ID: 1023862998

View in Genome Browser
Species Human (GRCh38)
Location 7:44226797-44226819
Sequence GGGGGGGTGTGGGGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3295
Summary {0: 1, 1: 1, 2: 20, 3: 266, 4: 3007}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023862998 Original CRISPR GGGGGGGTGTGGGGGGAAGA TGG Intronic
Too many off-targets to display for this crispr