ID: 1023863829

View in Genome Browser
Species Human (GRCh38)
Location 7:44229526-44229548
Sequence CAGGTGGGTGGTGCGCCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023863821_1023863829 9 Left 1023863821 7:44229494-44229516 CCTGGGGGCTGAGGCGGAACAGG 0: 1
1: 0
2: 4
3: 28
4: 365
Right 1023863829 7:44229526-44229548 CAGGTGGGTGGTGCGCCCGCAGG 0: 1
1: 0
2: 1
3: 8
4: 186
1023863820_1023863829 10 Left 1023863820 7:44229493-44229515 CCCTGGGGGCTGAGGCGGAACAG 0: 1
1: 0
2: 0
3: 27
4: 261
Right 1023863829 7:44229526-44229548 CAGGTGGGTGGTGCGCCCGCAGG 0: 1
1: 0
2: 1
3: 8
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023863829 Original CRISPR CAGGTGGGTGGTGCGCCCGC AGG Intronic
900396649 1:2455787-2455809 CAGGGGGGTGGAGGGCCCGAGGG - Intronic
901067639 1:6502034-6502056 CAGGAGGGTGGGGCTCACGCGGG - Intronic
901740268 1:11337695-11337717 CCGGGGGGAGGTGCGCCCCCTGG - Intergenic
904755787 1:32767883-32767905 CAGGTGGGGGGGTCGCCCACTGG - Exonic
905408374 1:37752776-37752798 TGGGTGGGTGGGGCTCCCGCAGG + Intronic
905449076 1:38045754-38045776 CAGGTTGGTGGGGCTGCCGCTGG + Exonic
906062667 1:42958614-42958636 AAGGTGAGTCGCGCGCCCGCGGG - Exonic
919724698 1:200874002-200874024 CAGGCGGCCGGTGCGCCCGCAGG - Exonic
923020542 1:230159993-230160015 CACCTGGGTGGTGCGGCTGCTGG - Intronic
1067690334 10:48497681-48497703 CAGGTGGATGGTGAGACCACAGG - Intronic
1071464387 10:85926210-85926232 GAGGTGGATGGTGCGACAGCTGG + Intronic
1074530755 10:114297238-114297260 CAGGTGGGTGGTGTCCACGGTGG + Exonic
1077136222 11:1000486-1000508 GAGGAGGGTGGGGGGCCCGCGGG - Exonic
1081664238 11:44907173-44907195 CATGTGGGTGGGCCGCCAGCAGG - Intronic
1082023344 11:47552972-47552994 CTGGTGAGTGCTGCGGCCGCAGG - Intronic
1083308507 11:61772802-61772824 CAGGTGGGTGGAGCTCCAGGAGG + Intronic
1084072353 11:66744697-66744719 CAGGTGGGCGGGGCGTGCGCGGG + Intronic
1090205183 11:124879926-124879948 CATCTGGGTGGAGCACCCGCTGG - Exonic
1092069545 12:5621563-5621585 CAGGTGCGGGGAGGGCCCGCTGG + Intronic
1100565415 12:95790235-95790257 CAGGTGGGTGGTGACGCGGCGGG - Exonic
1103505723 12:121441384-121441406 CAGGTGGGAGGTGCCCGCGTGGG - Intronic
1105015873 12:132786635-132786657 CAGGTGGGAGGTGCGGGGGCCGG - Intronic
1105251031 13:18698410-18698432 CAAGGGGGTGGTGCGTCCCCAGG + Intergenic
1113378392 13:109783913-109783935 GAGGTGGGTGCTGGCCCCGCAGG + Exonic
1113571375 13:111360694-111360716 CAGGAGGGTGTGGCGCCCACGGG - Intergenic
1113782065 13:112982504-112982526 CAGGTGGGAGGTGCGGCAGATGG + Intronic
1113785893 13:113001981-113002003 CAGGTGCGTGGGGCGCGGGCGGG + Intronic
1113904411 13:113812689-113812711 CAGGTGCATGCTGGGCCCGCGGG - Exonic
1119323504 14:73745258-73745280 CAGGTGGCTTGTGGGCCAGCAGG - Intronic
1119422657 14:74516773-74516795 CAGGTGGGTGGTGGGGTGGCAGG + Intronic
1121422556 14:93825363-93825385 CAGATGGGGGGTGCACCCTCTGG + Intergenic
1122216235 14:100206466-100206488 CTGGAGGGTGGTGTGCCAGCAGG + Intergenic
1122835072 14:104426871-104426893 CAGGTGTCTGCTGCACCCGCCGG + Intergenic
1122985250 14:105208859-105208881 CAGGTGGGCCGTGGGACCGCAGG - Intergenic
1129607018 15:77029987-77030009 CTGGTGGGTGGGGCACCAGCAGG - Intronic
1131066773 15:89439638-89439660 CAGGTGAGTGGGGTGCCCTCAGG - Intergenic
1131370057 15:91872966-91872988 CAGGTGAGTGCTGAGCACGCAGG - Intronic
1138555936 16:57771203-57771225 CAGGTGGGGACTGGGCCCGCAGG + Exonic
1139750322 16:69106094-69106116 GGGGTCGGGGGTGCGCCCGCGGG + Intronic
1141609681 16:85174352-85174374 CAGGTGGGTGGTGAGGCCGCTGG + Intronic
1141662932 16:85451409-85451431 CTGGTGGTTGGTGCGTGCGCTGG + Intergenic
1141662939 16:85451450-85451472 CTGGTGGTTGGTGCGTGCGCTGG + Intergenic
1141662946 16:85451491-85451513 CTGGTGGTTGGTGCGTGCGCTGG + Intergenic
1141662953 16:85451532-85451554 CTGGTGGTTGGTGCGTGCGCTGG + Intergenic
1141662960 16:85451573-85451595 CTGGTGGTTGGTGCGTGCGCTGG + Intergenic
1141662973 16:85451655-85451677 CTGGTGGTTGGTGCGTGCGCTGG + Intergenic
1141662980 16:85451696-85451718 CTGGTGGTTGGTGCGTGCGCTGG + Intergenic
1141662987 16:85451737-85451759 CTGGTGGTTGGTGCGTGCGCTGG + Intergenic
1141815751 16:86408276-86408298 CAGGTGGGGGGTGGGCCTGGAGG + Intergenic
1142329873 16:89445022-89445044 CAGGTGGGTGGTGCAAGGGCAGG - Intronic
1142330686 16:89450931-89450953 TAGCTGGGTGGTGAGCCAGCTGG - Intronic
1142984839 17:3689472-3689494 GAGGTGGGTGGGGTGCACGCAGG - Exonic
1143863972 17:9910731-9910753 CAGGGGGGTGGTGCGGGGGCAGG + Intronic
1144686849 17:17231774-17231796 CAGGTGGGTGGTGCATTCGCAGG - Exonic
1144958708 17:19032878-19032900 GGGGTGGGGGGTGAGCCCGCGGG + Intronic
1144976451 17:19141646-19141668 GGGGTGGGGGGTGAGCCCGCGGG - Intronic
1147612879 17:41811987-41812009 CGGGCGGGCGGCGCGCCCGCTGG + Exonic
1147693451 17:42333274-42333296 CAGGTGGGTGGTGGGCCTGTAGG - Intronic
1149995611 17:61404703-61404725 GAGGTGGGTGGTTCCCGCGCGGG - Exonic
1150918943 17:69463084-69463106 CCGGTGGCTGGTGCACCCACAGG - Intronic
1151403094 17:73868924-73868946 CAGGTGGCTGGTGCCTCAGCAGG - Intergenic
1152248531 17:79199252-79199274 CTGGTGGGTGGTGCTGCCGAGGG - Intronic
1152862665 17:82704957-82704979 CAGGTGGGTGGTCTGTCCTCAGG + Intergenic
1154119900 18:11643841-11643863 GAGGTGGGTGGTGCCCAGGCTGG - Intergenic
1154437819 18:14360504-14360526 CAAGGGGGTGGTGCGTCCCCAGG - Intergenic
1160542452 18:79631962-79631984 CAGGTGAGTGCTGGGCCCACAGG + Intergenic
1160767449 19:814763-814785 CAGGTGGGCGGGGCTCACGCTGG - Intronic
1160909006 19:1466264-1466286 CAGCTTGATGGTGCGCACGCGGG - Exonic
1160991681 19:1862874-1862896 TCGGTGGGTGGGGCGCGCGCGGG - Intronic
1161242179 19:3228611-3228633 CAGGTGGGGGGGGGGCCCGGCGG + Intronic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1161977586 19:7615089-7615111 CAGGTGGGTGGCGGGCAGGCTGG + Intronic
1162896646 19:13768539-13768561 CTGGTGGGTGGGGCCCCCGCAGG + Exonic
1162931708 19:13960870-13960892 CAGGTGGAGGGTGTGGCCGCAGG + Intronic
1163510673 19:17733268-17733290 CAGGTGGGCGCTGCTCCCGCTGG - Exonic
1163697616 19:18771932-18771954 GAGGTGGCTGGCCCGCCCGCAGG + Intronic
1163716541 19:18875911-18875933 CAGCTGGGCGGTGCTCCCTCTGG - Intronic
1164597516 19:29539910-29539932 CAGGTGGGTGGGCCTCCAGCAGG - Intronic
1166319216 19:42006143-42006165 CAGGTGGGTGGTGGGCACAGTGG - Intronic
1167106440 19:47432445-47432467 CAGCTGGGTCGTGTGCCCACAGG - Exonic
1168281558 19:55308726-55308748 CAGGTGGGTGGTGGGGCCGTGGG + Exonic
1168596537 19:57682242-57682264 CAGGTGAGTTGTGCGTCCTCCGG + Exonic
1168602252 19:57727371-57727393 CGGGTGGGTGCTGCGTCCTCCGG - Exonic
925156421 2:1651749-1651771 GAGGTGGGTGGTGCCCTGGCTGG - Intronic
926144177 2:10386751-10386773 CTGGTGGGGGGTGCTCCAGCTGG - Intronic
926223982 2:10954616-10954638 CATGTGGGTGGGGCCCCAGCAGG - Intergenic
928453985 2:31403015-31403037 CATGTGGGTGGTCAGCCAGCAGG + Intronic
932402048 2:71487451-71487473 CAGGGGGGCAGTGTGCCCGCAGG + Intronic
933085107 2:78046072-78046094 CACGTGGGTGTTGGGCCTGCAGG + Intergenic
934767657 2:96889041-96889063 GATCTGGGTGGTGCCCCCGCAGG + Intronic
934985843 2:98884073-98884095 CAGGTGGGTGGGGCACCTGTGGG - Intronic
936550732 2:113437576-113437598 CAGGTGGTTAGTGCGCCCTAAGG + Intergenic
938407287 2:131039658-131039680 GGGATGGGTGGCGCGCCCGCTGG - Intronic
940945766 2:159615935-159615957 GAGGTGGGGGGTGCGGCCTCAGG - Intronic
941687020 2:168457011-168457033 CAGGTGGGTGGCGCGGGCCCCGG - Intronic
942629270 2:177938388-177938410 AAGGTGTGTGGTGCACCAGCAGG + Intronic
943667618 2:190626677-190626699 CAGGTGGGTGCCGAGCCCACAGG + Intergenic
948460955 2:238129772-238129794 CAGGTGGCTGGTGCGACGGAGGG - Intronic
949057517 2:241936623-241936645 CAGGTTGGTCGTGTGTCCGCTGG + Intergenic
949079948 2:242088725-242088747 CAGGTGGCAGGCGCGCCCGTTGG + Intergenic
1169207895 20:3750225-3750247 CAGGTGGGTCCTGAGCCCGCGGG + Exonic
1171908651 20:30921587-30921609 CAGGTGAGGCGTGCGCCGGCCGG + Intergenic
1172501973 20:35434021-35434043 CAGGTGGGTGGTGTGGACTCGGG + Exonic
1173605179 20:44326726-44326748 CAGGAATGTGGGGCGCCCGCGGG + Intergenic
1174111605 20:48201486-48201508 CAGGTGGCTGGAGCGGCTGCTGG - Intergenic
1175988836 20:62777591-62777613 CAGATGGCTGGGGCGCCAGCAGG - Intergenic
1176457857 21:6928967-6928989 CAAGGGGGTGGTGCGTCCCCAGG + Intergenic
1176836029 21:13794051-13794073 CAAGGGGGTGGTGCGTCCCCAGG + Intergenic
1179626995 21:42654273-42654295 CAGGTGCGGGGGGCGCCGGCGGG + Intronic
1179996732 21:44977697-44977719 CAAGGGGGTGGTGCGTCCCCAGG + Intergenic
1181036442 22:20171874-20171896 CAGGTGGGCGGTGAGCCAGGGGG + Intergenic
1181040080 22:20187954-20187976 CAGGTGAGTGGTGCGCACCCTGG + Intergenic
1181694437 22:24585871-24585893 CAGGTGGGTGGTGGGTCACCTGG + Exonic
1183343907 22:37296445-37296467 GGGGTGGGTGGTGGGACCGCAGG - Intronic
1184641983 22:45877701-45877723 CAGGTGGGTGGGGAGCCCCAGGG - Intergenic
1185108173 22:48885828-48885850 CAGGTGGGTGGAGCCCCAGGTGG - Intergenic
1185268520 22:49917934-49917956 CAGGTGGGAGGTCCGGCCCCAGG + Intronic
950321538 3:12059334-12059356 TAAGTGGGTGGTGGGCCCACAGG + Intronic
953929969 3:47000969-47000991 CAGGTGGGTGGTGTGGGCGTGGG - Intronic
954376272 3:50195619-50195641 CAGGTGAGTCGTGGGCCCCCAGG - Exonic
954396775 3:50297191-50297213 CAGGCGGGAGGTGCGGCTGCGGG + Exonic
954435451 3:50493568-50493590 CAGGTGTGTGATGCGGCTGCTGG - Intronic
961389277 3:126542706-126542728 CAGGTGTGCCCTGCGCCCGCTGG - Exonic
965672031 3:171157372-171157394 CAGGTGGGATGTGGGCCCCCAGG + Intronic
969465762 4:7355488-7355510 CAGGTGGGTGGATCTCCTGCAGG + Intronic
969588189 4:8106732-8106754 CTGGTGGGTGCGGGGCCCGCTGG - Intronic
969693950 4:8724540-8724562 CAGGTGGGTGGCAGGCCCGAGGG + Intergenic
970007975 4:11428679-11428701 CAGGTGAGTGCGGCGCGCGCGGG - Exonic
973760067 4:54107575-54107597 CAGGTGGGAGTTGCTCCCGATGG + Intronic
984929376 4:184833209-184833231 CAGCTGGGTGGTTCCCCTGCTGG + Intergenic
988844921 5:35118015-35118037 CAGATGGGTGGTGTGACCGAGGG + Intronic
992197922 5:74357901-74357923 CAGGAGAGTGGTGTGCCCCCTGG - Intergenic
997570133 5:134921043-134921065 CAGGTGGGTGGAGCAGCCCCAGG + Intronic
1002065718 5:176650746-176650768 CAGGTGGGTGGGGAGGTCGCAGG + Intronic
1003263993 6:4550302-4550324 CAGGTGGGTGGAGCCCCAGGTGG - Intergenic
1003264024 6:4550380-4550402 CAGGTGGGTGGAGCCCCAGGTGG - Intergenic
1003264029 6:4550396-4550418 CAGGTGGGTGGAGCTCCAGGTGG - Intergenic
1013422634 6:109979757-109979779 CTGCAGCGTGGTGCGCCCGCTGG + Exonic
1019487061 7:1294271-1294293 CAGGTGGGAGGGGCTCCGGCGGG - Intergenic
1019639182 7:2094075-2094097 CTGGTGAGTGGGGAGCCCGCTGG + Intronic
1020194520 7:6026637-6026659 CGGTTGGGTGGTGCCCCCGGAGG - Intronic
1023863829 7:44229526-44229548 CAGGTGGGTGGTGCGCCCGCAGG + Intronic
1024232250 7:47371473-47371495 CAGGTGGGCAGTGGGCCAGCAGG - Intronic
1031991404 7:128201425-128201447 CAGGTGGGCGGGGCTCCTGCCGG + Intergenic
1032074734 7:128831053-128831075 CAGGTGCGGGGTGGGCGCGCGGG + Intronic
1034209296 7:149349016-149349038 CATGTGGGTGTTGGGCCTGCAGG - Intergenic
1034688753 7:152997231-152997253 CAGGTGGGCCGTGAGCCCCCAGG + Intergenic
1035537987 8:406990-407012 CAGGTGGCCGGCGCGCCCGTTGG + Exonic
1035553395 8:545728-545750 CTGGTGGGCGGTGGGGCCGCTGG + Exonic
1036779330 8:11634758-11634780 CAGGTGAGTGGAGTGCCCGAGGG - Intergenic
1038446863 8:27610641-27610663 CAGGTGGGCGGGACGCCAGCAGG - Intronic
1038482403 8:27910646-27910668 CAGGTGGGAGGTGAGACCCCTGG + Intronic
1038789734 8:30657953-30657975 CAGGTAGGGGCTGCGGCCGCCGG - Exonic
1040760245 8:50832968-50832990 CAGGTGTCTGCTGCCCCCGCTGG - Intergenic
1041636521 8:60152202-60152224 CAGGTGGTTGGTGGTCTCGCTGG + Intergenic
1047381804 8:124371821-124371843 CAGGTGGGGGGCGAGCCCGGGGG - Intronic
1047523118 8:125610794-125610816 CAGGTGGCTGGTCAGCCCACAGG - Intergenic
1048456462 8:134583100-134583122 GAGGTGGGTGGTGAGCTCGGTGG - Intronic
1049545597 8:143229217-143229239 TGGGTGGGTGGTGAGCCAGCTGG - Intergenic
1049689473 8:143952441-143952463 CTGGTGGGTGGAGGGTCCGCAGG - Intronic
1049760681 8:144330788-144330810 CGGGTGGGGGCTGCGGCCGCCGG - Exonic
1049902202 9:179240-179262 CAGGTGGTTAGTGCGCCCTAGGG - Intergenic
1051887164 9:21905259-21905281 CAGATGGGTGGTGAGCCAGAAGG + Intronic
1053745232 9:41189529-41189551 CAGGTGGTTAGTGCGCCCTAAGG - Intronic
1053906880 9:42851863-42851885 CAGGTGGGCTGTGCGCTCGGCGG + Intergenic
1054482039 9:65675684-65675706 CAGGTGGTTAGTGCGCCCTAAGG + Intronic
1054683115 9:68241739-68241761 CAGGTGGTTAGTGCGCCCTAAGG + Exonic
1055785921 9:79868700-79868722 AAGGTGGGAGGTGCACCTGCAGG + Intergenic
1057308076 9:93924128-93924150 CAGGTCGGTGCTGGGCCTGCTGG - Intergenic
1057720428 9:97527791-97527813 GAGGTGGGAGGCGCTCCCGCGGG + Intronic
1060272624 9:122157670-122157692 CAGGGGGGTGGTTCGCCGGGGGG + Intronic
1060766516 9:126298180-126298202 CAGGTGGGTGGGGGGCAAGCTGG + Intergenic
1061075857 9:128340918-128340940 CAGGTGGGGGGCGCGCCCTGCGG + Intronic
1061791321 9:133060781-133060803 CAGGTGGCTGGGGCGCCCCAGGG - Intergenic
1061794999 9:133081348-133081370 CAGGTGGCTGGGGCGCCCCAGGG - Intronic
1062364694 9:136203144-136203166 CTGCTGGGCGCTGCGCCCGCGGG + Exonic
1202781360 9_KI270718v1_random:313-335 CAGGTGGTTAGTGCGCCCTAAGG - Intergenic
1203768412 EBV:38378-38400 CGGGTGGGGGGTGGCCCCGCTGG + Intergenic
1203768462 EBV:38503-38525 CGGGTGGGGGGTGGCCCCGCTGG + Intergenic
1203768512 EBV:38628-38650 CGGGTGGGGGGTGGCCCCGCTGG + Intergenic
1203768562 EBV:38753-38775 CGGGTGGGGGGTGGCCCCGCTGG + Intergenic
1203768612 EBV:38878-38900 CGGGTGGGGGGTGGCCCCGCTGG + Intergenic
1203768662 EBV:39003-39025 CGGGTGGGGGGTGGCCCCGCTGG + Intergenic
1203768712 EBV:39128-39150 CGGGTGGGGGGTGGCCCCGCTGG + Intergenic
1203768762 EBV:39253-39275 CGGGTGGGGGGTGGCCCCGCTGG + Intergenic
1203768812 EBV:39378-39400 CGGGTGGGGGGTGGCCCCGCTGG + Intergenic
1203768862 EBV:39503-39525 CGGGTGGGGGGTGGCCCCGCTGG + Intergenic
1203768912 EBV:39628-39650 CGGGTGGGGGGTGGCCCCGCTGG + Intergenic
1203768962 EBV:39753-39775 CGGGTGGGGGGTGGCCCCGCTGG + Intergenic
1203774756 EBV:66478-66500 CAGGTGGGTGGTGTGTGCCCGGG + Intergenic
1185449503 X:275055-275077 CAGGAGGCTGGTGTCCCCGCAGG + Intergenic
1187106638 X:16250090-16250112 CAGTTGGGTGATGGGCCCTCTGG - Intergenic
1187684032 X:21798721-21798743 CAGGTGGGAAGTGCTCCCACTGG + Intergenic
1189386260 X:40539355-40539377 CGTGTGGGTGGGGCGCCCCCAGG - Intergenic
1189915459 X:45851497-45851519 GAGGTGGGTGGCTCGCCAGCCGG - Intergenic
1198534813 X:137575013-137575035 CAGGTGGGTGGGGAGGCCTCTGG - Intronic