ID: 1023859427

View in Genome Browser
Species Human (GRCh38)
Location 7:44208572-44208594
Sequence CCTTCAATGCAAACGCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 70}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023859427_1023859429 11 Left 1023859427 7:44208572-44208594 CCTTGCAGCGTTTGCATTGAAGG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1023859429 7:44208606-44208628 AAGCACCGTGCACTGACCACAGG 0: 1
1: 0
2: 0
3: 4
4: 76
1023859427_1023859434 29 Left 1023859427 7:44208572-44208594 CCTTGCAGCGTTTGCATTGAAGG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1023859434 7:44208624-44208646 ACAGGGCAGCTTCTGGAATATGG 0: 1
1: 0
2: 2
3: 12
4: 199
1023859427_1023859430 12 Left 1023859427 7:44208572-44208594 CCTTGCAGCGTTTGCATTGAAGG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1023859430 7:44208607-44208629 AGCACCGTGCACTGACCACAGGG 0: 1
1: 0
2: 0
3: 5
4: 77
1023859427_1023859435 30 Left 1023859427 7:44208572-44208594 CCTTGCAGCGTTTGCATTGAAGG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1023859435 7:44208625-44208647 CAGGGCAGCTTCTGGAATATGGG 0: 1
1: 0
2: 0
3: 18
4: 201
1023859427_1023859432 22 Left 1023859427 7:44208572-44208594 CCTTGCAGCGTTTGCATTGAAGG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1023859432 7:44208617-44208639 ACTGACCACAGGGCAGCTTCTGG 0: 1
1: 0
2: 3
3: 15
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023859427 Original CRISPR CCTTCAATGCAAACGCTGCA AGG (reversed) Intronic
911269386 1:95781891-95781913 ACTTTATTGCAAACGCAGCAAGG - Intergenic
917593654 1:176504766-176504788 CTTTCAAGGCAAAAGTTGCAAGG + Intronic
924191478 1:241557292-241557314 CGTTGAATGCAAATGCTGAAGGG - Intronic
924300977 1:242637366-242637388 CCTTCTCTGCAAACTCTGCTTGG + Intergenic
1063224345 10:4001429-4001451 CCTTTAATGTGAAGGCTGCAGGG - Intergenic
1065555814 10:26914507-26914529 CCTTGAATGCAAAAGTGGCACGG + Intergenic
1069301840 10:66917475-66917497 ACTTCATTGCAAACTATGCAGGG + Intronic
1073586214 10:104712596-104712618 CCTTCAAGGAACACGCTGCCAGG - Intronic
1078632506 11:13016116-13016138 CCTTCAAAGCAATCCATGCAAGG - Intergenic
1083560757 11:63671346-63671368 CCTTCAAAGCAGAAGCAGCAGGG + Exonic
1084548222 11:69825112-69825134 CCATCAATGCCCAAGCTGCAGGG + Intergenic
1086566837 11:88236681-88236703 GCATCTATGCAAAGGCTGCAAGG - Intergenic
1091277234 11:134360840-134360862 CTTTTAAAGCAAACGATGCAGGG - Intronic
1094828627 12:34289724-34289746 CCTTCAAAGCAGCCCCTGCATGG - Intergenic
1095393686 12:41739596-41739618 CCTTCATGGCAAGCTCTGCAGGG + Intergenic
1110946533 13:81427569-81427591 CCTACAAAGCAAATGATGCAGGG + Intergenic
1112337306 13:98525854-98525876 CCTTCTATTCAGACCCTGCATGG - Intronic
1120851488 14:89175981-89176003 CATTCAATGCAATCTCTGCAAGG + Intronic
1124088829 15:26578703-26578725 CTTTCTAGGCAAAGGCTGCATGG + Intronic
1131505298 15:93012812-93012834 CCTTCCATACAAAAGCTGGAAGG - Intronic
1134414579 16:14032430-14032452 GCTTCAATGCAAGAGATGCATGG - Intergenic
1135303139 16:21347729-21347751 ACTCCAAGGGAAACGCTGCATGG - Intergenic
1136299880 16:29326921-29326943 ACTCCAAGGGAAACGCTGCATGG - Intergenic
1137270493 16:46899703-46899725 CCTTCAAAGCTCACGCTCCAGGG - Intronic
1151696789 17:75721906-75721928 CCTTCTTTGCAAACCCTGGAGGG - Intronic
1160352246 18:78193571-78193593 CCTGCAATGCAATCCATGCAGGG - Intergenic
1160445326 18:78922956-78922978 CCTTCAGTGCAAGGGCAGCAGGG + Intergenic
1165362349 19:35344759-35344781 CCTTCCAGGCAAAGGCTGCCAGG + Intronic
1167926448 19:52825019-52825041 CCTGAAATGCAGAGGCTGCAGGG + Intronic
928006867 2:27570402-27570424 ACTTCAAGGCCAAAGCTGCAAGG + Intergenic
933314194 2:80696400-80696422 CCATTAATGCAAACTCTTCAAGG - Intergenic
933558531 2:83862669-83862691 CCATAAATGCCAATGCTGCAAGG - Intergenic
936097644 2:109544874-109544896 CTTTCAATGCAAGCTCTCCAAGG - Intronic
941071983 2:160965837-160965859 CCTTGAATTCAAACTCTGAAAGG + Intergenic
941356809 2:164504004-164504026 CCTTCAATTAGAACTCTGCAAGG - Intronic
945222969 2:207503492-207503514 CCTCCCATGCACACACTGCATGG + Intergenic
946641917 2:221793090-221793112 ATTACAATGCAAACTCTGCAAGG + Intergenic
956374494 3:68600053-68600075 CATTCAATGTAAACTCTGCGAGG - Intergenic
958537845 3:95426676-95426698 TTTTCAATGCAAACACTGCCAGG - Intergenic
959011128 3:101077554-101077576 CCTTCAATGAAAATGCCTCATGG + Intergenic
960101676 3:113748363-113748385 CCTTCAATTGAAAAGCAGCATGG - Intronic
968328978 3:197847760-197847782 ACTTCAAAGCAAAAGTTGCATGG + Intronic
974149577 4:57989561-57989583 CCTCCACTGCGAAAGCTGCAGGG - Intergenic
975450829 4:74524436-74524458 CCTTCAATGCAAAAGTTTGAAGG - Intergenic
979107437 4:116705674-116705696 CCTTCCTTGCAGAGGCTGCAGGG - Intergenic
984500934 4:180557694-180557716 CCTTCAATGCATACTCTACTTGG + Intergenic
988392976 5:30659604-30659626 CCTTCGATGTAACCACTGCAGGG - Intergenic
989146534 5:38256423-38256445 CCTTGGATTCAAGCGCTGCATGG + Intergenic
995061716 5:107817803-107817825 CATTCAATGCTAGAGCTGCAGGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
1002764384 6:226713-226735 CCTTCCATGAAAAGTCTGCATGG - Intergenic
1003212008 6:4077244-4077266 CCCACGATGCAAACGCAGCAAGG + Intronic
1004789792 6:19012099-19012121 CCTTCATTGCAAAGGCTGAAGGG + Intergenic
1010664749 6:78615555-78615577 CCTTCAATGCATATGTTACAAGG + Intergenic
1012032600 6:94091397-94091419 CCTTCAATGCAAAGACAGTATGG - Intergenic
1012971363 6:105735186-105735208 CTTTCAGTCCTAACGCTGCATGG - Intergenic
1018500050 6:164397728-164397750 CATGCAATGCAAAAGATGCATGG + Intergenic
1019685662 7:2380576-2380598 CCTTCAACGGAAATGCTGCTCGG - Exonic
1022665264 7:32404790-32404812 CCTCCAATTGAAACACTGCATGG + Intergenic
1022665606 7:32407376-32407398 CCTCCAATCAAAACACTGCATGG + Intergenic
1023859427 7:44208572-44208594 CCTTCAATGCAAACGCTGCAAGG - Intronic
1024487659 7:49937554-49937576 CCTTCAATGCAATAGCAGCCTGG - Exonic
1025754308 7:64321345-64321367 CCTTCAAAGCAAAAGGTGCATGG - Intronic
1031616617 7:123889209-123889231 CCTTCATTGCAAACTTTTCAGGG - Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038346359 8:26735829-26735851 CCTTCAGTGCACAGGCTACAGGG + Intergenic
1042523836 8:69743863-69743885 TCTCCAATGCAAACACTCCAAGG - Intronic
1046593294 8:116231033-116231055 CCTTCATTGGAAAAGATGCATGG - Intergenic
1046777801 8:118182100-118182122 CCTTTATTGCATATGCTGCAGGG + Intergenic
1047696110 8:127405320-127405342 CTTTGAATGTAAAAGCTGCATGG + Intergenic
1048831850 8:138485348-138485370 CCTTGAATGGAAACTCTGGATGG - Intronic
1049742699 8:144248711-144248733 CCTTCAATGAGCTCGCTGCACGG - Intronic
1057230729 9:93319890-93319912 CCTGCAATGCACACGCAGGAGGG - Intronic
1185458182 X:320688-320710 CCTCCAATCCAGGCGCTGCAGGG - Intergenic
1192461224 X:71319069-71319091 CCTTCAATGAAAACATTGCAAGG - Intergenic