ID: 1023862377

View in Genome Browser
Species Human (GRCh38)
Location 7:44224403-44224425
Sequence ACAGCTTGTCCTCAGCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 1, 2: 1, 3: 24, 4: 196}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023862377_1023862383 5 Left 1023862377 7:44224403-44224425 CCTGCTGGCTGAGGACAAGCTGT 0: 1
1: 1
2: 1
3: 24
4: 196
Right 1023862383 7:44224431-44224453 CAGTTCCAGAGACAAAGGGGAGG No data
1023862377_1023862380 0 Left 1023862377 7:44224403-44224425 CCTGCTGGCTGAGGACAAGCTGT 0: 1
1: 1
2: 1
3: 24
4: 196
Right 1023862380 7:44224426-44224448 CCTGGCAGTTCCAGAGACAAAGG 0: 1
1: 0
2: 2
3: 18
4: 228
1023862377_1023862389 17 Left 1023862377 7:44224403-44224425 CCTGCTGGCTGAGGACAAGCTGT 0: 1
1: 1
2: 1
3: 24
4: 196
Right 1023862389 7:44224443-44224465 CAAAGGGGAGGTGGTGGGCAGGG No data
1023862377_1023862384 8 Left 1023862377 7:44224403-44224425 CCTGCTGGCTGAGGACAAGCTGT 0: 1
1: 1
2: 1
3: 24
4: 196
Right 1023862384 7:44224434-44224456 TTCCAGAGACAAAGGGGAGGTGG 0: 1
1: 1
2: 3
3: 65
4: 524
1023862377_1023862386 11 Left 1023862377 7:44224403-44224425 CCTGCTGGCTGAGGACAAGCTGT 0: 1
1: 1
2: 1
3: 24
4: 196
Right 1023862386 7:44224437-44224459 CAGAGACAAAGGGGAGGTGGTGG No data
1023862377_1023862388 16 Left 1023862377 7:44224403-44224425 CCTGCTGGCTGAGGACAAGCTGT 0: 1
1: 1
2: 1
3: 24
4: 196
Right 1023862388 7:44224442-44224464 ACAAAGGGGAGGTGGTGGGCAGG No data
1023862377_1023862381 1 Left 1023862377 7:44224403-44224425 CCTGCTGGCTGAGGACAAGCTGT 0: 1
1: 1
2: 1
3: 24
4: 196
Right 1023862381 7:44224427-44224449 CTGGCAGTTCCAGAGACAAAGGG No data
1023862377_1023862390 22 Left 1023862377 7:44224403-44224425 CCTGCTGGCTGAGGACAAGCTGT 0: 1
1: 1
2: 1
3: 24
4: 196
Right 1023862390 7:44224448-44224470 GGGAGGTGGTGGGCAGGGCCTGG No data
1023862377_1023862387 12 Left 1023862377 7:44224403-44224425 CCTGCTGGCTGAGGACAAGCTGT 0: 1
1: 1
2: 1
3: 24
4: 196
Right 1023862387 7:44224438-44224460 AGAGACAAAGGGGAGGTGGTGGG No data
1023862377_1023862382 2 Left 1023862377 7:44224403-44224425 CCTGCTGGCTGAGGACAAGCTGT 0: 1
1: 1
2: 1
3: 24
4: 196
Right 1023862382 7:44224428-44224450 TGGCAGTTCCAGAGACAAAGGGG No data
1023862377_1023862391 23 Left 1023862377 7:44224403-44224425 CCTGCTGGCTGAGGACAAGCTGT 0: 1
1: 1
2: 1
3: 24
4: 196
Right 1023862391 7:44224449-44224471 GGAGGTGGTGGGCAGGGCCTGGG 0: 1
1: 0
2: 19
3: 154
4: 1179
1023862377_1023862392 28 Left 1023862377 7:44224403-44224425 CCTGCTGGCTGAGGACAAGCTGT 0: 1
1: 1
2: 1
3: 24
4: 196
Right 1023862392 7:44224454-44224476 TGGTGGGCAGGGCCTGGGCTTGG 0: 1
1: 2
2: 14
3: 175
4: 1158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023862377 Original CRISPR ACAGCTTGTCCTCAGCCAGC AGG (reversed) Intronic
900303619 1:1990917-1990939 AAAGCTCGTCCTCAGGGAGCAGG + Exonic
901522535 1:9796338-9796360 CCATCTTGTCCTCAGTCACCAGG - Intronic
902825731 1:18972848-18972870 ACAGCTAGTCAGCAGCAAGCAGG + Intergenic
903379326 1:22885887-22885909 ACAGCTTGGCATCTGCCAGTGGG + Intronic
904464183 1:30698348-30698370 ACAGCTGGTTCACAGCCACCAGG + Intergenic
908644869 1:66266386-66266408 GCAGCTTGACCTCAGCTTGCTGG + Intronic
912413668 1:109494195-109494217 ACTGCCTCTCCGCAGCCAGCGGG - Exonic
912437359 1:109671185-109671207 ACTGCTTGCCCGCGGCCAGCTGG + Intronic
913077767 1:115355552-115355574 ACTGCTTGTCCATATCCAGCGGG + Intergenic
915541414 1:156569374-156569396 ACCGCTTGGCCTCCTCCAGCCGG + Exonic
915687540 1:157649827-157649849 CCAGCTTTTCCTCACCCAGTGGG + Intergenic
916214390 1:162383287-162383309 ACAGCCTGTCCTCAGCAGTCTGG + Exonic
916429353 1:164712414-164712436 ACAGCCTGTTATCAGCCAGTCGG - Intronic
918148311 1:181777169-181777191 TCACCTTGTCCTCAGCCATGAGG - Intronic
921407694 1:214799206-214799228 GCTCCTTGTCCTGAGCCAGCAGG + Intergenic
922961300 1:229647778-229647800 GCAGCTTTTCCTCTGCGAGCAGG + Intronic
923262312 1:232279040-232279062 ACAGCTTGCCTCCAGCCATCAGG - Intergenic
924309175 1:242722298-242722320 ACAGCCTGACTTCAGCCAGCGGG + Intergenic
1063121583 10:3108697-3108719 GCAGCTTGTCGTCACGCAGCTGG + Exonic
1063611750 10:7568702-7568724 AAAGCTTGTCCTCACAGAGCTGG + Intronic
1068599151 10:58937330-58937352 TCATCTTGTCTTCAGCCCGCTGG - Intergenic
1069824343 10:71246063-71246085 TCAGGCTGTCCTCAGGCAGCTGG + Intronic
1072198577 10:93138382-93138404 ACAGCTTGTCCCCAGACACAGGG - Intergenic
1072934169 10:99695973-99695995 CCAGGTTGAACTCAGCCAGCAGG - Exonic
1073523180 10:104154617-104154639 ACAATCTGGCCTCAGCCAGCTGG - Intronic
1074423118 10:113326864-113326886 TCAGCTTTTCCTGGGCCAGCTGG + Intergenic
1074474254 10:113755032-113755054 GCAGCTTGTCCTCACACAGTGGG - Intronic
1074710494 10:116173269-116173291 ACAGCATGAGCTCAGCCACCAGG - Intronic
1075323962 10:121515149-121515171 TCAGCTTGTGCACAGCCGGCTGG + Exonic
1076131943 10:128019416-128019438 CCAGCGTGGCCTCAGCCACCAGG + Intronic
1076832757 10:133004987-133005009 ACAGCGTGTCCTGAGCCACGGGG - Intergenic
1076832763 10:133005014-133005036 ACAGCGTGTCCTGAGCCACGGGG - Intergenic
1076832769 10:133005041-133005063 ACAGCGTGTCCTGAGCCACGGGG - Intergenic
1076832775 10:133005068-133005090 ACAGCGTGTCCTGAGCCACGGGG - Intergenic
1077088029 11:764355-764377 AGAGCTTCTCCACAGCCATCTGG - Exonic
1078339603 11:10489338-10489360 ACACCTTGGCCCCAGGCAGCAGG - Intronic
1078434633 11:11314252-11314274 ACTGCTTCTCCCCAGCCTGCAGG + Intronic
1078485704 11:11721460-11721482 ACAGCATCTGCTCAGCCATCTGG + Intergenic
1081440583 11:43076617-43076639 ACTGATTGTCCTAAGGCAGCGGG + Intergenic
1083634979 11:64116080-64116102 CCAGCTTGACCTCACCCCGCAGG + Intronic
1083679203 11:64343536-64343558 CCACATTCTCCTCAGCCAGCTGG - Exonic
1084095026 11:66905747-66905769 AGAGCTTGGCCTCAGCAAGGTGG + Intronic
1084554464 11:69867748-69867770 AAGGCTTGTCCTCAGCCGCCAGG + Intergenic
1084643199 11:70438053-70438075 GCAGCTTGCTCTCAGCCTGCTGG + Intergenic
1085469003 11:76744858-76744880 ACAGCCTGTTCCCAGTCAGCAGG + Intergenic
1086063990 11:82728153-82728175 ACAGCTTGTCCTCATGAGGCAGG + Intergenic
1087151719 11:94866119-94866141 CCTTCTTTTCCTCAGCCAGCTGG - Exonic
1087199423 11:95330539-95330561 GCAGCTTTCCCTCAGGCAGCAGG + Intergenic
1088623572 11:111711592-111711614 ACAGCCTGGACTCAGCCTGCTGG - Intronic
1089049595 11:115534730-115534752 ACAGCAGGTACTCAGCCAACAGG + Intergenic
1090106193 11:123855297-123855319 CCATATTCTCCTCAGCCAGCAGG - Intergenic
1091916897 12:4276157-4276179 ACAGCTTCTCCGCGGTCAGCGGG - Exonic
1094113438 12:26884836-26884858 AGAGCTGGTCCACAGCCACCAGG + Intergenic
1096504131 12:52082086-52082108 GCAGCAGCTCCTCAGCCAGCTGG + Intergenic
1098810390 12:75081437-75081459 ACAGCTAGTCTTCAGCCACAAGG - Intronic
1100400144 12:94222322-94222344 GCCTCTTGTACTCAGCCAGCCGG + Intronic
1102204178 12:111078897-111078919 ACTCCTTTTCCTCAGCCACCTGG - Intronic
1103937870 12:124486062-124486084 AGAGGGTGTCCTCTGCCAGCTGG + Intronic
1109283939 13:60389666-60389688 ACAGCTAGTGCTCTGACAGCTGG + Intergenic
1111827058 13:93280915-93280937 ACAGCCTGACCTCTGCCAGCTGG - Intronic
1111953558 13:94731143-94731165 ACAACCTGTCATCAGCAAGCTGG + Intergenic
1112107428 13:96256529-96256551 TCAGCCTCTTCTCAGCCAGCTGG + Intronic
1112300589 13:98226149-98226171 ACACCTTGATCTCAGACAGCTGG - Intronic
1118253864 14:64187944-64187966 ACAGCTGGTCTGCAGCAAGCAGG - Intronic
1121556965 14:94845415-94845437 ACAGCCAGCCCTGAGCCAGCAGG - Intergenic
1122206388 14:100149990-100150012 CCAGCTTGTTCCCACCCAGCAGG + Intronic
1122795121 14:104202169-104202191 ACAGCTGGCCCTCACCCAGCGGG + Intergenic
1122960321 14:105091167-105091189 AGAGTTTGTCCTCAGCTGGCAGG - Intergenic
1123107185 14:105847276-105847298 ACAGCTTGATCTCAGACACCTGG + Intergenic
1124662086 15:31558053-31558075 GGAGCATGTCCTCAGCCAGTGGG - Intronic
1127600078 15:60526649-60526671 ACAGCTTGTCCTCCCCCAGGTGG + Intronic
1130018229 15:80203494-80203516 ACAGATATTCCCCAGCCAGCGGG - Intergenic
1130093373 15:80839188-80839210 GCCACTTCTCCTCAGCCAGCAGG + Intronic
1132017809 15:98334474-98334496 ACAACTTGTCCTCAGCAACAAGG - Intergenic
1132589974 16:722311-722333 GCAGCTTGTCCTCCAGCAGCGGG - Exonic
1133112168 16:3554529-3554551 GCACCTTGTTCCCAGCCAGCAGG - Intronic
1133899158 16:9957199-9957221 AGGGCTTGTTCTCAGCCAGGGGG + Intronic
1134041020 16:11068264-11068286 ACAGCTGGTCCTCAGGCAGGTGG + Intronic
1135719244 16:24800926-24800948 ACATTTTTTCCTTAGCCAGCTGG - Intronic
1136061288 16:27728375-27728397 AAAGCGGGTCCCCAGCCAGCAGG + Intronic
1136162015 16:28426284-28426306 ACGGCTGGTCCACAACCAGCTGG + Intergenic
1136200951 16:28688706-28688728 ACGGCTGGTCCACAACCAGCTGG - Intronic
1136217291 16:28802890-28802912 ACGGCTGGTCCACAACCAGCTGG - Intergenic
1136677463 16:31924619-31924641 ACAGTTTGTCCTCAGGCTGAGGG - Intergenic
1137496481 16:48973049-48973071 AGAACTTGGCCTCAGCCAGAAGG - Intergenic
1138332997 16:56230314-56230336 ACAGCTTGTCCAGAGGAAGCGGG + Intronic
1138555952 16:57771311-57771333 GCAGCTCCACCTCAGCCAGCCGG + Exonic
1142171104 16:88623317-88623339 ACAGCTCGTTCTCAGGAAGCCGG + Exonic
1142316043 16:89345684-89345706 TCAGCTCGTGCTGAGCCAGCTGG - Intronic
1143002155 17:3801210-3801232 TCAGCTTCCCCTCAGCCAGGAGG + Exonic
1143316328 17:6036085-6036107 ACAGCTGCTCCTCACCCACCAGG - Intronic
1143368509 17:6423905-6423927 AGAGCTTGTCTCCACCCAGCAGG - Exonic
1144702203 17:17347174-17347196 TCAGCCTGACCTCAGGCAGCAGG + Exonic
1146496282 17:33325358-33325380 ACAGCTTCTGTTCAGCCTGCAGG - Intronic
1147318557 17:39632695-39632717 ATAGCTTGCCCAGAGCCAGCAGG + Intronic
1147436414 17:40418995-40419017 AAACCTTTTCCGCAGCCAGCTGG + Intergenic
1150313458 17:64148586-64148608 AAAGCTTTTCTTCAGGCAGCCGG - Exonic
1151170021 17:72237959-72237981 ACTGCTTATCCTCAGCCACTAGG - Intergenic
1152775334 17:82197953-82197975 ACAGTTTGTCATCTGCAAGCTGG - Intronic
1153533639 18:6077016-6077038 TCAGCTTGTGCTCAGGGAGCAGG + Intronic
1153814284 18:8779482-8779504 ACAGCTTCAGCTCAGGCAGCGGG - Intronic
1154966689 18:21364958-21364980 ACATCTTTTCCTAAGTCAGCAGG - Intronic
1156060054 18:33063345-33063367 AGAGCTTGTCCTCAGTCCCCTGG - Intronic
1156468033 18:37360377-37360399 ACAGGTTGTGCTCAGCAGGCTGG - Intronic
1157504505 18:48217133-48217155 ACAGCTTGATCTCAGACACCTGG + Intronic
1158325085 18:56305112-56305134 ACTGCTCGTCCTCAGCCACATGG - Intergenic
1160065746 18:75572862-75572884 AAAGATTGTCCTCAGGCTGCTGG + Intergenic
1160967849 19:1754358-1754380 GCAGCTTGTCCCCAGCCAGGTGG - Exonic
1161535844 19:4818053-4818075 ACAGCTTCTCCTCAGCCAGCAGG + Exonic
1161622644 19:5306758-5306780 ACAGCTTGTTCTAAACAAGCAGG + Intronic
1161761014 19:6172894-6172916 GCTCCTTGTCCTCAGCCAGCAGG + Intronic
1162496441 19:11025725-11025747 AAAGCTTGCCCTCAGAGAGCAGG + Intronic
1163679305 19:18671499-18671521 ACATCTTGTCCCCAGTGAGCTGG + Exonic
1165123900 19:33580757-33580779 ACACATTGTCCTCAGCAAGCTGG - Intergenic
1167241358 19:48345201-48345223 CCAGGGTGTCCTCAGACAGCGGG + Exonic
927735900 2:25521803-25521825 ACAGGTTGGCCTTAGCCTGCAGG + Intronic
928605951 2:32945771-32945793 GCAGCTAGTGCTCAGGCAGCTGG + Intergenic
932216349 2:69968782-69968804 ACTGCTTGTCCCCAGCGACCAGG - Intergenic
932414959 2:71568043-71568065 ACAGCTTCCCCTCAGCAAACTGG - Exonic
932595186 2:73088958-73088980 GCACCCTGTCCTCAGCCAGCGGG - Exonic
934790568 2:97056210-97056232 AAAGATAGTCCTCAGCCATCTGG - Intergenic
934812278 2:97290507-97290529 ATAGCTTGTTCACAGACAGCTGG + Intergenic
934815897 2:97326321-97326343 AAAGATAGTCCTCAGCCATCTGG + Intergenic
934821798 2:97382162-97382184 AAAGATAGTCCTCAGCCATCTGG - Intergenic
934825416 2:97417416-97417438 ATAGCTTGTTCACAGACAGCTGG - Intergenic
935448318 2:103180199-103180221 ACAAAATGTCCTCAGCTAGCTGG + Intergenic
941407611 2:165110638-165110660 ACAGCTTGTCCTCAGAGTACTGG - Intronic
944062358 2:195583056-195583078 CCAGCCAGCCCTCAGCCAGCAGG + Intronic
946162783 2:217846337-217846359 ACACCAGGTCCTGAGCCAGCTGG + Intronic
947974677 2:234355416-234355438 AATGCTTGACCTCAGCTAGCTGG + Intergenic
947981387 2:234412943-234412965 CCAGCTTATCCTCAGGCTGCCGG + Intergenic
948459980 2:238124337-238124359 AGCCCTTGTCCCCAGCCAGCAGG - Intronic
948559145 2:238839107-238839129 TCAGATTGTGCTCAGCCAGGTGG - Intergenic
948606926 2:239141653-239141675 ACAGCTTGACATCAGAGAGCAGG - Intronic
1168891412 20:1297282-1297304 ACAACCTGTTCCCAGCCAGCAGG - Intronic
1169743499 20:8919867-8919889 ACAGCTTCGACTCAGCAAGCAGG + Intronic
1170905093 20:20507691-20507713 AAAACTTGTCCTCATGCAGCAGG + Intronic
1171186618 20:23127859-23127881 GCAGCTTGACCTCGGCCCGCTGG + Intergenic
1176184002 20:63768100-63768122 ACAGCCTGTCAACAGCCATCTGG + Intronic
1179446541 21:41435833-41435855 ACAGGTTGTTCTCAGCCACCTGG - Exonic
1179932863 21:44582402-44582424 GCAGGTGGTCCTGAGCCAGCGGG + Intronic
1181521513 22:23451061-23451083 ACAGCGTGAGCCCAGCCAGCTGG - Intergenic
1181939425 22:26463946-26463968 GCAGCGGCTCCTCAGCCAGCAGG + Exonic
1183082845 22:35467888-35467910 ACAGCCTGTCCTCAGCCTGCAGG - Intergenic
1184629146 22:45762572-45762594 CCAGCTTCCCTTCAGCCAGCTGG - Intronic
953798911 3:46006430-46006452 ACAGCTTGTCCTCAGTACACTGG - Intergenic
962318014 3:134370857-134370879 ACAGCTGGCCCGCAACCAGCAGG - Exonic
963920712 3:150902269-150902291 ACAGCATGTCCTCAGGAAGAAGG + Intronic
964527441 3:157630418-157630440 AGAGCTTGTCCTCAGCTGGCAGG + Intronic
968494831 4:909899-909921 GCAGCATCTCCTCAGCCTGCAGG + Intronic
968651871 4:1763389-1763411 ACAGCTTGTCTTCACCCACCGGG + Intergenic
969304619 4:6318580-6318602 ACAGCTTGGCCTGCTCCAGCGGG - Intergenic
969553848 4:7892779-7892801 GCACCCTGACCTCAGCCAGCTGG + Intronic
969671861 4:8594093-8594115 CCACCCTGTCCTCACCCAGCAGG + Intronic
970673463 4:18421701-18421723 GCAGCCTGCCCTCAGCCACCTGG + Intergenic
979001774 4:115230302-115230324 AAAGCTTGTTTTCAGCCAGAGGG + Intergenic
981474221 4:145172084-145172106 ACAGGTTGTCCTGCTCCAGCTGG - Intronic
984466252 4:180102196-180102218 GCTGCTTGTACTCAGCCATCTGG + Intergenic
985617980 5:936049-936071 ACAGCTTGTCATCTGCCTGCTGG - Intergenic
985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG + Intronic
985731907 5:1554051-1554073 CCATCTGGTCCTCAGCCCGCTGG - Intergenic
987006369 5:13714437-13714459 CCAGCATATCATCAGCCAGCCGG + Exonic
988973425 5:36492214-36492236 CTAGCTTTTCCTCACCCAGCAGG + Intergenic
990308370 5:54515852-54515874 ACAGCCTGTCCTCATCCTTCTGG + Intergenic
993671230 5:90764101-90764123 ACTTCTAGTCCTGAGCCAGCAGG + Intronic
994098437 5:95868757-95868779 ACAGCTTGTCCCCAACTGGCAGG + Intergenic
994801480 5:104382722-104382744 ACACTTTGGCCTCAGCCAGCTGG + Intergenic
999961418 5:156760155-156760177 ACAGCTGTTCCTCAGTGAGCTGG + Intronic
1002127702 5:177059050-177059072 ACAGCTTGTCTTCTCCCTGCTGG + Intronic
1003236564 6:4300415-4300437 AGAGCATGTCCTCATCTAGCTGG + Intergenic
1006449786 6:34099302-34099324 TCAGCCTGCCCTCAGCCTGCAGG + Intronic
1013619884 6:111878018-111878040 ACAGCTTGCCATGAGCCAGCAGG + Intergenic
1014258340 6:119186626-119186648 AGAGCTTTTCCCTAGCCAGCTGG - Intronic
1017947169 6:159105020-159105042 CCAGCTTGTCCTCAGACACGTGG - Intergenic
1019397447 7:829434-829456 ACAGCTAGGACTCAGCCAGCAGG - Intronic
1019589828 7:1825421-1825443 ACAGCGTGAGCCCAGCCAGCTGG + Intronic
1021807945 7:24375373-24375395 ACAGGTTGTCCCCAGCCATCTGG - Intergenic
1021910087 7:25376857-25376879 CCAGCTTGTTCACAGACAGCAGG - Intergenic
1021926738 7:25541124-25541146 ATAGCTTGTCCCCAGGTAGCTGG + Intergenic
1023256480 7:38317814-38317836 AGAGCTTGTCTTCAACCAGCTGG + Intergenic
1023862377 7:44224403-44224425 ACAGCTTGTCCTCAGCCAGCAGG - Intronic
1023908095 7:44536336-44536358 ACAGCTTGGCCTGGGCCAGACGG + Exonic
1025811700 7:64879825-64879847 AAAGCCTGTCCTCCTCCAGCGGG + Intronic
1026521033 7:71118457-71118479 TCAGCTTGGCCTCAGTCAGCAGG + Intergenic
1029562819 7:101314719-101314741 ACAGCAGGTGCTCAGCCAGTCGG + Exonic
1032057912 7:128698348-128698370 ACACCTTCTCCTCAGCCCTCAGG + Intergenic
1032239443 7:130149584-130149606 ACTGCTGGTCCCCAGGCAGCAGG - Intergenic
1032390082 7:131550147-131550169 ACAGGGGGTCCTCAGCCAGTGGG + Intronic
1035469942 7:159103262-159103284 CCAGCTTGTCCTCCGCCAAGAGG - Intronic
1035720475 8:1787756-1787778 TCAGCCAGTCCTCTGCCAGCTGG + Intergenic
1035759259 8:2057387-2057409 ACAGCGCTTCCTCAGCGAGCTGG + Exonic
1035870603 8:3133140-3133162 ACAGCTTCTCCTCAGCGACCTGG + Intronic
1039547313 8:38419565-38419587 CCAGCTTGTGCACAGCCATCTGG + Exonic
1041201650 8:55455293-55455315 ACACCATCTTCTCAGCCAGCTGG + Intronic
1041457307 8:58074741-58074763 AGAGCTTTGCCCCAGCCAGCCGG + Intronic
1041971375 8:63746914-63746936 ATATCCTGTCCTCAGCAAGCAGG + Intergenic
1042944820 8:74144527-74144549 AAAGCTTGGCCTCAGGCAGTGGG - Intergenic
1045816773 8:106285563-106285585 ACAGCTTGTGCTGAAACAGCTGG + Intronic
1048346716 8:133581388-133581410 ACAGCTCTTCCTGAGGCAGCGGG + Intergenic
1049108470 8:140628178-140628200 ACAGCTGGTGCTCAGTCAGTGGG - Intronic
1049553836 8:143272644-143272666 ACAGCCTGGGCACAGCCAGCAGG + Intronic
1049788926 8:144464225-144464247 GCAGCCTGTCCTCCTCCAGCCGG + Intronic
1052375800 9:27716358-27716380 ACAGTTTTTCCTCAGCTAGAGGG + Intergenic
1052863050 9:33448453-33448475 ACAGCTGGGACTCAGCCTGCTGG - Intergenic
1053261150 9:36666057-36666079 ACTGCCTGTCCTCAGCAGGCAGG + Intronic
1056590145 9:87960369-87960391 CCATCTTGTCTTCAGCCAACTGG + Intergenic
1056764457 9:89436356-89436378 TCAGCGTGTCCTCAGCCACCAGG + Intronic
1056936555 9:90919322-90919344 ACAGGTGGTCCTCAGCCATCTGG - Intergenic
1060480447 9:124014035-124014057 ACTGCTTGTCCACCGCCAGCAGG - Exonic
1060539536 9:124420230-124420252 AGAGCCTGTCCTCAGGGAGCTGG + Intergenic
1060928700 9:127474123-127474145 ACAGCTTGTGCTTGGCAAGCTGG - Intronic
1061008698 9:127942842-127942864 GCTGCATGTCCTCAGCCAGAGGG + Exonic
1061710385 9:132483381-132483403 GCTCCTTGTCCTGAGCCAGCTGG - Intronic
1061776114 9:132965687-132965709 AAAGATTGCCCGCAGCCAGCAGG + Intronic
1062709729 9:137968286-137968308 ACAGCCAGTCCTCAGGCAGAAGG - Intronic
1185734905 X:2489159-2489181 AGATCTTGTCCTCAGCCGGCCGG + Exonic
1194244600 X:91495007-91495029 ACATCTTGTGCTTAGCCACCTGG - Intergenic
1198315692 X:135464097-135464119 ACAGCTTCTCTTCAACCAGAAGG + Intergenic
1199851509 X:151727450-151727472 AAAGCTTGTCCTGAAGCAGCTGG + Intergenic
1200047370 X:153410015-153410037 ACCGCTTGGCTTCAGCCAACAGG + Intergenic
1200089313 X:153626946-153626968 ACCGCTTGGCTTCAGCCAACAGG - Intergenic
1200120916 X:153790153-153790175 CCGCCTTGTCCTCAGCCAGGGGG - Intronic
1200563577 Y:4736320-4736342 ACATCTTGTGCTTAGCCACCTGG - Intergenic