAAAGG + Intergenic
1120309315 14:82809774-82809796 TGGCAGAGCAGGGAAGGAAGAGG + Intergenic
1121476802 14:94216359-94216381 TGGCAGAGCATAGGAGGAAGAGG + Intronic
1122302396 14:100738617-100738639 CCTCAGAGCATGGGGGGAACTGG - Intergenic
1122598669 14:102909976-102909998 TGTCAGCCCAAGGGAGGGCCGGG + Exonic
1125775720 15:42211452-42211474 TGTCAGAGTCTGGGAGGAAAGGG + Exonic
1125830675 15:42715134-42715156 TGTCAGTGAAAGGGAGAGACTGG + Intronic
1126893556 15:53233268-53233290 TGTGAGAGCAAGTCAGGAGCTGG - Intergenic
1127061947 15:55196023-55196045 TCTCTGAGAAAGAGAGGAACGGG + Intronic
1127700448 15:61494855-61494877 TGTGAGAGCAGGGCAGGTACTGG - Intergenic
1128105731 15:65043350-65043372 TAGGAGAGCAAGAGAGGAACAGG - Intergenic
1128544098 15:68555801-68555823 TGGCAGAGCCAGGGAGGAGGGGG + Intergenic
1129080156 15:73032464-73032486 TGCCAGAGCAAGGAAGGGCCAGG + Intergenic
1129702433 15:77775504-77775526 TTTCAGAGAGAGGGAGGAGCTGG - Intronic
1130271948 15:82456344-82456366 AGTCACAGAGAGGGAGGAACAGG - Intergenic
1130464298 15:84183731-84183753 AGTCACAGAGAGGGAGGAACAGG - Intergenic
1130488388 15:84411088-84411110 AGTCACAGAGAGGGAGGAACAGG + Intergenic
1130499968 15:84489804-84489826 AGTCACAGAGAGGGAGGAACAGG + Intergenic
1131306297 15:91246756-91246778 TTGCAGAGCAAAGGAGGAAGAGG - Intronic
1133381873 16:5337775-5337797 TGAGAGGGCAAGGAAGGAACTGG + Intergenic
1133901267 16:9977284-9977306 TCTTGGAGCAAGGGAGGAAGGGG + Intronic
1135575757 16:23584302-23584324 TGCCAGAGCTAGGGAGGATGGGG - Intronic
1135858555 16:26034172-26034194 GGACAGAGCAAGGGAGCGACTGG + Intronic
1136546421 16:30957561-30957583 TGGCAGTGCAAGGAAGGGACGGG + Exonic
1137900537 16:52263073-52263095 TGCCAGAGCAATGGAGCAATGGG + Intergenic
1138418565 16:56885241-56885263 TGGGAGAGCAAGGGAGCAACGGG - Intronic
1140045311 16:71436738-71436760 GGCCAGAGCAGGGGAGGAAGAGG - Intergenic
1141801101 16:86309813-86309835 TTTCAGAGCATGGGAGGAATTGG + Intergenic
1141833104 16:86520657-86520679 GGTCAGAGCACGGGAGTCACAGG + Intergenic
1143371547 17:6443898-6443920 TGTCACAGGAAGGGAGGGTCAGG + Intergenic
1143377629 17:6476800-6476822 AGTCAGAGCAGGGCAGGGACAGG + Intronic
1143767435 17:9146823-9146845 TTTCAGAGCCAGCGAGGCACTGG + Intronic
1144951511 17:18996900-18996922 TGGCAGAGCCAGGGAGGCCCAGG - Intronic
1146556222 17:33826604-33826626 TTTCAGAGCTAGGGAAGGACTGG + Intronic
1148283778 17:46370260-46370282 TGTCAGAGCAAGGCACAAACAGG + Intergenic
1148305996 17:46588177-46588199 TGTCAGAGCAAGGCACAAACAGG + Intergenic
1148549905 17:48544109-48544131 ATTCAGAGCTAGGGAGGAAGAGG - Intronic
1148593379 17:48833190-48833212 TGCCATAGCCAGGGAGAAACGGG + Intronic
1150159368 17:62882526-62882548 AGTCAGAGAGAGGGAGGAAGGGG + Intergenic
1151409706 17:73914039-73914061 TGGCAGAACAAGGGAGGAGGAGG + Intergenic
1152604985 17:81285094-81285116 AGACAGAGCAAGGGAAGGACAGG + Intronic
1153324150 18:3801056-3801078 GGTGAGAGCAAGGGAGCAAGAGG + Intronic
1156415563 18:36885551-36885573 TTTCAGAGTAAGTGAGGAAAAGG + Exonic
1158110161 18:53931906-53931928 TATCATAGCAATGGAGGAAATGG + Intergenic
1158447851 18:57536664-57536686 TCTCAGAGGAAGGGAAGAAGGGG + Intergenic
1160340661 18:78086248-78086270 GGTCAGAGAAGGGGAGGAGCGGG - Intergenic
1160802620 19:977315-977337 TGTCAGAGCAAAGGGGGAGAGGG - Intergenic
1161619729 19:5291757-5291779 TTTTAGAGCAGAGGAGGAACGGG - Intronic
1161621240 19:5298485-5298507 TGTGAGAGCCAGAGAGAAACTGG + Intronic
1162343304 19:10105395-10105417 TGGCAGAGAAAGGGAGAGACGGG + Intergenic
1162806648 19:13140725-13140747 TGGCAGGGCAAGGGGGGTACAGG - Exonic
1163717309 19:18879777-18879799 TGGCAGAGAAGGGGAGGGACTGG - Intronic
1164598532 19:29546149-29546171 TGAAAGAGCCAGAGAGGAACAGG + Intronic
1164601165 19:29564611-29564633 TGTCAGAGCACAGGAGGGAACGG - Intergenic
1164669113 19:30063007-30063029 GGTCAGGGCAGGCGAGGAACAGG + Intergenic
1164806972 19:31124517-31124539 TGAGAGACAAAGGGAGGAACAGG + Intergenic
1166170435 19:41024514-41024536 TGTCAGAGCAAGAAAGGCACTGG + Intergenic
1166658128 19:44627171-44627193 GTTCTGAGCAGGGGAGGAACAGG + Intronic
1166671185 19:44710438-44710460 TGTCAGAGAGATGGAGGACCAGG - Intronic
1166919888 19:46222007-46222029 TGACAGAGCCAGGGAGTCACAGG - Intergenic
1167105925 19:47429860-47429882 GGTCACCGCAGGGGAGGAACCGG + Exonic
1167555588 19:50193191-50193213 TGTCTGAGCAGAGGAGGGACAGG + Intronic
1167735664 19:51293227-51293249 TGCCAGAGCAAGAAAGGAAAGGG + Intergenic
1167744142 19:51340977-51340999 TGTCTGAGCAAAGGTGGACCTGG - Intronic
1167799010 19:51728371-51728393 TGTCTGAGTAAGGGACAAACTGG + Intergenic
1168273987 19:55266048-55266070 TGTGGGAGAAGGGGAGGAACAGG - Intronic
925150091 2:1609826-1609848 TGTCAGAGAGACGGAGGAAGTGG + Intergenic
925415415 2:3666934-3666956 GGTCAGAACAAAGGAGGAACTGG + Intronic
925611660 2:5706698-5706720 GTTCAGAGTAAGGGAAGAACTGG + Intergenic
926067690 2:9857404-9857426 TGTGAGAGAAAGAGAGGAATAGG + Intronic
927200509 2:20575437-20575459 TGTCAGAGCTAGAGAGGAAGGGG - Intronic
927608455 2:24511000-24511022 TGGCTGAGGAAGGGAGGAATGGG - Intronic
928602883 2:32918850-32918872 TCTCAGATCAAAGGAGAAACTGG - Intergenic
928605443 2:32941546-32941568 TGTGTGAGCAAGGTAGAAACAGG - Intergenic
928795183 2:35010837-35010859 TGTCAGAGGCAGGGAGGAGGAGG - Intergenic
930896077 2:56448185-56448207 TGTGACAGCAAGAAAGGAACTGG + Intergenic
932616974 2:73238510-73238532 TGTCTGAGCAAGGAAGGCACAGG - Intronic
932852641 2:75201220-75201242 TGACAGAGAGAGGGAGGAAAAGG + Intergenic
933022236 2:77208287-77208309 TGTGCGAGAAAGGGAGGAAGAGG - Intronic
933876467 2:86625122-86625144 TCATGGAGCAAGGGAGGAACGGG + Intronic
934652058 2:96098423-96098445 TGGCAGAACGAGGAAGGAACAGG + Intergenic
934664364 2:96159320-96159342 TGTCAGGGCAGAGGAGGAGCAGG - Intergenic
935946942 2:108295331-108295353 TTTCAGAGCAGGGCGGGAACAGG - Intronic
936768456 2:115882819-115882841 TGTCATAGCAATGGAGTAACTGG - Intergenic
937814940 2:126240917-126240939 GGTCAGAGCAAGGAAGGAGGGGG - Intergenic
937986548 2:127640618-127640640 TACCAGAGCAAGGGAGGGAGGGG + Intronic
939350869 2:141036193-141036215 TGTCAGAGCATGGGAAGAAGAGG + Intronic
939684575 2:145183349-145183371 TGTTTAAGCAAGGGAGGAAAAGG + Intergenic
940751944 2:157635985-157636007 TGTGAGACCAAGAGAGGAAAAGG + Intergenic
941166714 2:162090692-162090714 TAGCAGAGAAAGGGAGGAAGAGG - Intergenic
941238791 2:163011502-163011524 TGTCAGGGCATGGGGGGAAAGGG - Intergenic
941514804 2:166459973-166459995 TGTCAGAGGGTGGGAGGAAGGGG + Intronic
943022962 2:182597462-182597484 TTGCAGAGGAAGAGAGGAACTGG + Intergenic
944877438 2:203976359-203976381 TGTCAGAAAAAGCGAGGAAATGG + Intergenic
945878809 2:215305679-215305701 TATGAGAGCAAAGGTGGAACAGG - Intergenic
948716643 2:239869650-239869672 TGTCAGAGACAGGGAGGGGCTGG - Intergenic
1169001784 20:2173150-2173172 TTTCTGAGCAAGAGAGGGACAGG + Intronic
1169217260 20:3801011-3801033 TGCCAGAGCATGGGTGGAGCTGG - Exonic
1171849412 20:30297340-30297362 TGCCAGAGCAAGGGAGGGGAGGG + Intergenic
1172227848 20:33317118-33317140 TGTTAGAGCAGGGGAGAGACAGG - Intergenic
1172783554 20:37451401-37451423 AGACAGAGCATGGGAGGAACAGG - Intergenic
1173241070 20:41297667-41297689 TCCCAGAGCAAGTGAGGAAATGG + Intronic
1173295195 20:41749446-41749468 GGTCAGAGCAGGGAAGGAGCAGG - Intergenic
1173524297 20:43720267-43720289 TCTCAGAGCAAGGCAGGGACTGG + Intergenic
1174625764 20:51913024-51913046 GGACAGAGCAAGGGAGGAGAGGG - Intergenic
1174782851 20:53406122-53406144 TGAAAGAGCAAGAGAGGATCAGG + Intronic
1175632562 20:60554571-60554593 TTTCAGGGGAAGGAAGGAACTGG - Intergenic
1175652348 20:60736264-60736286 TGCAGGAGCAATGGAGGAACAGG - Intergenic
1180153811 21:45967330-45967352 TGTGAGAGCAGAGGAGAAACAGG + Intergenic
1181367799 22:22392068-22392090 GGTCAGAGTGAGGGAGAAACTGG + Intergenic
1181373874 22:22440761-22440783 GGTCAGAGTGAGGGAGAAACTGG + Intergenic
1181533511 22:23530366-23530388 TGTCAGAGCTGGGGAGGGGCTGG + Intergenic
1181726291 22:24813325-24813347 ATTCTGAGCAGGGGAGGAACAGG + Intronic
1182736967 22:32537657-32537679 TGTCAGAGCACAGGAGGGACTGG + Intronic
1182744696 22:32596595-32596617 TGACAGAGGGAGAGAGGAACAGG + Intronic
1182833856 22:33325693-33325715 TGTCACAGGAAGGAAGAAACGGG - Intronic
1184595830 22:45513671-45513693 TGTCAGAGACAGGAAGGAAAAGG - Intronic
950085201 3:10252537-10252559 CCACAGAGCAAGGGAGGAAGAGG - Intronic
950231166 3:11277129-11277151 TGAGGGAGCAAGGGAGGAAATGG - Intronic
952011788 3:28908178-28908200 TGTAAGAGCAAGGAAGGTGCGGG + Intergenic
952752795 3:36839055-36839077 GGTCAGAGCCATGGAGCAACTGG + Intronic
952868668 3:37877262-37877284 TGTCAGGGCAAGGAGGGAATGGG - Intronic
952926135 3:38320661-38320683 TGTCAGGGGATGGGAGGAAAGGG - Intergenic
953452724 3:43017549-43017571 AGTCACAGGAAGGGAGGAAGGGG + Intronic
956391245 3:68775077-68775099 TGTCAGACCAGGGGAAGAAACGG + Intronic
958069620 3:88593555-88593577 TGTCAGCGCAAAGGAGGCAAAGG + Intergenic
959853543 3:111120101-111120123 TGTAAAAGCAAGGTAGGAAAAGG - Intronic
960066268 3:113376770-113376792 TAACAGAGCAAGGGGGGAAAAGG + Intronic
960126847 3:114008361-114008383 TCTCTGAGCAAGGGGGGATCAGG - Intronic
960490160 3:118307710-118307732 TGCAAGAGCAAGAGAGAAACAGG - Intergenic
960603089 3:119477743-119477765 TTACAGAGCATGGGAGGAAGGGG + Intronic
962686409 3:137852312-137852334 TTTCAAAGCAAGGAAGGAAGAGG + Intergenic
963132366 3:141870293-141870315 TGGCAGGGCAAGCGAGCAACTGG - Intergenic
963746093 3:149126484-149126506 TCTCAGAGCAATGGATGAAGTGG - Intergenic
964398636 3:156274318-156274340 TTACAGAGCAGGGCAGGAACAGG - Intronic
965240112 3:166186340-166186362 TGTAAGAGCAAGTGAGAAAGAGG + Intergenic
966641920 3:182201530-182201552 TATAAGAGCGAGGGAAGAACTGG + Intergenic
967492846 3:190113412-190113434 CGTAAAAGCAAGGGAGGAAAGGG - Intronic
967834380 3:193948634-193948656 TGTCAGCCAAAGGGAGGAAGTGG - Intergenic
968884161 4:3318375-3318397 GGACAGAGCTAGGGAGGAGCAGG - Intronic
969197414 4:5573958-5573980 TTTCAGAGCAAGGAGGGAAGAGG - Intronic
969243175 4:5915298-5915320 TGTCTGAGAATGGCAGGAACTGG - Intronic
969340108 4:6535124-6535146 GGCCAGAGCAGGGGAGGGACCGG + Intronic
970652392 4:18193149-18193171 TGGAAGAGCAAGGCAGGGACAGG + Intergenic
970916997 4:21347525-21347547 AAGCAGAGCTAGGGAGGAACAGG + Intronic
971156953 4:24093480-24093502 TCTCAGTAAAAGGGAGGAACTGG - Intergenic
971433176 4:26590124-26590146 TGGCAGAGCACAGGAGGAAAAGG - Intronic
972285339 4:37642770-37642792 AGTCAGAGCAGGGGAGGACGGGG + Intronic
972521936 4:39866860-39866882 TGACAGAGCAAAAGAGGATCAGG - Exonic
973069772 4:45843457-45843479 TGCCAGAGCAAGGATGGAGCAGG + Intergenic
973790050 4:54369868-54369890 TGTAACAGCAAGGGAGCATCAGG - Intergenic
975907988 4:79238456-79238478 AGACAGAGTAAGTGAGGAACAGG + Intronic
978622047 4:110642159-110642181 TTTCAGATCAAGAGACGAACTGG - Intergenic
978648241 4:110968213-110968235 GATCAGAGCAATGAAGGAACTGG - Intergenic
981954055 4:150448469-150448491 TGGCAAAGCATGGGAGGAAGAGG + Intronic
983198884 4:164839016-164839038 TGTCAAAGCAAGAGAGGCAATGG + Intergenic
986229842 5:5853057-5853079 GGTGAGAGGAAGGGAGAAACTGG + Intergenic
986344502 5:6822346-6822368 CAGCAGAGCAAGGGAGGATCAGG + Intergenic
987076271 5:14384963-14384985 TGTCATAGCAAGGGAATAAATGG + Intronic
987551137 5:19383562-19383584 TGACAGAGCAAGGCAGAATCTGG - Intergenic
988050949 5:26030454-26030476 TACCAGAGTAAGGGAAGAACTGG + Intergenic
988489226 5:31692571-31692593 TGTCAGAGCTAGGGAAGCAGGGG - Intronic
988778949 5:34502019-34502041 GGTCAGAGGAAGTCAGGAACTGG + Intergenic
989559866 5:42837756-42837778 GCTCAGAGCCAGGGAGGAAATGG - Intronic
990259797 5:54009932-54009954 GGTGAGAGAAAGGGAGGAAAGGG + Intronic
990350580 5:54911651-54911673 TGTCATAAAAAGGGAGGTACAGG - Intergenic
990902127 5:60763302-60763324 TCTCAGAGCATGGGAGGACATGG - Intronic
990976270 5:61564456-61564478 TGTCCCAGCAAAGCAGGAACTGG - Intergenic
992023570 5:72649381-72649403 TGTCTGTGCAGGGGAGGAGCAGG - Intergenic
994273581 5:97809474-97809496 GCTCAGAATAAGGGAGGAACAGG + Intergenic
995169156 5:109086572-109086594 TGACAAAGCAAGGCAGGAAAAGG - Intronic
995180939 5:109229656-109229678 TATGAGGGCAAGCGAGGAACAGG + Intergenic
995578064 5:113562555-113562577 AGTCACAGGAAGGAAGGAACAGG + Intronic
996940910 5:129004321-129004343 AGTCAGAGCTAGGGAGCAAGGGG - Intronic
997632328 5:135378234-135378256 TGGCAGAGCAAGCGAGGTACTGG - Intronic
998794203 5:145800282-145800304 TGTAAGAGAAGGGGAGGAAAGGG - Intronic
1000157389 5:158564942-158564964 TGTCACAGCAAGGGAAGAGAGGG + Intergenic
1001421856 5:171593627-171593649 TGGCAGAGTCAGGGAGGGACCGG - Intergenic
1001485204 5:172115072-172115094 TTTCAGAGGAAGGGAGGATTCGG - Intronic
1002168444 5:177362262-177362284 TGTCAGGGCAAGAGAGGCTCAGG + Intronic
1003060417 6:2858289-2858311 GGTGAGAGGAAGGGAGAAACAGG - Intergenic
1003788090 6:9510480-9510502 TGTTAGCACAAGGGAGGAAGTGG - Intergenic
1004138795 6:12994809-12994831 TGTCTGGGGAAGTGAGGAACAGG + Intronic
1004146162 6:13068751-13068773 TGACATAGCAAAGGAGAAACAGG - Intronic
1005194791 6:23270539-23270561 TGTGAGAACAGGGGAGAAACAGG - Intergenic
1006273265 6:32980786-32980808 TGTCACAGCAAAGGGGGAAGGGG - Exonic
1007758547 6:44117358-44117380 TGTTAGTGCTAGGGAGCAACAGG - Intronic
1008946208 6:57099698-57099720 TCTCAGAGCAAGGGAAGTATTGG - Intronic
1009032256 6:58073583-58073605 TGTCAGGGGAAGAGTGGAACCGG - Intergenic
1012974309 6:105763582-105763604 AGTCAGAGGAAAGGAGGAAGAGG - Intergenic
1015117249 6:129663343-129663365 TGTCAGAGCAAGATAGGGACTGG - Intronic
1016679635 6:146813812-146813834 TGTCTGAGTTAGGGAGGAAATGG - Intronic
1017782626 6:157728167-157728189 TTTCAGAGCTAGGGATGACCTGG + Intronic
1018111692 6:160542677-160542699 TCTCAGAACAAGGTAAGAACAGG - Exonic
1018489150 6:164273869-164273891 TGACAGAGCAGGGAAGGAAGAGG - Intergenic
1018551889 6:165007358-165007380 TGGCAGAGCATGGGAGAAAGAGG - Intergenic
1019269563 7:139472-139494 TCTCACTGCCAGGGAGGAACTGG + Intergenic
1019594875 7:1853830-1853852 TGGCCGAGCAGGGGAGGACCGGG + Intronic
1023287119 7:38631445-38631467 GGGCCGAGCAAGGGAGGAGCGGG + Exonic
1023589867 7:41770337-41770359 TGTCAGAGGATGGGGGGAAAGGG + Intergenic
1023659290 7:42456295-42456317 GCTCAGACCTAGGGAGGAACTGG + Intergenic
1023737312 7:43246793-43246815 TGACAGGGAAAGGGAGGAAGTGG + Intronic
1023857664 7:44194648-44194670 TGTCAGAGCAAGGGAGGAACAGG - Intronic
1027604274 7:80281530-80281552 AGTCAGAGAAAGCGAAGAACAGG - Intergenic
1029164421 7:98577087-98577109 TGACAGAGCATGGGAGGAAAAGG - Intergenic
1029204435 7:98860455-98860477 TGTCAGAGCTAGGCAGGGAGAGG + Intronic
1029688800 7:102166685-102166707 TGGCAGTGAAAGGAAGGAACAGG - Intronic
1030510637 7:110478858-110478880 TGTGAGAGAAAGGGAGAACCAGG - Intergenic
1030740661 7:113105470-113105492 TGTAACAGCATGGGTGGAACTGG + Intergenic
1031179051 7:118392038-118392060 TGTCAGGGCAAGGCAGGGGCAGG + Intergenic
1033480957 7:141739813-141739835 TGACAGAGTCATGGAGGAACTGG - Intronic
1034494235 7:151410378-151410400 GCTCAGAGCATGGGAGGACCTGG - Intronic
1037533050 8:19797165-19797187 TGTCAGTGCCAGGGTGAAACGGG + Intergenic
1038052128 8:23823941-23823963 TGTCCTAGTAAGGGAGGAAGAGG + Intergenic
1038110269 8:24489027-24489049 TGTTAGAGCAGGGAAGTAACTGG - Intronic
1038150657 8:24940494-24940516 TGCCAGAGCAAGGGTGGGACAGG - Intergenic
1038427629 8:27474486-27474508 TTTCAGAGCCAGGAAGGAACCGG - Intronic
1038644722 8:29352015-29352037 TCACAGAGCAAGGGAGTTACAGG + Intergenic
1039032455 8:33325156-33325178 AGACAGAGAAAGGGAAGAACGGG - Intergenic
1039795548 8:40909776-40909798 TGACAGAGCATGCCAGGAACAGG - Intergenic
1039980491 8:42406025-42406047 TGTGAGAGCAAGAGAAGAGCAGG - Intergenic
1041458075 8:58081531-58081553 TTTCAGAGCAGGGAAGTAACAGG - Intronic
1042508597 8:69588183-69588205 TGTAAGAGGGAGGGAGGAAATGG - Intronic
1042774821 8:72418970-72418992 TTGCAGAGCAGGGGAGGAAGAGG - Intergenic
1042848562 8:73192554-73192576 TGACAGAGCAAGAAAGGAAGAGG + Intergenic
1045403385 8:101841359-101841381 TGTTAGAGGAAGGGAAGAAGGGG - Intronic
1046844582 8:118901701-118901723 TGGCAGAGCAAAGAAGAAACTGG - Intergenic
1047298847 8:123595831-123595853 TGGCAGAGCAAGGGAAAAAAAGG - Intergenic
1047759926 8:127946879-127946901 TGTCAGAGCAGGGAAGGGAAGGG - Intergenic
1048701933 8:137101416-137101438 TGTCAGAGCAAGAGTGGAGGTGG + Intergenic
1048922300 8:139242236-139242258 CCTCAGAGCAGCGGAGGAACTGG - Intergenic
1048980269 8:139699652-139699674 TGTCATAACCAGGGAAGAACGGG - Intronic
1050990622 9:12146775-12146797 AGTCAGAGCAAGCAAGGAAATGG - Intergenic
1051918681 9:22237872-22237894 TTTCAGATCAAGGGATAAACTGG - Intergenic
1052524408 9:29595374-29595396 TGTCAAGGATAGGGAGGAACTGG + Intergenic
1052631786 9:31050773-31050795 TGTCAGAACAATTGAGGAAAGGG + Intergenic
1053349451 9:37403326-37403348 AGTCAGATCAAGAGAGGAAGGGG + Intergenic
1053420149 9:37972268-37972290 TCTCTGGGCATGGGAGGAACTGG - Intronic
1054157927 9:61654133-61654155 TGCCAGAGCAAGGGAGGGGAGGG - Intergenic
1054477700 9:65585138-65585160 TGCCAGAGCAAGGGAGGGGAGGG - Intergenic
1056752094 9:89359297-89359319 TGTCAGAGCAAGAGGGCTACAGG + Exonic
1056852463 9:90095997-90096019 GGACAGAGCTAGGGAGGAAGAGG - Intergenic
1056910645 9:90697074-90697096 TAGCAGAGCATGGGAAGAACAGG - Intergenic
1056917012 9:90754944-90754966 TGTCATATCCAGGGAGGCACAGG + Intergenic
1057573713 9:96222734-96222756 TGGCAGAACTAGGGAAGAACAGG - Intergenic
1059339111 9:113587434-113587456 TCTCAGAGCCAGGGAGGAGGAGG - Intronic
1059767937 9:117401410-117401432 TTTGTGAGCAAGGGAGGAAATGG + Intronic
1059853001 9:118364410-118364432 TGTGAGAGCAAGTGAGCACCAGG - Intergenic
1060291977 9:122311888-122311910 TGTCAGTATAAGGAAGGAACAGG - Intronic
1060498470 9:124134893-124134915 GGTCAGAGTAGGGGAGGAAGTGG - Intergenic
1061737650 9:132672420-132672442 TGTAAGAGGAAGGAAGGAAAGGG + Intronic
1061905716 9:133695891-133695913 TGTGAGAGCATGGGGGGGACTGG + Intronic
1062194855 9:135267280-135267302 TGGCAGAGCCAGGGAGGGAGGGG - Intergenic
1062198318 9:135286973-135286995 TGGCAGAGCAAAGGAGGCAGAGG + Intergenic
1062213284 9:135376090-135376112 TGTGAGAGCATGGGTGGACCTGG + Intergenic
1062725832 9:138073008-138073030 TGACTGAGCCAGGGAGGAAAGGG + Intronic
1185466143 X:355461-355483 TGTCGTAGCAACGGAGGGACCGG + Intronic
1186871025 X:13772934-13772956 TATCAAAGCAAAGGAAGAACAGG - Exonic
1189244602 X:39553833-39553855 TGTGAGAGAAAGAGAGGAAATGG - Intergenic
1191633335 X:63349482-63349504 TGTTAGAGTAAGGGAGGGAGGGG + Exonic
1194206400 X:91016261-91016283 TGTCAAAGCAATGTTGGAACTGG - Intergenic
1196463458 X:115951311-115951333 AGACAGAGCAAGAGAGGAAGCGG - Intergenic
1198273708 X:135080844-135080866 TGTAAGAGAAGGGGAGGAAGGGG + Intergenic
1199504135 X:148542681-148542703 AGTCACAGCAAGGAAGGAAGTGG + Intronic
1199933829 X:152552098-152552120 TGTCAGAGAAAGTGAGAAAAAGG - Intergenic
1200172999 X:154092263-154092285 TGTCACATCAAAGCAGGAACTGG + Intronic
1200861483 Y:7997114-7997136 TGTCAGAGAAACTGAGGAAAAGG + Intergenic
1201518818 Y:14849571-14849593 TTTCAGAGGCAGGGAGGGACAGG - Intergenic