ID: 1023861463

View in Genome Browser
Species Human (GRCh38)
Location 7:44219812-44219834
Sequence CAGTCCACACTGGCCAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023861463_1023861468 9 Left 1023861463 7:44219812-44219834 CCAGCTCTGGCCAGTGTGGACTG No data
Right 1023861468 7:44219844-44219866 TCACCAGCTCCCCAGTCCTCTGG 0: 1
1: 1
2: 2
3: 30
4: 397
1023861463_1023861469 10 Left 1023861463 7:44219812-44219834 CCAGCTCTGGCCAGTGTGGACTG No data
Right 1023861469 7:44219845-44219867 CACCAGCTCCCCAGTCCTCTGGG 0: 1
1: 0
2: 2
3: 34
4: 308
1023861463_1023861472 14 Left 1023861463 7:44219812-44219834 CCAGCTCTGGCCAGTGTGGACTG No data
Right 1023861472 7:44219849-44219871 AGCTCCCCAGTCCTCTGGGGAGG 0: 1
1: 0
2: 1
3: 27
4: 242
1023861463_1023861470 11 Left 1023861463 7:44219812-44219834 CCAGCTCTGGCCAGTGTGGACTG No data
Right 1023861470 7:44219846-44219868 ACCAGCTCCCCAGTCCTCTGGGG 0: 1
1: 0
2: 2
3: 29
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023861463 Original CRISPR CAGTCCACACTGGCCAGAGC TGG (reversed) Intronic