ID: 1023864554

View in Genome Browser
Species Human (GRCh38)
Location 7:44232615-44232637
Sequence GCACCTCCAGGGGCGCGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023864547_1023864554 7 Left 1023864547 7:44232585-44232607 CCACATGGGGACCGGGCGCAACT 0: 1
1: 0
2: 0
3: 4
4: 32
Right 1023864554 7:44232615-44232637 GCACCTCCAGGGGCGCGCCTGGG 0: 1
1: 0
2: 1
3: 9
4: 118
1023864548_1023864554 -4 Left 1023864548 7:44232596-44232618 CCGGGCGCAACTGTGCCAAGCAC 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1023864554 7:44232615-44232637 GCACCTCCAGGGGCGCGCCTGGG 0: 1
1: 0
2: 1
3: 9
4: 118
1023864540_1023864554 27 Left 1023864540 7:44232565-44232587 CCCTGGTCTGAGAGTGTCGGCCA 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1023864554 7:44232615-44232637 GCACCTCCAGGGGCGCGCCTGGG 0: 1
1: 0
2: 1
3: 9
4: 118
1023864541_1023864554 26 Left 1023864541 7:44232566-44232588 CCTGGTCTGAGAGTGTCGGCCAC 0: 1
1: 0
2: 0
3: 7
4: 58
Right 1023864554 7:44232615-44232637 GCACCTCCAGGGGCGCGCCTGGG 0: 1
1: 0
2: 1
3: 9
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023864554 Original CRISPR GCACCTCCAGGGGCGCGCCT GGG Intronic
900187371 1:1338716-1338738 GCACCCCCAGGGGAGCCTCTGGG + Intronic
900284224 1:1891410-1891432 GCTCCTCCAGGGGCGGGGGTGGG + Intergenic
901403671 1:9031891-9031913 GCACCTTCAGGGGCCCGGCAAGG - Intergenic
905632702 1:39527500-39527522 GCACCCCCAGGGAGGGGCCTGGG + Intergenic
905665114 1:39758917-39758939 GCACCCCCAGGGAGGGGCCTGGG - Exonic
906114678 1:43348866-43348888 GCAGCTCCAGGGTCCCTCCTCGG - Exonic
919004087 1:191872110-191872132 GCACCTCCAGCAGCAGGCCTAGG - Intergenic
920561927 1:206945125-206945147 GCACATCCAGGGGCGGGACAAGG + Intronic
922214944 1:223512539-223512561 GCCCCTCCAGGGGACCCCCTTGG + Intergenic
1065628640 10:27655325-27655347 GGACCTCCATGGGCCGGCCTGGG - Intergenic
1067478116 10:46579283-46579305 GCCCCTCCAAGAGCGCGCCGAGG - Intronic
1067616624 10:47762504-47762526 GCCCCTCCAAGAGCGCGCCGAGG + Intergenic
1069664683 10:70146485-70146507 GCAGCTCCACGGGCCCGCCTCGG + Exonic
1073593504 10:104778279-104778301 GCATCTCCAGGGGTGGGCCTGGG + Intronic
1076801785 10:132834380-132834402 GCACCTCCAAGGGACCGCCCGGG - Intronic
1076802338 10:132836357-132836379 GCGCCTCCAGGGGCACCGCTGGG + Intronic
1076809521 10:132879370-132879392 GCACCTCCCGGGACGGGCCGCGG - Intronic
1085472845 11:76769135-76769157 GCACTTCCAGGGGGGCCCCAAGG - Intergenic
1089373760 11:117979713-117979735 GCTCCTCCAGGGGGGAGCCAGGG + Intergenic
1101880563 12:108623017-108623039 CCACCTCCACGGGCTCTCCTGGG - Exonic
1110436415 13:75481936-75481958 GCACTTCCACGGGCGCGGCTCGG + Exonic
1113846433 13:113394216-113394238 GCACCTGCAGGGACAGGCCTCGG - Intergenic
1121024078 14:90601643-90601665 GCACCTGCAGGGGAGCGCCCCGG + Intronic
1122835474 14:104428650-104428672 GCAGCTGCAGGGGCGGGTCTCGG - Intergenic
1122946238 14:105011491-105011513 GCACCTGCAGAGCAGCGCCTGGG - Exonic
1123061792 14:105597828-105597850 CCACCTCCAGGGGCCCGGCCAGG - Intergenic
1123086530 14:105719559-105719581 CCACCTCCAGGGGCCCGGCCAGG - Intergenic
1123488275 15:20760163-20760185 TCTCCTCCAGGGGCTTGCCTTGG + Intergenic
1123544773 15:21329236-21329258 TCTCCTCCAGGGGCTTGCCTTGG + Intergenic
1124820985 15:33045196-33045218 GCAGCTCCAGGTGCGAGCATGGG - Intronic
1127853434 15:62935300-62935322 GCACCTCCAGGGGTGGGGCTGGG - Intergenic
1128331814 15:66761012-66761034 GAACCTCCAGGGGCGGGGCCTGG + Intronic
1129459034 15:75690638-75690660 GGACCTCTAGGGGGGCTCCTGGG + Exonic
1129514837 15:76151059-76151081 ACAGCTCCAGGGGCCCGGCTTGG - Intronic
1129724783 15:77896255-77896277 GGACCTCTAGGGGGGCTCCTGGG - Intergenic
1202953118 15_KI270727v1_random:56507-56529 TCTCCTCCAGGGGCTTGCCTTGG + Intergenic
1132669854 16:1098098-1098120 GGCCCTCCCGGGGCCCGCCTGGG - Intergenic
1132745212 16:1433593-1433615 GCCCCTCCAGGGGCTCTGCTGGG - Intergenic
1134006556 16:10822141-10822163 GAACCTCCAGGGTTGCGGCTTGG + Intergenic
1134550695 16:15137232-15137254 GCCCCACCAGGGGGGCCCCTGGG + Intronic
1134708553 16:16317392-16317414 GCCCCACCAGGGGGGCCCCTGGG - Intergenic
1136579387 16:31142609-31142631 CCGCCTCCAGCAGCGCGCCTGGG + Exonic
1141146165 16:81531625-81531647 ACACCTCGAGGGGCAAGCCTGGG + Intronic
1142057121 16:88004963-88004985 GCAGCCCCAGGGGCACTCCTGGG - Intronic
1142727863 17:1829817-1829839 GCAGCTCCTGGCGCGCCCCTTGG + Exonic
1145223097 17:21105257-21105279 GCACCTCCAGTGGCTGGCCCAGG + Intergenic
1147446357 17:40477538-40477560 ACACCTCCAGGGGCTCGCTAAGG - Exonic
1148627114 17:49078109-49078131 GCACCTCCAGCGGCAGTCCTGGG + Intergenic
1151334575 17:73432291-73432313 GCACCTGCAGGAGTGAGCCTGGG + Intronic
1152387223 17:79981850-79981872 ACTCCTCCAAGGGCGCGCCAGGG + Intronic
1152422877 17:80203594-80203616 GCATCTCCAGGGGTGGGCCGAGG + Intronic
1152463122 17:80451561-80451583 GCAGCTCGAGGGGCACACCTGGG + Intergenic
1152717135 17:81905564-81905586 GTACCTCCTGGGCCCCGCCTAGG + Intronic
1153885080 18:9457360-9457382 GCACATCCTGGGGCCCTCCTGGG + Intergenic
1154445921 18:14435429-14435451 TCTCCTCCAGGGGCTTGCCTTGG + Intergenic
1160776655 19:859639-859661 GCACCCCCAGGGCCCTGCCTGGG + Exonic
1161051391 19:2165490-2165512 GCAGCTCCGGGTGTGCGCCTGGG + Intronic
1161579577 19:5073429-5073451 GCACCAGGAGGGGCCCGCCTGGG - Intronic
1162021057 19:7868831-7868853 GGAGCTCGAGGGGCGGGCCTAGG + Exonic
1162781895 19:13010941-13010963 GCACATGCAGGGGCGCCACTGGG - Intronic
1164643919 19:29844701-29844723 GCACTTCCGGGCGCGCGCCGCGG + Intergenic
1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG + Intronic
1167266442 19:48485340-48485362 GCCCCTCCAGGGGCCGGGCTGGG + Exonic
1167399510 19:49255585-49255607 CCACCCCCAGGTGTGCGCCTCGG - Intergenic
1167551346 19:50163032-50163054 GCAGCTGCAGGCGCGCGCCGGGG - Exonic
1168272451 19:55257775-55257797 CCACCTCCAGGGCAGGGCCTAGG + Intronic
927708510 2:25311391-25311413 GCACCTCCAGGGAGCCGCCCAGG - Intronic
930033259 2:47070800-47070822 GTACCTCCAAGGGGGCGCTTTGG - Intronic
933666674 2:84970720-84970742 GCCCCGCCTGGGGCGGGCCTAGG - Intergenic
940694159 2:156958656-156958678 GCAGCTCCAGGTGCCAGCCTGGG + Intergenic
941508381 2:166375957-166375979 CTACCTCCACGGGCGCGCCCTGG - Exonic
943483650 2:188454062-188454084 GTACCTCCAGCGGCAGGCCTGGG - Intronic
1175265676 20:57702031-57702053 GCACCTTCAGGGCCTCGCCTAGG - Intronic
1175715813 20:61253393-61253415 GCGGCTCCGGGGGCGCCCCTGGG + Intronic
1175964046 20:62651425-62651447 GCACCTCCAGGGGCTTCCGTTGG - Intronic
1176450058 21:6854428-6854450 TCTCCTCCAGGGGCTTGCCTTGG - Intergenic
1176828227 21:13719446-13719468 TCTCCTCCAGGGGCTTGCCTTGG - Intergenic
1180096104 21:45555799-45555821 GCACCTCCAGGACCGCGCATGGG - Intergenic
1182684284 22:32109314-32109336 CTACCTCCAGGGCCACGCCTGGG + Intronic
1183095303 22:35548462-35548484 GCAACTTCAGGGGCGTGACTTGG - Intronic
1183694743 22:39415377-39415399 GCAGCTTCAGGGGCCCTCCTGGG - Intronic
1184870411 22:47234083-47234105 GCACCTCCTGTGGCAAGCCTGGG + Intergenic
1185406868 22:50657200-50657222 GGAGCTCCAGGAGCCCGCCTTGG - Intergenic
951822176 3:26825660-26825682 GAACCTCCAGTGGCAGGCCTGGG + Intergenic
952336441 3:32407237-32407259 GCAGATCCAGGGGCATGCCTGGG - Intronic
954778929 3:53045540-53045562 CCGGCTGCAGGGGCGCGCCTGGG - Intronic
961327783 3:126119565-126119587 GAACCTTCATGGGCGTGCCTGGG - Intronic
963947651 3:151163961-151163983 GCAGATCCAGGGGTGAGCCTGGG - Exonic
965596821 3:170418929-170418951 CCACCTCCAGTGTCCCGCCTCGG + Exonic
968549367 4:1214362-1214384 GCACATCCAGGGCCGCGCCGCGG + Exonic
968810877 4:2799197-2799219 CCACCCCCAGGGTCCCGCCTGGG - Intronic
977473405 4:97472358-97472380 TCACCTCCAGGAGCTTGCCTTGG + Intronic
985298149 4:188457492-188457514 TCACCTCCAGGGGCGTGCCTCGG - Intergenic
985577396 5:679786-679808 GCACCCCGTGGGGCCCGCCTGGG + Intronic
985592328 5:771882-771904 GCACCCCGTGGGGCCCGCCTGGG + Intergenic
986669270 5:10128303-10128325 GCCCCTCCAGGGACTGGCCTTGG - Intergenic
1002435598 5:179229038-179229060 GCACCTCCAGCTGTGCACCTCGG + Intronic
1002580918 5:180209067-180209089 GCAGCTCCCGGTGCGAGCCTCGG + Intronic
1002925845 6:1605236-1605258 GCCCCTGCACGGACGCGCCTTGG - Intergenic
1014724796 6:124962073-124962095 GCACCTCCTGGTGCGCGCCGCGG + Intergenic
1015143429 6:129959616-129959638 GCAGCTCCAGGTGCTGGCCTGGG - Intergenic
1020257475 7:6510213-6510235 GCAGCTCCAGGGCTGAGCCTGGG + Intronic
1021522552 7:21552126-21552148 GCACCCCAAGGGCCGCGCCCTGG + Intronic
1022697935 7:32728431-32728453 GCACGTCCAGGGCCGCCGCTCGG - Intergenic
1023864554 7:44232615-44232637 GCACCTCCAGGGGCGCGCCTGGG + Intronic
1023941211 7:44769291-44769313 GTGCCTCCAGGGGCAGGCCTTGG - Exonic
1025198064 7:56947247-56947269 GCACGTCCAGGGGAGCATCTCGG - Intergenic
1025673885 7:63629690-63629712 GCACGTCCAGGGGAGCATCTCGG + Intergenic
1032091891 7:128915316-128915338 TCACCCCCAGGGACGCTCCTCGG + Intergenic
1033159079 7:138981224-138981246 TCCCCTCCATGGCCGCGCCTCGG + Exonic
1033287505 7:140055101-140055123 GAACCTCCAGGGGTGGGACTTGG + Intronic
1035050091 7:155993740-155993762 GCTTCTCCTGGGGCTCGCCTTGG + Intergenic
1035258041 7:157644420-157644442 GGACCTCCAGGGGCCTGCCCTGG - Intronic
1049533751 8:143168637-143168659 GCGCCTCCAGGAGTGGGCCTGGG - Intergenic
1049708398 8:144053048-144053070 ACACCTCCAGGGGCAGGCCCCGG + Exonic
1049802472 8:144524428-144524450 GCACCTGCCGGTGAGCGCCTGGG - Exonic
1056545012 9:87606210-87606232 GTACCTGCAGGGTGGCGCCTGGG - Intronic
1057263503 9:93599171-93599193 GCACCTGCAGGGGCTCTCCAGGG + Intronic
1060267637 9:122121622-122121644 GCACCACCCGAGGCCCGCCTGGG + Intergenic
1060525994 9:124321691-124321713 GCATCTGCAGGGGGGCGCCCAGG - Intronic
1061868202 9:133506247-133506269 GCTCCTCCTGGGGTGAGCCTGGG + Intergenic
1062252323 9:135604607-135604629 GCACGGCCAGGGGTGCGCTTTGG - Intergenic
1062498010 9:136840668-136840690 GCACCTGCAGGGCCCAGCCTGGG - Exonic
1203519124 Un_GL000213v1:30089-30111 TCTCCTCCAGGGGCTTGCCTTGG + Intergenic
1190705331 X:53022516-53022538 TCACCTCCAGGGGGTAGCCTTGG - Intergenic
1191105561 X:56770028-56770050 GCACCGCCAGAGGCGCACCCTGG - Intergenic
1191106554 X:56775430-56775452 GCACCGCCAGAGGCGCACCCTGG - Intergenic
1191107547 X:56780831-56780853 GCACCGCCAGAGGCGCACCCTGG - Intergenic
1192536621 X:71933976-71933998 GCACCTCCAAGAGCGACCCTTGG + Intergenic