ID: 1023862114

View in Genome Browser
Species Human (GRCh38)
Location 7:44222951-44222973
Sequence CTGCTGTCACTGTGCAGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 286}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023862114_1023862125 7 Left 1023862114 7:44222951-44222973 CCCCTGCTGCACAGTGACAGCAG 0: 1
1: 0
2: 1
3: 34
4: 286
Right 1023862125 7:44222981-44223003 CCGATGGCACCTGAGGAGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 138
1023862114_1023862119 -9 Left 1023862114 7:44222951-44222973 CCCCTGCTGCACAGTGACAGCAG 0: 1
1: 0
2: 1
3: 34
4: 286
Right 1023862119 7:44222965-44222987 TGACAGCAGGAGGAGCCCGATGG No data
1023862114_1023862120 0 Left 1023862114 7:44222951-44222973 CCCCTGCTGCACAGTGACAGCAG 0: 1
1: 0
2: 1
3: 34
4: 286
Right 1023862120 7:44222974-44222996 GAGGAGCCCGATGGCACCTGAGG 0: 1
1: 0
2: 1
3: 7
4: 134
1023862114_1023862121 5 Left 1023862114 7:44222951-44222973 CCCCTGCTGCACAGTGACAGCAG 0: 1
1: 0
2: 1
3: 34
4: 286
Right 1023862121 7:44222979-44223001 GCCCGATGGCACCTGAGGAGTGG 0: 1
1: 0
2: 1
3: 10
4: 133
1023862114_1023862123 6 Left 1023862114 7:44222951-44222973 CCCCTGCTGCACAGTGACAGCAG 0: 1
1: 0
2: 1
3: 34
4: 286
Right 1023862123 7:44222980-44223002 CCCGATGGCACCTGAGGAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023862114 Original CRISPR CTGCTGTCACTGTGCAGCAG GGG (reversed) Intronic
900154612 1:1198935-1198957 CTGCTGTCCCTGTGGAGCGCAGG - Intergenic
900676554 1:3890842-3890864 CTGGCGTTTCTGTGCAGCAGGGG - Exonic
900919194 1:5660012-5660034 CTGCTGGCACAGGGCAGCTGAGG + Intergenic
903133561 1:21294380-21294402 TTCCTGGCACTGTGCAGCCGTGG + Intronic
903258192 1:22116715-22116737 CTGCTGTGAGTTTGCTGCAGCGG + Intergenic
904279462 1:29408842-29408864 CTGCTGTTTCTGTTCAGCTGTGG - Intergenic
905899885 1:41574488-41574510 CTGGTGGCACTGACCAGCAGGGG - Intronic
906567952 1:46813898-46813920 CTGCTGTCCCTGCTAAGCAGAGG - Exonic
906642337 1:47449054-47449076 CAGCTGTCGCTCTGCAGCAAGGG + Intergenic
907340835 1:53735146-53735168 CTCCGGTCACTGGGCAGCTGTGG + Intergenic
908289710 1:62652108-62652130 CTGCTGTCACTGTGCACACATGG + Intronic
908481058 1:64539864-64539886 GTGCTGTCAGAGTTCAGCAGAGG - Intronic
908580004 1:65505012-65505034 GTGCTGTCAACGTGCAGCACTGG + Intronic
910116336 1:83736373-83736395 CTTCTGTCACTGCTCTGCAGGGG - Intergenic
910625626 1:89303261-89303283 GGGCTCCCACTGTGCAGCAGTGG + Intergenic
911413460 1:97540505-97540527 CTTCTGTCCCTGTGGAGCTGGGG + Intronic
912415555 1:109506211-109506233 ATGCTTTGACTTTGCAGCAGAGG + Exonic
912819434 1:112854955-112854977 GGGCTCCCACTGTGCAGCAGTGG + Intergenic
914453005 1:147810020-147810042 CTGTTTTCACTGTGGAGCACAGG + Intergenic
914999816 1:152579206-152579228 CTGCTGGAATTGTGCGGCAGTGG - Intronic
916403858 1:164477425-164477447 GTGATGTCAGTGAGCAGCAGGGG + Intergenic
916672899 1:167040204-167040226 TTGCTGTCAGTTTGCAGCAAAGG + Intergenic
917538575 1:175892254-175892276 CTTCTGTCTCTGCCCAGCAGTGG - Intergenic
917620783 1:176793626-176793648 CTGCTGACACTCTGGAGCACTGG + Exonic
919338460 1:196270047-196270069 TTTCTTTCACTGTGCAGTAGTGG + Intronic
920093648 1:203471903-203471925 ATGCTGTCTCTGCCCAGCAGGGG + Intergenic
921577688 1:216855956-216855978 AGGCTATCACTGTGCAGCACTGG - Intronic
922364508 1:224851442-224851464 CAGCTGTCACTGACCAGCATAGG - Intergenic
922475584 1:225905132-225905154 CTGCTGTCACTGGGCTGAGGAGG - Intronic
922513292 1:226186983-226187005 CGGCTGTCAGTGCCCAGCAGGGG + Intergenic
922958689 1:229626256-229626278 CTGCTGTCCCGGTGCGGCGGAGG - Exonic
923196998 1:231678111-231678133 CTGCAGTCACTTTGGAGCATAGG - Intronic
923443244 1:234041240-234041262 CTCCTGTCACTGTGTGACAGTGG + Intronic
1063778618 10:9294142-9294164 CTGCTTTCACTATGTGGCAGTGG - Intergenic
1063947424 10:11191562-11191584 CTGAAGTCACTGAGTAGCAGGGG + Intronic
1064018555 10:11791529-11791551 CTGCTGTCTCTGAGCCACAGAGG - Intergenic
1064710573 10:18119964-18119986 CTGCTGTCAGTGTTCAGATGTGG + Intergenic
1066321594 10:34308373-34308395 CCGCTGTTACTGTGCCCCAGTGG - Intronic
1066604409 10:37146089-37146111 CTGTTACCACTGTGCAGCAGGGG - Intronic
1070854382 10:79594874-79594896 CTGATGGCACTGGGCTGCAGAGG + Intergenic
1071083513 10:81840815-81840837 CTGCTGCCAGTGAGGAGCAGAGG - Intergenic
1072446221 10:95501053-95501075 TTGCTGCCACTGTGCAGAACTGG - Intronic
1076383958 10:130044194-130044216 CTCCTATCACAGTGCACCAGTGG - Intergenic
1076778547 10:132711249-132711271 GGGCTGTCACTGGGAAGCAGGGG + Intronic
1076853038 10:133102464-133102486 CTCCCGTCTCTGTGCAGAAGGGG + Intronic
1077324044 11:1956042-1956064 CGGCTGTCACGCTGCAGCAGAGG - Intronic
1080875360 11:36269950-36269972 CTGCAGTGAATGTGCAGCATTGG + Intergenic
1081383728 11:42446503-42446525 CTGCTGTCACTGTGCATCTCAGG - Intergenic
1081892989 11:46560218-46560240 CTGCTGCCTGTGTGCAGTAGAGG - Intronic
1083456569 11:62782777-62782799 CTGCTGCCACTATGGAGCCGTGG + Exonic
1083666052 11:64275348-64275370 GTGCGGTGACTGTGGAGCAGGGG + Intronic
1084176586 11:67425528-67425550 ATCCTGCCTCTGTGCAGCAGAGG + Exonic
1084738396 11:71121008-71121030 ATGCTGTGTCTGTGCAGCACGGG + Intronic
1085330277 11:75643559-75643581 CTGCTGTGGATGTGCAGTAGTGG - Intronic
1085783427 11:79430120-79430142 CTGCTGTCACTTAGCAGCGTTGG + Intronic
1086491657 11:87362280-87362302 CTCCTGGCAATGTGCAGAAGGGG + Intergenic
1087589282 11:100165277-100165299 CTGCTTTCACTGTACTCCAGTGG + Intronic
1089320008 11:117619278-117619300 ATGCTGTCATGGTACAGCAGAGG + Intronic
1089891226 11:121883404-121883426 CTGCTTTCCCTATGCAGCTGAGG + Intergenic
1090611339 11:128473767-128473789 CTGCTCACTCTCTGCAGCAGGGG + Intronic
1202807030 11_KI270721v1_random:11237-11259 CGGCTGTCACGCTGCAGCAGAGG - Intergenic
1091641746 12:2242300-2242322 TTGCTGTCTCTGTGTAGCAATGG - Intronic
1093454040 12:19347066-19347088 CTGCTATCACTGGGCAGAGGGGG - Exonic
1094665277 12:32514114-32514136 CTGCTTTCACCGTACAGCAAGGG - Intronic
1095429733 12:42120414-42120436 CTTCTAACACAGTGCAGCAGTGG + Intronic
1100765201 12:97856404-97856426 CTGGTGCCACAGTGCTGCAGGGG + Intergenic
1103929122 12:124439968-124439990 CTGGGGTCTCGGTGCAGCAGTGG - Intronic
1104072787 12:125360952-125360974 CTACTCTCACTGTACAGGAGAGG - Intronic
1104401066 12:128476676-128476698 CTGCTTGTACTGTGCAGCTGAGG - Intronic
1104743068 12:131193102-131193124 CTGCTGGGACTGAGCCGCAGTGG - Intergenic
1104925643 12:132312788-132312810 CTGTTGTCAAGGGGCAGCAGAGG + Intronic
1105422560 13:20266071-20266093 GTGCTGGGACTGTGCAGCATGGG - Intergenic
1105983056 13:25538442-25538464 CAGCTATCAATGTGCAGCACTGG - Intronic
1107010105 13:35661904-35661926 ATCCTCTCACTGTGCAGCGGAGG + Intronic
1107177994 13:37422467-37422489 CTGCTGTGACAGGGCAGCAGAGG - Intergenic
1107978591 13:45713674-45713696 GCGCTGTCTTTGTGCAGCAGTGG - Exonic
1108574807 13:51781934-51781956 CTGCAGTCACTGTGATGTAGTGG - Intronic
1111747627 13:92290808-92290830 GGGCTCTCACAGTGCAGCAGCGG - Intronic
1112306501 13:98279672-98279694 CAGCTGTCACTCTGCTGCAGGGG - Intronic
1112685808 13:101824928-101824950 CTTCTGTCCCTGTGGAGCTGGGG - Intronic
1113076804 13:106475057-106475079 CAGCTGGCATTGTGCTGCAGAGG - Intergenic
1113443129 13:110345428-110345450 CTGCTGTTCCTGGGAAGCAGTGG + Intronic
1113731241 13:112642926-112642948 GTGCTGTCACTGAACAGCAGCGG + Intergenic
1119647330 14:76357133-76357155 CTGGTGGCACTGGGCAGGAGTGG - Intronic
1119852049 14:77873166-77873188 CTGCTGCCACTTGGCAGCAGAGG + Intronic
1120436588 14:84490000-84490022 CTGCTTTCACTTTACAGCAAAGG + Intergenic
1121645507 14:95515313-95515335 TTCCTGTCACTGTGCCCCAGCGG - Intergenic
1122015340 14:98790280-98790302 CTGGTCCCACTGTGAAGCAGTGG + Intergenic
1123706837 15:22956718-22956740 CTGCTGTCTCGGGGCGGCAGTGG - Intronic
1124001933 15:25767315-25767337 CTGCTGTCACCAGGAAGCAGAGG + Intronic
1128357302 15:66937080-66937102 CTGCTTTCACACTGCAACAGTGG - Intergenic
1129906617 15:79192084-79192106 CTGCTGCCACTGTGCAGGCCTGG + Intergenic
1130870861 15:87971189-87971211 CCACTGTCAGTGGGCAGCAGGGG - Intronic
1133281533 16:4668256-4668278 CTGCCGTCCATGTGCTGCAGGGG - Exonic
1134202445 16:12210199-12210221 CTGCTGTCACAGTGCTGCTGGGG + Intronic
1134327017 16:13216671-13216693 CAGATGTCACTGGGGAGCAGTGG + Intronic
1134394258 16:13848562-13848584 ATGCTGTCACTGTGGAACACTGG - Intergenic
1135270130 16:21061994-21062016 GTGCTGTCACTGAGCAGAAATGG + Intronic
1136711647 16:32241610-32241632 CAGCTGTGACTGTGCATCCGTGG - Intergenic
1136756269 16:32687796-32687818 CAGCTGTGACTGTGCATCCGTGG + Intergenic
1136811844 16:33182579-33182601 CAGCTGTGACTGTGCATCCGTGG - Intergenic
1136818320 16:33292659-33292681 CAGCTGTGACTGTGCATCCGTGG - Intronic
1136824884 16:33349192-33349214 CAGCTGTGACTGTGCATCCGTGG - Intergenic
1136829950 16:33447963-33447985 CAGCTGTGACTGTGCATCCGTGG - Intergenic
1137044328 16:35641993-35642015 CTGGAGCCACTGTGGAGCAGTGG - Intergenic
1137975508 16:53028151-53028173 CTGCTCTGACTGAGTAGCAGGGG + Intergenic
1139248293 16:65470046-65470068 AGGCTGTCACTGTGCTGCAGGGG - Intergenic
1139290638 16:65855243-65855265 CAGGTGTCACTGAGTAGCAGGGG + Intergenic
1139958152 16:70703066-70703088 CTGCTGTGAGTGGGCACCAGGGG + Intronic
1139967175 16:70752241-70752263 GTGCTGTCACTGTTAATCAGTGG - Intronic
1141213065 16:81999103-81999125 ATTCTGTCACTGTGAAGGAGGGG - Exonic
1142067274 16:88069913-88069935 TTGCTGTCTCAGGGCAGCAGAGG - Intronic
1142246516 16:88972666-88972688 CTGCTGACCCTGTGGGGCAGAGG - Intronic
1202990422 16_KI270728v1_random:5547-5569 CAGCTGTGACTGTGCATCCGTGG - Intergenic
1203058407 16_KI270728v1_random:948149-948171 CAGCTGTGACTGTGCATCCGTGG + Intergenic
1145312481 17:21708171-21708193 CTCCTGGCACTGGGCACCAGCGG - Intergenic
1148197171 17:45722334-45722356 CTGAGGCCACTGTCCAGCAGGGG + Intergenic
1149130088 17:53289292-53289314 CTTTTGAAACTGTGCAGCAGTGG - Intergenic
1150977545 17:70105484-70105506 TTGCTGTCACTTTGCAACAGTGG - Intronic
1152158096 17:78648087-78648109 CTGCTGTCACCGTGGAGCTGTGG + Intergenic
1152162389 17:78676994-78677016 CTGGTGCCACCGTTCAGCAGGGG - Intronic
1152175368 17:78783253-78783275 GTGCTGGCATTCTGCAGCAGTGG - Intergenic
1152621718 17:81368251-81368273 CTGCCTTCACTGAGCAGCATCGG + Intergenic
1152680296 17:81664412-81664434 TTGCTCTCAGCGTGCAGCAGAGG - Intergenic
1153145052 18:2021800-2021822 CTGCTGTCCCAGTACAACAGAGG - Intergenic
1153424990 18:4953006-4953028 CTGCGGCCACTGTGCAGGATGGG - Intergenic
1154411347 18:14143736-14143758 CTGCTGTCAGAGGCCAGCAGGGG + Intergenic
1154477750 18:14781028-14781050 CTGTTACCACTGTGCAGCAGGGG - Intronic
1155098117 18:22579748-22579770 GTGCTGCTCCTGTGCAGCAGTGG + Intergenic
1156171659 18:34493687-34493709 CTGCGGTCCCTGCGCAGCCGGGG - Intronic
1157298872 18:46465433-46465455 CAGCAGTCCCTGTCCAGCAGGGG + Intergenic
1160047524 18:75400625-75400647 CAGCTGTCACTCTGGAGGAGGGG + Intergenic
1160173497 18:76573418-76573440 CTGAGGCCACTGTGCAGAAGTGG + Intergenic
1161003195 19:1921431-1921453 CTGAGGACACGGTGCAGCAGGGG + Intronic
1162066863 19:8131261-8131283 TTCCAGGCACTGTGCAGCAGTGG - Exonic
1162524196 19:11197812-11197834 CTGCTGTCCCTGGGCCGCTGCGG + Intergenic
1163759924 19:19130632-19130654 CTGCTGTCAAAATGCAGCATGGG + Intronic
1165144797 19:33724302-33724324 ATCCTCTCACTGTGCAGAAGGGG + Intronic
1165782350 19:38441843-38441865 CTCCTGTGTCTGTGAAGCAGAGG + Intronic
1166121179 19:40687796-40687818 CAGATGTCAGTGTGCAGCAGTGG - Intronic
1166967369 19:46537400-46537422 CTGTTGTCACTGTGGGGAAGTGG + Intronic
925245774 2:2381156-2381178 CTTCTGTAACTCTGCAGCTGTGG - Intergenic
925426395 2:3751933-3751955 CAGCTGTGACTGTGCAGGACAGG - Intronic
926329823 2:11815197-11815219 CTGCTGGGACTCAGCAGCAGGGG - Exonic
927110003 2:19857908-19857930 CTGCTGTCCCGGTGCGGCAGAGG - Intergenic
927326356 2:21810182-21810204 CTTCTGTCCCTGTGCCACAGTGG + Intergenic
927885072 2:26713263-26713285 CTCCAGTGACTCTGCAGCAGTGG + Intronic
927896023 2:26782624-26782646 TTGCTGTCACTGGGGTGCAGTGG + Intronic
928483959 2:31711030-31711052 CTGCTGTGACAGGGCAGCACTGG - Intergenic
929424850 2:41833763-41833785 CTGCTCTCACTGTTCAGAAATGG - Intergenic
930048544 2:47194983-47195005 TTGCTGTCACTGTCCACCTGGGG - Intergenic
930370071 2:50490715-50490737 CTGCTGTCACGGTGGGGCAATGG + Intronic
930758926 2:55010246-55010268 CTGCTGCAGTTGTGCAGCAGAGG - Intronic
930901059 2:56508204-56508226 CTGCTGTCCCAGTGGAGCAAAGG - Intergenic
932460041 2:71876143-71876165 CTCCTGTCCCTCTGCTGCAGAGG + Intergenic
932513830 2:72324485-72324507 TTGCTGTCACTGTACTGTAGTGG - Intronic
937204207 2:120225268-120225290 GTCCTGTCACAGTGCAACAGTGG + Intergenic
937941138 2:127286923-127286945 CAGCTGTTTCTGTGGAGCAGTGG - Exonic
938318752 2:130347981-130348003 ATGCTGTCAGTGTGCAAAAGAGG + Intergenic
938725482 2:134105076-134105098 CTGCTTTCATTGTAGAGCAGAGG - Intergenic
939114160 2:138041353-138041375 CTGCTGTCAGTGTTCAGGATAGG - Intergenic
939600732 2:144186907-144186929 CTGCTGTCATTTTGCAGCTGAGG - Intronic
943301968 2:186213995-186214017 CAGCTGTCACTGAGCAGCATGGG + Intergenic
945048449 2:205801797-205801819 CTGGTGCCACTGTGTAGGAGAGG - Intergenic
945077678 2:206056553-206056575 CTGCTGTGAAGGTGCAGGAGGGG + Exonic
945404172 2:209424461-209424483 CAGGTGTCACTGCGGAGCAGGGG + Intronic
947712431 2:232323768-232323790 CTGCTGCCAGTCTCCAGCAGAGG - Intronic
947719820 2:232363583-232363605 CTGCTGCCAGTCTCCAGCAGAGG - Intergenic
947731390 2:232433448-232433470 CTGCTGCCAGTCTCCAGCAGAGG - Intergenic
948099750 2:235364493-235364515 CTGCTGTCTCTTTTTAGCAGGGG + Intergenic
1171533700 20:25868293-25868315 CTGCCTTCACTGAGCAGCGGTGG - Intergenic
1173252404 20:41371131-41371153 CTGTGGTCCCTGTGCAGGAGGGG - Intergenic
1175598688 20:60255571-60255593 CTGCTGCCACTGTGCACCACGGG - Intergenic
1175731106 20:61354445-61354467 AAGCTGTCAATGTGCATCAGTGG - Intronic
1175743405 20:61436297-61436319 CTTCTGACACTGTCTAGCAGAGG + Intronic
1176012741 20:62908357-62908379 CTGCAGTCACGGTGCAGCGGGGG - Intronic
1176861710 21:14014681-14014703 CTGCTGTCAGAGGCCAGCAGGGG - Intergenic
1178286504 21:31329727-31329749 CAGCAGTCACTGGGCAGCAGGGG - Intronic
1179092552 21:38280251-38280273 CAGCTTGCACTGTGCAACAGTGG - Intronic
1179428098 21:41297650-41297672 CTACTGTGACTGTGCTGCAGTGG - Intergenic
1179523766 21:41962197-41962219 CTTCTGTCACTGAGAAGCAGGGG + Intergenic
1179985799 21:44919768-44919790 CTGCTGTCCCTGTCCATCCGGGG - Intronic
1180706145 22:17811080-17811102 CTCCTGTCCCTGTGCAGAGGTGG - Intronic
1181843188 22:25682997-25683019 CTCCTGTAGCTGTGCAGCAGAGG + Intronic
1182058375 22:27378962-27378984 CTGCAGCCACTGGGCAACAGGGG + Intergenic
1183893967 22:40952440-40952462 TGGCTGTAACTGAGCAGCAGTGG - Intronic
1184198518 22:42948198-42948220 CTGCTGTGGCTGTGAAGGAGGGG + Intronic
1184602234 22:45550457-45550479 CTGCCTTCACTGTGCTGCTGTGG + Intronic
1184722053 22:46320533-46320555 CAGCTGTCACCGTGGAGGAGAGG + Intronic
1185165710 22:49261071-49261093 GTTGTGTCACAGTGCAGCAGAGG + Intergenic
1185210209 22:49566471-49566493 CGGGGGTCACCGTGCAGCAGTGG - Intronic
949146052 3:701254-701276 CTGCAGTCACTGTGGAGGATGGG + Intergenic
949938270 3:9134357-9134379 CAGCTGCCCCTGTGGAGCAGAGG - Intronic
950917821 3:16663800-16663822 CAGCTGCCACTGAGCAGCAAAGG - Intronic
951063515 3:18237743-18237765 CTGCTCACACTGTGGAGCACTGG - Intronic
951635523 3:24770750-24770772 ATGCTGTTACTGTGCAGCCTGGG + Intergenic
952183234 3:30941607-30941629 CTGCTGTCACTGTGGAGGTTGGG + Intergenic
953183309 3:40616088-40616110 ATGCTGTGAGTGTGCCGCAGAGG - Intergenic
953369408 3:42374694-42374716 CTCCTGTCACTTGGCACCAGTGG - Intergenic
953417659 3:42732198-42732220 CTGCTGACACTTGGCAGCATAGG - Intronic
954673385 3:52302680-52302702 CTGGTGTGCCTGTGCTGCAGGGG - Intergenic
954711362 3:52506599-52506621 CTGCTCTAACTGGGCTGCAGGGG + Intronic
954876587 3:53806404-53806426 CTGCTTTCCCTCTGCAGCGGTGG + Intronic
956487644 3:69739555-69739577 CTGTTCTCACTTTCCAGCAGTGG + Exonic
956856335 3:73278578-73278600 CTGCAGTTACTTTGCAGCAGGGG - Intergenic
957368298 3:79255794-79255816 CTGCTGTCAGTGTGGTGGAGGGG - Intronic
957392698 3:79598579-79598601 CTGCAGCCACTGTGCAGTGGGGG - Intronic
958927068 3:100170591-100170613 CTGCTGTCACTATGTCACAGAGG - Intronic
960333792 3:116392412-116392434 CTGCTGTCACAGCCCAGCTGGGG + Intronic
960991107 3:123311871-123311893 TTGCTGCCTCTGTGCTGCAGAGG - Intronic
962464897 3:135649067-135649089 CTGCCGTGACAGTGCTGCAGTGG - Intergenic
962499773 3:135979337-135979359 CTTCTGTCACTGGAGAGCAGTGG - Intronic
962831796 3:139148454-139148476 ATGGTGACACTGTGGAGCAGTGG + Intronic
963664183 3:148161442-148161464 TTGCTGTCTCTGTGTGGCAGAGG - Intergenic
967100468 3:186211393-186211415 CTGGTGTTACAGGGCAGCAGGGG - Intronic
967971518 3:195003100-195003122 CTCCTGGGACTGTGCAGCACGGG + Intergenic
968226481 3:196975596-196975618 CTGCTGTCAACTTGGAGCAGTGG - Intergenic
968631944 4:1656400-1656422 GTGCAGTCACTGTCCAGCTGAGG + Intronic
969477676 4:7430779-7430801 GTGCTGTAACTGTCCAGCTGTGG - Intronic
969523223 4:7691060-7691082 CTGCAGACACTGAACAGCAGAGG + Intronic
969682443 4:8650816-8650838 ATGCAGTCACTGGACAGCAGGGG + Intergenic
971255143 4:25007777-25007799 CAGCTGTCCATGTGCACCAGGGG - Intronic
971302632 4:25454496-25454518 CTGCTGTCACTGCTCTTCAGAGG - Intergenic
973045333 4:45530376-45530398 GTGCTCCCACAGTGCAGCAGTGG - Intergenic
973724723 4:53763913-53763935 CTGCTGTCACTGTGCACCACAGG + Intronic
974877540 4:67716959-67716981 CTGCTGGCACTGTGCTGTCGTGG - Intergenic
977522359 4:98100984-98101006 CTGCTCTTAATGTGCAGGAGAGG + Intronic
981410303 4:144422395-144422417 TTGCTGTGACTGAGGAGCAGAGG + Intergenic
981532288 4:145764256-145764278 CTGATTTCACTGTGCAGATGAGG + Intronic
981973894 4:150699706-150699728 CTGATGTAAAGGTGCAGCAGTGG + Intronic
982642453 4:157980265-157980287 ATGGGGTCACTCTGCAGCAGAGG - Intergenic
983083306 4:163414135-163414157 CTGCTGGCATTTTGCCGCAGGGG + Intergenic
983318505 4:166164866-166164888 CTGCTGTCACTATTCAGGAAAGG - Intergenic
984203352 4:176755285-176755307 CTGCTGTAAGTGGGCAGCATGGG - Intronic
984243910 4:177251534-177251556 GTGCTGTGACAGAGCAGCAGAGG - Intergenic
986824408 5:11505002-11505024 CTGATGTGGATGTGCAGCAGAGG - Intronic
987100145 5:14583635-14583657 CTGCAGTTGGTGTGCAGCAGAGG + Intronic
987888821 5:23848707-23848729 TGTCTGTCACTGTGCATCAGAGG - Intergenic
989099200 5:37808711-37808733 CTGCTGACCCTGGGGAGCAGGGG - Intergenic
989196107 5:38718255-38718277 CTGCTGTTACAGCACAGCAGGGG + Intergenic
993863261 5:93161415-93161437 CTGCTATGCCTGTGTAGCAGAGG - Intergenic
996326998 5:122286483-122286505 CTGCAGTCACTGTGGAGGATGGG + Intergenic
996574184 5:124963600-124963622 CTGCTGTCAAGGTGGAGAAGAGG - Intergenic
997629308 5:135354677-135354699 CTGCTGCCACTGGGGAGTAGGGG + Intronic
1000110896 5:158107284-158107306 CTTCTTTGCCTGTGCAGCAGAGG + Intergenic
1000914646 5:167065942-167065964 CTGCTGTCACTTTGTAGCTCTGG + Intergenic
1003793974 6:9579185-9579207 ACGCTGTCACTGTGAGGCAGGGG - Intergenic
1006892111 6:37437618-37437640 CTACTGTGACTTTGAAGCAGAGG - Intronic
1007513334 6:42391516-42391538 CTGCTGAGACTGTTCACCAGAGG - Intronic
1007893989 6:45328741-45328763 ATGGTGTCACTGTGCTGAAGAGG - Exonic
1008642127 6:53474799-53474821 CTGCTGTGACAGGGCAGCACTGG + Intergenic
1009026606 6:58007482-58007504 CTTCTTTCCCTGTACAGCAGTGG + Intergenic
1009202149 6:60758951-60758973 CTTCTTTCCCTGTACAGCAGTGG + Intergenic
1010284945 6:74065917-74065939 CTGCTGTGCCTGAGGAGCAGAGG + Intergenic
1011246463 6:85325900-85325922 GGGCTCTCACAGTGCAGCAGCGG - Intergenic
1017455389 6:154596884-154596906 CTGCTGTCACATGGCAGAAGTGG - Intergenic
1019281077 7:200524-200546 CTGCTGTCTCTGCTCAGCACGGG - Intronic
1019648957 7:2146209-2146231 CTGCTGTGACGGTGCCGCTGGGG - Intronic
1019758532 7:2791304-2791326 CTGCTGTCTGTGACCAGCAGTGG + Intronic
1019950821 7:4370901-4370923 CTGGGGTCACTGGGCAGCACGGG + Intergenic
1022379370 7:29845318-29845340 CTGCTGTCACTGAGCTCAAGGGG - Intronic
1023396267 7:39754378-39754400 GTGCTCCCACGGTGCAGCAGGGG + Intergenic
1023862114 7:44222951-44222973 CTGCTGTCACTGTGCAGCAGGGG - Intronic
1024274513 7:47667085-47667107 CTGCTGGCTCTGTCCTGCAGGGG + Intergenic
1024964168 7:55006698-55006720 CTCCTGTCACTCTGGGGCAGAGG - Intergenic
1025901798 7:65750943-65750965 CTGCAGGCACCGTGCAGCCGCGG + Intergenic
1026024143 7:66731857-66731879 CTGCTTTCACTGTGCACCTTGGG - Intronic
1027935992 7:84603405-84603427 CTGCTGCCACTGTACTGCGGAGG + Intergenic
1028303355 7:89229167-89229189 GGGCTCTCACTGTGCAGCGGCGG + Intronic
1028432809 7:90767111-90767133 CTGCTGACACTGTGCATGGGGGG - Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1030060594 7:105618011-105618033 CTGCTGTCACTGAGCAACATTGG - Intronic
1033529392 7:142247267-142247289 TTGCTTTCACTCTGAAGCAGGGG + Intergenic
1033709718 7:143929773-143929795 CAGCTGTCATAGTGCAGCAGAGG + Intergenic
1034416344 7:150966182-150966204 CAGCTGCCACTGTCCACCAGGGG + Intronic
1034925769 7:155120201-155120223 TGGCTGTTACTGTGCAGCAGGGG + Intergenic
1035138981 7:156738211-156738233 CTGCTGTGACAGGGCAGCATTGG - Intronic
1035445750 7:158941976-158941998 CTGCTGTCCCACTGCAGGAGCGG - Exonic
1035727803 8:1835343-1835365 GTGCCGTCCCTGTGCAGCTGAGG + Intronic
1036761644 8:11513595-11513617 CTTCTGTCTCTGTGCAGCGAGGG - Intronic
1039390884 8:37179992-37180014 CAGGGGTCACTGTGCACCAGCGG + Intergenic
1041257893 8:55995186-55995208 CTGCTGTTTCTGGGCAGCAGAGG + Intronic
1041799171 8:61779971-61779993 CTTCTGTCACTGTGGAGCTGGGG + Intergenic
1041977598 8:63817483-63817505 CTGCTGGGACAGTGCAGAAGGGG - Intergenic
1044380804 8:91530952-91530974 TTGCAGTCATTGTACAGCAGAGG + Intergenic
1045809506 8:106205000-106205022 CTGCTGTCACTGGGGAGCATTGG - Intergenic
1047201246 8:122769738-122769760 CTGCTGTTACTGAGCTGGAGTGG + Intergenic
1047874938 8:129125652-129125674 CTGATTTCACTGTGTGGCAGAGG + Intergenic
1047890609 8:129303975-129303997 CTGCTGTCTCTGCACAGGAGAGG + Intergenic
1047929595 8:129713524-129713546 CTGCTGTCACTGAGGAGCCTTGG + Intergenic
1048291755 8:133186582-133186604 CTGTTGTCAGTGGGGAGCAGAGG + Intergenic
1048446192 8:134495140-134495162 CTGCTGTCACAAAGCAGCACAGG + Intronic
1048866556 8:138765673-138765695 CTGTTGACACTGTGCAGGTGTGG + Intronic
1048934128 8:139341354-139341376 TGCCTGTCAGTGTGCAGCAGAGG - Intergenic
1049248600 8:141576219-141576241 CTGCAGTGAGTGGGCAGCAGTGG - Intergenic
1049345055 8:142134289-142134311 CTGCTGCCACAGTCCAGGAGAGG + Intergenic
1050570437 9:6932632-6932654 CTGCTTTGGCTGTGCACCAGGGG - Intronic
1050686913 9:8181741-8181763 CTGCTGTCATGGTGCATCAATGG + Intergenic
1052249648 9:26382566-26382588 TTGTTGTCACAGTGCAGCATTGG - Intergenic
1055954237 9:81759239-81759261 CTGCTGTCCCAGGGAAGCAGAGG - Intergenic
1057878333 9:98774409-98774431 GTGCCTTCACTGTGCAGCAGGGG - Intronic
1057979775 9:99649584-99649606 CTGATGTCACAGTCCTGCAGTGG - Intergenic
1058091475 9:100810922-100810944 CTGCTCTCTCTGTGGAGCAGAGG - Intergenic
1058897303 9:109411438-109411460 CTGCTGTCACTGTACAGGACAGG + Intronic
1059858399 9:118428113-118428135 GTGCTGACACTGTGAAGCCGTGG - Intergenic
1061424048 9:130488348-130488370 CTGCTGTCTGGGTGGAGCAGGGG - Intronic
1062013242 9:134278005-134278027 GAGCTGTCACTGCTCAGCAGAGG - Intergenic
1062723052 9:138054382-138054404 CTGCTGTCACTGTCCACATGAGG + Intronic
1185990165 X:4885604-4885626 CTTGTGACACTGTGCAGCAGTGG + Intergenic
1186203803 X:7180561-7180583 ATGCTGACTCTGTGGAGCAGGGG - Intergenic
1187626313 X:21117997-21118019 CTGTTGTTACTATACAGCAGAGG - Intergenic
1189259881 X:39670712-39670734 AAGCTGTCAGTGTGCAGGAGGGG + Intergenic
1189920735 X:45900945-45900967 CTCCCTTCACTGAGCAGCAGGGG - Intergenic
1190702867 X:53001053-53001075 CTCCTGTGAGTGTGCAGCTGGGG - Intergenic
1190711998 X:53078141-53078163 CTTCTGACACTGTCCAGAAGGGG + Exonic
1190851567 X:54248870-54248892 CTTCTGTCACTGGACAGGAGAGG + Exonic
1199356308 X:146867319-146867341 GTGCTCCCACAGTGCAGCAGTGG + Intergenic
1199697403 X:150352590-150352612 CTGGTGTCACGTTGCATCAGTGG - Intergenic
1200117832 X:153776917-153776939 GTGCTGCCACGGTGCAGCTGAGG - Exonic
1200379426 X:155819440-155819462 CTGCTGTAACAGGGCAGCATTGG - Intergenic
1201143138 Y:11044917-11044939 ATGCTGTGTCTGTGCAGCACGGG + Intergenic
1201559117 Y:15297230-15297252 TTGCTGTCACAGGGGAGCAGAGG + Intergenic