ID: 1023860078

View in Genome Browser
Species Human (GRCh38)
Location 7:44213292-44213314
Sequence GCACCCACTCCTGGTGCTCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 198}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023860078_1023860087 14 Left 1023860078 7:44213292-44213314 CCTTGAGCACCAGGAGTGGGTGC 0: 1
1: 0
2: 0
3: 17
4: 198
Right 1023860087 7:44213329-44213351 GATTCCCAGCACCCCACCTATGG 0: 1
1: 0
2: 0
3: 15
4: 139
1023860078_1023860093 29 Left 1023860078 7:44213292-44213314 CCTTGAGCACCAGGAGTGGGTGC 0: 1
1: 0
2: 0
3: 17
4: 198
Right 1023860093 7:44213344-44213366 ACCTATGGTCTTGCCAGCATAGG 0: 1
1: 0
2: 0
3: 6
4: 84
1023860078_1023860081 -8 Left 1023860078 7:44213292-44213314 CCTTGAGCACCAGGAGTGGGTGC 0: 1
1: 0
2: 0
3: 17
4: 198
Right 1023860081 7:44213307-44213329 GTGGGTGCCAGCCGGCCCCGAGG 0: 1
1: 0
2: 1
3: 16
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023860078 Original CRISPR GCACCCACTCCTGGTGCTCA AGG (reversed) Exonic
900499085 1:2991004-2991026 TCACCCACACCAGGTGCTGATGG - Intergenic
901628168 1:10635168-10635190 GCACTGACTCCTGGGGCCCAGGG - Intergenic
901639597 1:10686611-10686633 CCACCCTCTCTTGGTGCACAGGG + Intronic
903454525 1:23478048-23478070 GGACCCAATCATGTTGCTCAAGG - Intronic
904356153 1:29941300-29941322 GAACCCACTCCTGGTGATGGAGG + Intergenic
904618873 1:31763891-31763913 GCCCCCGCTCCTGCTGCTGACGG - Exonic
904642391 1:31940070-31940092 GCAGCCCCTCCTGCTCCTCAAGG - Intronic
905404289 1:37722804-37722826 TGACCCTCTCCTGGTCCTCAAGG - Intronic
905915706 1:41682837-41682859 GGACTTAGTCCTGGTGCTCACGG + Intronic
907043978 1:51288479-51288501 GGAACCACTCCTGGTCCTCCTGG + Intronic
910443121 1:87273242-87273264 GGACCCGCTCCTGTTCCTCAAGG + Intergenic
911046130 1:93630236-93630258 GCACCCACACCAGATGCACAAGG - Intronic
911071103 1:93832445-93832467 GCAGCCACTCCTAGAGCTCCTGG + Intronic
912936848 1:114011024-114011046 GCACCGCCTCCTGCTTCTCAGGG + Intergenic
913213609 1:116601852-116601874 GGACCCACACCAGGTGCTCCTGG + Intronic
915034468 1:152910592-152910614 GCTGCCCCTCCTGGTGCTCCAGG - Exonic
915648684 1:157292134-157292156 GCATCCACTCCTGGTTCTAGTGG + Intergenic
915933471 1:160075504-160075526 GCTCCCACCCCTGCTGTTCAAGG - Intergenic
917243975 1:172980435-172980457 GCATCCACTCATGTTGCTCTAGG + Intergenic
919245817 1:194982433-194982455 GGACTCATTCCTGGTCCTCAAGG - Intergenic
920041708 1:203102176-203102198 GCACCCACTCCCAGGGCTCCAGG - Intronic
920373946 1:205496794-205496816 GGACCCTCTTCTGCTGCTCAGGG + Intergenic
920960908 1:210663297-210663319 CCCCCTACTCCAGGTGCTCAAGG - Intronic
921982421 1:221273092-221273114 GCACCCTCGCATGGTGCCCAGGG + Intergenic
1065287759 10:24202039-24202061 GCAGCCACACCTGGAGCTGAGGG - Intronic
1065796462 10:29312710-29312732 GCACCCCCTCCTGGCTCCCATGG + Intronic
1066315511 10:34242114-34242136 GAATTCACTCCTGGAGCTCATGG + Intronic
1067226310 10:44378512-44378534 ACACACACACCTGGTCCTCATGG + Intronic
1067750819 10:48969881-48969903 CCACCCCGTGCTGGTGCTCATGG + Intronic
1070449540 10:76544040-76544062 GAACTCACCACTGGTGCTCAGGG + Intronic
1070474959 10:76820958-76820980 GCAGCCACTCCTGGAGCCCCTGG + Intergenic
1070594019 10:77819961-77819983 GTGCCCACTCCTGGAGCTCCGGG + Exonic
1071274746 10:84043192-84043214 GCACCCTCCTCTGGTGCGCAGGG + Intergenic
1076235438 10:128860725-128860747 GCACCAGCTCCTGCTGCTGAGGG + Intergenic
1076844069 10:133060513-133060535 GCAGCCATCCCTGGGGCTCATGG - Intergenic
1077152237 11:1077556-1077578 GGATGCACTCATGGTGCTCAGGG + Intergenic
1077332851 11:1990912-1990934 GCACCCACTGCTGGGCCTCCTGG + Intergenic
1077414451 11:2418244-2418266 GCCCCACCTCCTGGTGCCCAAGG - Exonic
1081905552 11:46667292-46667314 GCCCCCACTGCTGCTGCTTAGGG + Intronic
1083255316 11:61491818-61491840 GCCCCCAGGCCTGCTGCTCAAGG - Intergenic
1083722506 11:64610373-64610395 GCACCTACACCTGGTGATCTTGG - Intronic
1084150492 11:67285857-67285879 GCACCCCCTCCTGCTGCAGAGGG + Exonic
1084604982 11:70167290-70167312 TCACACACTCCTCGTGGTCAGGG - Exonic
1085530891 11:77191417-77191439 GAATCCTCTCCTGGTGCTGAAGG + Intronic
1085620913 11:78037422-78037444 GCACCAGTCCCTGGTGCTCAGGG - Intronic
1088065533 11:105713859-105713881 GTACCCACTACTGGTCCTCTGGG - Intronic
1088994915 11:114987763-114987785 GCAACCTCTCCTGGTGCCAAGGG + Intergenic
1202815834 11_KI270721v1_random:46088-46110 GCACCCACTGCTGGGCCTCCTGG + Intergenic
1093336677 12:17912918-17912940 GCACCCACTCCTGCTGTCCGTGG - Intergenic
1096685428 12:53285395-53285417 GCCCCCACACCTGCAGCTCAGGG - Intronic
1101836633 12:108300222-108300244 GCACCTGCTCCTGGAGCCCAGGG - Intronic
1104835149 12:131785317-131785339 GCAGCCACTCCTGGCCCTCCAGG + Intronic
1105216843 13:18292409-18292431 GGACCCACACCAGGTGCTCCTGG + Intergenic
1106033154 13:26020622-26020644 GCACCCTCTCCAGGTGCACTCGG + Exonic
1113539296 13:111093856-111093878 GCACCCCCTCCTGGTGAGAAGGG + Intergenic
1113683314 13:112260406-112260428 GCCCTCACTGCTGGTGCACAGGG + Intergenic
1116486323 14:45453181-45453203 GTACCCAGTCCTGGTGCTGCTGG + Intergenic
1120327729 14:83051481-83051503 GGACCCACTCCTGGTGGTACTGG - Intergenic
1120539528 14:85736296-85736318 GCAGCCACTCCTGGAGCCCCTGG - Intergenic
1120999401 14:90440674-90440696 ACACACACTGCAGGTGCTCAAGG + Intergenic
1121091455 14:91185554-91185576 GCCACCGCTCCTGGTGCTCTGGG + Intronic
1121779584 14:96613781-96613803 CCATCCCCTCCTGGTGCTCTTGG + Intergenic
1121911867 14:97798951-97798973 GCACCCACACCTGGGGCTAGAGG - Intergenic
1122822010 14:104352310-104352332 GCGCCTTCTCCTGGTGCTCACGG + Intergenic
1123031622 14:105454496-105454518 CCACCCACTCCTGGTGGTGTTGG + Intronic
1123114501 14:105888488-105888510 GCACCCACTCCTGGGACTGAGGG - Intergenic
1123116660 14:105897894-105897916 ACACCCACTCCTGGGGCTGAGGG - Intergenic
1202857289 14_GL000225v1_random:59152-59174 GCACCGGCTCCTGGAGCTCCTGG - Intergenic
1123987781 15:25660009-25660031 GCACCCTCTCCTGGTGTTCTGGG - Intergenic
1126112446 15:45183658-45183680 GCTCCCACCCATGGTCCTCAGGG + Intronic
1129244767 15:74272453-74272475 GCACCGACTCCTGGGAGTCAGGG + Intronic
1130537698 15:84798806-84798828 GAACCCACTCCTGGCACTCCTGG - Exonic
1130661381 15:85833821-85833843 GCACCTGGACCTGGTGCTCAGGG + Intergenic
1131400214 15:92119450-92119472 CCACTCAGTCCTGGTGCTCAGGG - Intronic
1132193885 15:99895346-99895368 GTACCAACTCCTGGGGCTTACGG - Intergenic
1132251519 15:100339170-100339192 GCACCCTCACATGGTGCTAAAGG + Intronic
1135509962 16:23073898-23073920 GCAGCCTCCCCTGGTGCTGATGG - Intronic
1137683711 16:50371872-50371894 GGAGCCACTCCAGGAGCTCAGGG - Intergenic
1138067861 16:53960676-53960698 GAACCCATTCCTTGTGGTCAGGG - Intronic
1139253453 16:65518969-65518991 ACAGCCACTCCTGGGGCACAGGG + Intergenic
1139589262 16:67924386-67924408 GCATCAACCCCTGCTGCTCATGG - Intronic
1141455329 16:84137455-84137477 GCTCCCTCCCTTGGTGCTCAAGG - Intronic
1142207440 16:88790847-88790869 GCAGCCAGGCCTGGTCCTCAGGG + Intergenic
1142625145 17:1187096-1187118 GCAGCCACTCCTGGGCCTGATGG - Intronic
1142833969 17:2570731-2570753 TCATCCACTCATGGTGCCCATGG - Intergenic
1142891531 17:2947191-2947213 CCACCAACTCCTGATGCTCACGG - Intronic
1143025693 17:3940936-3940958 TCACCCCCTCCTGGGGCTCCAGG + Intronic
1145782334 17:27571349-27571371 GCACCCACCATTGGGGCTCATGG - Intronic
1146846342 17:36183789-36183811 GCAGACACCCCTGTTGCTCAGGG - Intronic
1146889034 17:36493028-36493050 GGCCCCACTCCTGATGCTCAAGG - Intronic
1147671573 17:42179944-42179966 ACAACCAGTCCTGGTGCTCTAGG + Intronic
1148894794 17:50833439-50833461 ACCCCCACTCCTGGGGCTGATGG - Intergenic
1149692244 17:58587816-58587838 GCACCCTCTGCTGGTGCAAAGGG - Intronic
1151400996 17:73855985-73856007 GGACCCACTCCCTGTCCTCAGGG - Intergenic
1151661853 17:75523368-75523390 CCACCAACTCCTGGCGGTCAAGG - Intronic
1153395720 18:4618067-4618089 GCATCTGCTCCTGGTGGTCACGG - Intergenic
1153613771 18:6914705-6914727 TCACCCATTCCTAGTGCTCTTGG + Exonic
1154192412 18:12241833-12241855 TCACACACTCCTGGTGCTGGCGG - Intergenic
1155173113 18:23281801-23281823 GCAGCCACTCCTGTTGCTGGAGG - Intronic
1157509488 18:48260339-48260361 CCTCCCACTCCTAGTGCCCAGGG - Intronic
1157729154 18:49988856-49988878 ACACACACTCCTTGTCCTCAAGG + Intronic
1158384780 18:56976848-56976870 GGGCCCACCCCTTGTGCTCAGGG - Intronic
1158591354 18:58781475-58781497 AAACGCGCTCCTGGTGCTCAGGG - Intergenic
1160437923 18:78865976-78865998 GCCCCCACTCCAGGTCCTAATGG - Intergenic
1160673231 19:376132-376154 GGACTCAGTCCTGGTGGTCACGG + Intergenic
1160908949 19:1466028-1466050 GCACCCGCTGCTGCGGCTCAAGG + Exonic
1163419313 19:17205385-17205407 GCACCACCTCCTGGTGCACCTGG - Intronic
1163602517 19:18257561-18257583 GCTCCCGATCCTGGAGCTCAGGG + Exonic
1164859468 19:31551344-31551366 CCACCCAGCCATGGTGCTCAGGG - Intergenic
1164995835 19:32720075-32720097 GCTCCAGCTCCTGGTGCTGAAGG + Exonic
1166837583 19:45677038-45677060 GCACAGTCTCCTGGTGCTCGTGG + Exonic
926082869 2:10002992-10003014 GCACCCACTCCCTGCTCTCACGG + Intergenic
932993457 2:76817181-76817203 GCATGCACTCCTGGCACTCATGG - Intronic
933319995 2:80761536-80761558 GCACAAACTCCTGGTCCTTATGG + Intergenic
933812170 2:86039666-86039688 GGGCCCACTCCTTGTGCTCAGGG + Intronic
934297481 2:91754276-91754298 GGACCCACACCAGGTGCTCCTGG - Intergenic
934567881 2:95350592-95350614 GCCCCCACCCCTGCTGCTCCGGG - Intronic
934992812 2:98933300-98933322 CAACCCTCTCCTGGTGCCCAGGG + Intronic
935203206 2:100876339-100876361 GTCCCCACGCCTGCTGCTCAGGG + Intronic
935354524 2:102186853-102186875 GCAGACACTCCTGGTGATGAAGG + Intergenic
935453303 2:103235977-103235999 GCACACAGTCCAGATGCTCAGGG - Intergenic
937392955 2:121507777-121507799 GAACCCACTCATTGTGCACAAGG + Intronic
938081749 2:128373935-128373957 GAACCCTCTCCTGGTCCTCCTGG + Intergenic
938093726 2:128448724-128448746 GACCCCTCTCCTGTTGCTCAGGG - Intergenic
948320150 2:237062470-237062492 GCATCCATTCCTGGAGCTCTGGG + Intergenic
948869918 2:240792619-240792641 GCCCTCACACCTGGTGCTCAAGG - Intronic
1169474994 20:5923203-5923225 GCTCCCACTCCAGGTCCTCAGGG - Exonic
1170949285 20:20921446-20921468 GCACCAACTGCTGGTGGTAATGG + Intergenic
1172387230 20:34542465-34542487 GTACAAAATCCTGGTGCTCAAGG - Intergenic
1172749158 20:37237690-37237712 GCTGCCACTGCTGGTGCTAAGGG - Intronic
1174253246 20:49235005-49235027 GCACATCCTCCTGGGGCTCATGG + Exonic
1175465831 20:59191071-59191093 GCTCCCACTCCTGGCCCTCCAGG + Exonic
1175943860 20:62549957-62549979 CCACCCACTCCTGGTGGCCTGGG + Intergenic
1176302907 21:5107224-5107246 GCACCCAGTCCTGGTCGTCCGGG + Intergenic
1178003846 21:28194323-28194345 GCACCCAACCCTGGAGCACATGG + Intergenic
1179443227 21:41410813-41410835 GCAGGCACTCCTGGTCCCCAGGG + Intergenic
1179630061 21:42672255-42672277 GCACGCACCCCTGGAGCTGAGGG + Intronic
1179854117 21:44154699-44154721 GCACCCAGTCCTGGTCATCCGGG - Intergenic
1180948478 22:19709610-19709632 GCACTCACTCCAGCTGCCCAGGG + Intergenic
1181511170 22:23389293-23389315 GCCCCCTCCCCTGCTGCTCAAGG + Intergenic
1184687004 22:46100753-46100775 GCACCCACTCCTGAAGGACAGGG - Intronic
1185085469 22:48738418-48738440 GCAGCCACTCCTGGGCCTCTGGG + Intronic
950515693 3:13463554-13463576 GCACCTACTCTTGGTGATGACGG - Intergenic
953237958 3:41122465-41122487 AGACCCAGTCCTGGTCCTCATGG - Intergenic
953759933 3:45678666-45678688 GCACCCAGTCCTCTTGCTCTGGG - Exonic
954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG + Intronic
954538983 3:51381418-51381440 GCACCCCCTCATCGTGCTCCAGG - Exonic
954986099 3:54793569-54793591 GCAACCACTCTTGGTGATGATGG + Intronic
956264828 3:67385257-67385279 ACACCCACAGCTGCTGCTCAGGG + Intronic
956304069 3:67805002-67805024 ACAGCCACTGCTGCTGCTCAAGG - Intergenic
961454206 3:127016211-127016233 ACACCCACTCCTGGTGACCCTGG - Intronic
962367291 3:134795036-134795058 GCTCCCCCTCGTGGTGCTCTCGG - Intronic
962654931 3:137533458-137533480 GAGCCCTCTCCTGGGGCTCATGG - Intergenic
963044434 3:141092507-141092529 AGGCCCACTCCTGGTGCACAGGG - Intronic
965437197 3:168666832-168666854 GGAGCCACTCCTGTTGCTGATGG + Intergenic
968451870 4:679706-679728 GCACTTAGTCCTGGGGCTCACGG + Intronic
970403215 4:15737645-15737667 CCACCCAGTCCTTGTGCTCAGGG - Intronic
970831188 4:20341528-20341550 CCACTCACTCCTGCTGCTCCTGG - Intronic
972193982 4:36630375-36630397 CAACCCAAACCTGGTGCTCATGG + Intergenic
972797850 4:42440056-42440078 GCACTCTCTCCTGATGTTCATGG + Intronic
983436763 4:167725147-167725169 GCCCCCACTTCTGGCACTCAGGG + Intergenic
983845679 4:172514749-172514771 GTAGGCACTCCTGGTCCTCAGGG - Intronic
985016369 4:185639211-185639233 GGATCCACTCCTGGTGGGCAGGG - Intronic
985093756 4:186391608-186391630 GCTCCCACTCATGGTGCTCCAGG - Intergenic
985775614 5:1840316-1840338 GTGCCAACTCCTGCTGCTCAGGG + Intergenic
985863548 5:2493786-2493808 GCACCTGCTCCTGGTGCTATGGG + Intergenic
985989532 5:3543998-3544020 GCACCCACTTCTTGTGCTGTGGG + Intergenic
987073517 5:14359648-14359670 ACACCCCCTCCTGGTGCAGAGGG - Intronic
988540912 5:32108493-32108515 ATACCCAATCCTGGTGATCAGGG + Exonic
990400297 5:55430363-55430385 GCTGCCACTCCTGGGGCTCGAGG + Intronic
991248113 5:64529403-64529425 GTACCCAGTCCTGGTTCTCTTGG - Intronic
1000273477 5:159710133-159710155 CCACCCACTCCTGGAGCTGGTGG - Intergenic
1001686315 5:173597381-173597403 GCAACAACTCCTGGTACTCCTGG + Intergenic
1001925210 5:175631157-175631179 GCACCCACTGCTGGAGGTGATGG + Intergenic
1002175757 5:177400243-177400265 GCGCGCGCTCCTGGTGCTAATGG - Exonic
1003344256 6:5251864-5251886 GTTCCCACTCCAGGAGCTCATGG + Intronic
1004062022 6:12206852-12206874 TCACCCACTCCTGGGGCAAAGGG - Intergenic
1005670957 6:28105574-28105596 GAGACCACACCTGGTGCTCAGGG - Intergenic
1006463513 6:34177502-34177524 GCTCCCTCTCCTGCTGCTAAGGG + Intergenic
1009864258 6:69376744-69376766 GCACTTACTGCTGGGGCTCAGGG - Intronic
1010773565 6:79860102-79860124 CCTCCCACTCCTTGTGTTCAGGG + Intergenic
1012694128 6:102355913-102355935 GCCCCCACCCCTGTTGCTCCTGG - Intergenic
1015822913 6:137282114-137282136 GCACCCACTCAGGGAGCTCTGGG - Intergenic
1018905179 6:168071831-168071853 CCAGCCCCTCCTGTTGCTCAAGG + Intronic
1019416157 7:927370-927392 GCGGCCCCTCCTGCTGCTCAAGG - Intronic
1020089842 7:5332914-5332936 GCACCCACGCCTGGCGCCCGCGG - Exonic
1023860078 7:44213292-44213314 GCACCCACTCCTGGTGCTCAAGG - Exonic
1024089549 7:45923963-45923985 GAGCCCACTCCTGCTGCTAAAGG + Intergenic
1026055393 7:66979419-66979441 GCACCAAGTCCTGGGGCTCCTGG + Intergenic
1029356687 7:100057300-100057322 GCACCCAGGCCTGGAGCTCCTGG - Exonic
1029438018 7:100573443-100573465 GCACCCTCCCCTGGAGCCCAAGG + Exonic
1030276154 7:107723906-107723928 TCTCAAACTCCTGGTGCTCAAGG + Intergenic
1033036771 7:137882686-137882708 TCCCTCACTCCAGGTGCTCAGGG + Intronic
1033603395 7:142906986-142907008 GCACCCATTATAGGTGCTCATGG - Intergenic
1033691404 7:143740826-143740848 GGACCCACTTCTGGGGCTTAGGG + Intergenic
1034498597 7:151436114-151436136 CCTCCCACGCCTGGTGCTGAAGG + Intronic
1034556661 7:151854683-151854705 GCTCCCACTCCTTGAGCTCAGGG + Intronic
1037654703 8:20872914-20872936 GCACCTGCTGCTAGTGCTCATGG + Intergenic
1037764253 8:21762205-21762227 GCCCCCACTCCTGGTGGTGAGGG - Intronic
1045034894 8:98169277-98169299 TCACCAACTCCTGGGGCTCAAGG + Intergenic
1046012275 8:108563879-108563901 CCACTTACTTCTGGTGCTCATGG + Intergenic
1048177053 8:132162393-132162415 TCATCTACTCCTGGTGCTTATGG + Intronic
1048889202 8:138932874-138932896 TCACTCACGCCTGGAGCTCAGGG + Intergenic
1052744434 9:32426340-32426362 GAACTCAATCCTGCTGCTCAGGG - Intronic
1055650621 9:78403465-78403487 GCACCCATTGCTGGTGCTGTTGG - Intergenic
1056877620 9:90349718-90349740 TCACCCACACCTGCTGCTGATGG + Intergenic
1059402413 9:114078478-114078500 GAGCCCAATCCTGGTGCTCCAGG - Intergenic
1060991271 9:127850524-127850546 CCACCCTCTCCTGGTTCACACGG + Intronic
1061205236 9:129159199-129159221 GCCCCTACTCCTGGTGCTGGGGG - Intergenic
1061251304 9:129428130-129428152 GCCCCCACTCCTGGTCCTGTTGG + Intergenic
1061290364 9:129647318-129647340 GGACCCCCTGCTGGTGTTCAGGG - Intergenic
1062276494 9:135733787-135733809 GCACCCACGCCTGGTGCTATGGG - Intronic
1187925996 X:24250554-24250576 TCTCCAACTCCTGGGGCTCAAGG + Intergenic
1189446780 X:41086669-41086691 GCTCCCACTCCAGGAGCCCAGGG - Intronic
1195446616 X:104959362-104959384 GCACGTATTCTTGGTGCTCAGGG + Intronic
1198166739 X:134064937-134064959 GCACCTACTCATGGTTCTCAAGG - Intergenic