ID: 1023871479

View in Genome Browser
Species Human (GRCh38)
Location 7:44265343-44265365
Sequence CAAGTTGGAAAGGTGGAACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 147}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023871479_1023871483 -5 Left 1023871479 7:44265343-44265365 CCACGTTCCACCTTTCCAACTTG 0: 1
1: 0
2: 2
3: 9
4: 147
Right 1023871483 7:44265361-44265383 ACTTGTCCCAATAAAGTTGATGG 0: 1
1: 0
2: 0
3: 6
4: 98
1023871479_1023871487 16 Left 1023871479 7:44265343-44265365 CCACGTTCCACCTTTCCAACTTG 0: 1
1: 0
2: 2
3: 9
4: 147
Right 1023871487 7:44265382-44265404 GGCTAATCTTTCCCCAGGACAGG 0: 1
1: 0
2: 1
3: 1
4: 95
1023871479_1023871491 29 Left 1023871479 7:44265343-44265365 CCACGTTCCACCTTTCCAACTTG 0: 1
1: 0
2: 2
3: 9
4: 147
Right 1023871491 7:44265395-44265417 CCAGGACAGGATCCAAGCCCAGG No data
1023871479_1023871486 11 Left 1023871479 7:44265343-44265365 CCACGTTCCACCTTTCCAACTTG 0: 1
1: 0
2: 2
3: 9
4: 147
Right 1023871486 7:44265377-44265399 TTGATGGCTAATCTTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023871479 Original CRISPR CAAGTTGGAAAGGTGGAACG TGG (reversed) Intronic
901111583 1:6801045-6801067 CAAGTTAGAAGGGTGGAGAGTGG + Intronic
901943902 1:12685307-12685329 CCTGTTTGAAAGGTGGAAGGAGG - Intergenic
903919218 1:26787803-26787825 CAAGGTGGGAAGGTGCTACGAGG + Intronic
905615180 1:39392089-39392111 CAAGGTGGACAGGTGGAACAGGG - Intronic
907831971 1:58073279-58073301 TCAGTTGGGAAGGTGGAAAGAGG - Intronic
908441661 1:64161367-64161389 CAAGTTGGGAAGGAGGAGGGAGG + Intronic
908982467 1:69975744-69975766 TAAGTTGGCATGGTGGAAGGAGG - Intronic
911331872 1:96533753-96533775 AAAGGTGGGAAGGTGGGACGGGG + Intergenic
913591137 1:120327026-120327048 CAAGCTGAAAAAGTAGAACGGGG + Intergenic
913652231 1:120928074-120928096 CAAGCTGAAAAAGTAGAACGGGG - Intergenic
914034549 1:143989701-143989723 CAAGATGGAAAGGTGGGCTGTGG - Intergenic
914154903 1:145078267-145078289 CAAGATGGAAAGGTGGGCTGTGG + Intronic
914168879 1:145200997-145201019 CAAGCTGAAAAAGTAGAACGGGG + Intergenic
914642405 1:149622184-149622206 CAAGCTGAAAAAGTAGAACGGGG - Intergenic
914945806 1:152064913-152064935 TAAGTAGAAAAGGTGAAACGAGG - Intergenic
916160121 1:161902996-161903018 GAAGTTGGAAAGATGAAAAGAGG - Intronic
916530549 1:165652537-165652559 AAAGTGGGGAAGGTGGAAAGGGG + Intronic
916988262 1:170214709-170214731 GAAGGTGGAAAGGGGAAACGTGG + Intergenic
917068276 1:171121755-171121777 CACGATAGAAAGGTGGAAAGTGG + Intergenic
921048745 1:211495851-211495873 CAAAGGGGAAAGGTGGAAGGTGG - Intergenic
921361005 1:214331119-214331141 CAAGGTGGGAAGTTGGAAAGAGG + Intronic
922515413 1:226204534-226204556 CATGTTGGAAGGTTGGAAGGAGG + Intergenic
922974676 1:229774352-229774374 AAAGTTGGGAGGGTGGAAGGGGG + Intergenic
1063813897 10:9748404-9748426 CAAGTGGCAAATGTGGAGCGAGG + Intergenic
1063999795 10:11654060-11654082 CAAGTTTGAAATGTGCAATGAGG + Intergenic
1065121902 10:22538551-22538573 CAAGTGGGAAGGGTCAAACGAGG + Intronic
1065447205 10:25815135-25815157 CAAGTTGGAAAGGGAAAATGTGG + Intergenic
1072108024 10:92291834-92291856 CAAGTTGGGGAGGGGGAAGGGGG - Intronic
1074222093 10:111447965-111447987 CAAGGTGGAAGGTTGGAAAGGGG - Intergenic
1074294838 10:112175565-112175587 CAAGGTGTAAAGGTGGGAAGAGG - Intronic
1075458442 10:122599998-122600020 GAAGTCGGCAAAGTGGAACGAGG - Intronic
1077004227 11:344228-344250 GAAGCTGGAGAGATGGAACGGGG - Intergenic
1078604793 11:12765633-12765655 CAAGTTGGAGAGGAGGAGGGCGG - Intronic
1079315910 11:19407697-19407719 CAAGTTGGAAGGGGGGCATGCGG - Intronic
1083054275 11:59804810-59804832 CAAGTGAGAAAGGTGAAATGAGG + Intergenic
1083115266 11:60453214-60453236 CAAGTTGGAAAGCTGGTAAATGG - Intronic
1083722428 11:64609962-64609984 CAAGATGTGAAGGTGGAATGTGG - Intronic
1089686731 11:120154655-120154677 CGAGTTGGGAAGGGGGAATGGGG - Intronic
1090646297 11:128768991-128769013 AATTTTGGAAAGGTGGAACCTGG - Intronic
1091541415 12:1465926-1465948 CAAGTAGGAAAGATGGGACCAGG + Intronic
1091640579 12:2233971-2233993 CAAGTGGGAAGGGTGGACCTGGG - Intronic
1093486359 12:19657136-19657158 CAACTTGGGAAGGAGGAATGAGG - Intronic
1097322234 12:58238692-58238714 CACGTTGCAAAAGTGGAAAGGGG + Intergenic
1097431865 12:59518911-59518933 CAACTTGGAATGGTGAAATGTGG - Intergenic
1098123836 12:67269728-67269750 CAAATTGGAAATGTGGTACGAGG - Exonic
1100632819 12:96405642-96405664 AAAGTTGGAAAGTGGGAACTGGG + Intergenic
1101085344 12:101230097-101230119 CAATTTAGAAAGGCGGAACTGGG + Intergenic
1105598219 13:21860338-21860360 CAAGTTGGAAACTTGGAACTTGG - Intergenic
1106681793 13:32016012-32016034 GAAGTTAGAGAGGTGGAAAGGGG + Intergenic
1108890624 13:55253710-55253732 CAAGTTGGAAAGATGGCTAGTGG - Intergenic
1110903595 13:80856782-80856804 CAAGTTGGAGTAGTGGAAGGTGG + Intergenic
1111884347 13:94000567-94000589 CAAGTTGGACAGTTGGAACTGGG + Intronic
1112260014 13:97869288-97869310 CAAGTTGGAATGTTGGAGTGTGG + Intergenic
1113926283 13:113943583-113943605 AATGCTGGAAAGGTAGAACGAGG + Intergenic
1114375326 14:22140236-22140258 GAAGTGGGAGAGGTGGAAGGAGG + Intergenic
1115145596 14:30222580-30222602 ACAGTTAGAAAGGAGGAACGAGG - Intergenic
1116229863 14:42202791-42202813 TAAGTAGGAAAGGTGGAGCAAGG - Intergenic
1118616588 14:67578251-67578273 CAGGTGGGAAAGGTGGGAGGAGG + Intronic
1131061658 15:89408343-89408365 AATATTGGAAAGGTGGACCGAGG + Intergenic
1132020086 15:98353447-98353469 AAAATTGGGAAGGTGGAACATGG - Intergenic
1135349241 16:21714926-21714948 CACGTTGGAGAGGTGAAAGGCGG + Intronic
1138716196 16:59025681-59025703 CAAGTTGGAAAGATAGAGCATGG - Intergenic
1139329340 16:66175388-66175410 CATATTGGAAAGGGGGAAAGAGG + Intergenic
1142878991 17:2869885-2869907 CAAGTGGCCCAGGTGGAACGTGG + Intronic
1143427977 17:6855190-6855212 AAAGTTATAAAGGTAGAACGAGG - Intergenic
1145001356 17:19307163-19307185 CAAGTTGTTAAGGTGGATTGAGG + Intronic
1145797046 17:27661621-27661643 CAAGCTGGAAAAGTGGCCCGTGG + Intergenic
1145811403 17:27766296-27766318 CAAGCTGGAAAAGTGGCTCGTGG + Intronic
1148386095 17:47236289-47236311 CCAGTTGGGAAGGTGGAATGAGG + Intergenic
1148774519 17:50088055-50088077 CAAGCTGGAAAGGGGGACCCAGG + Intronic
1150158661 17:62875282-62875304 CAACCTGGAAAGGTGGCAGGAGG + Intergenic
1150875625 17:68967170-68967192 CAAGGGGGAAAGGTGGGAAGGGG - Intergenic
1151457227 17:74233217-74233239 CCAGGTGGAAAGGTGGCACTGGG + Intronic
1151798320 17:76361864-76361886 CAAGTTGGAGTGGCGCAACGTGG - Intronic
1154334152 18:13452543-13452565 GAAGCTGGAAAGGAGGAAGGCGG + Intronic
1155779843 18:29817408-29817430 CAAGGGTGAAAGGTGGAACAAGG + Intergenic
1156501605 18:37563631-37563653 GAGATTGGAAAGGTGGAACGGGG - Intronic
1157611212 18:48957183-48957205 CAAGTTGGCAAGGTCCCACGTGG + Intergenic
1158046400 18:53160581-53160603 CTAGATGGAAAGGTGTAACTGGG + Intronic
1160278440 18:77462160-77462182 CAAGATGTCAAGGTGGTACGTGG + Intergenic
1163011766 19:14431051-14431073 CAAAGTGGAAAGGTGAAATGTGG + Intergenic
1168570853 19:57467865-57467887 TAAGTTGGTAGGGAGGAACGAGG + Intronic
925467963 2:4126911-4126933 GAAGTTGGAAAGGTGAAAAAGGG + Intergenic
926995245 2:18728254-18728276 CAAGTGGAAAATGTGGAAAGTGG + Intergenic
933489310 2:82965262-82965284 AAAGTTGGAAAGGTGGGAGGTGG + Intergenic
935700583 2:105808290-105808312 CCAGTTGGAAAAGTAGAATGAGG + Intronic
935969582 2:108517712-108517734 CAATTACAAAAGGTGGAACGTGG + Intergenic
938049854 2:128158991-128159013 GAAGTTGGAAAGGTGGGCTGGGG + Intronic
938380285 2:130832563-130832585 TAAGATGGAAAGATGGAAAGAGG + Intergenic
1169137024 20:3203646-3203668 CCAGCTGGAAAGGTGGAGCCGGG - Intronic
1169324402 20:4663596-4663618 CAAGGTGGGAGGGTGGAAGGGGG - Intergenic
1173205634 20:40991112-40991134 CAAGATGGAAAGGAGAAAGGAGG - Intergenic
1183025428 22:35062550-35062572 CATGTGGGAAAGGTGGATTGCGG - Intergenic
1183106201 22:35617078-35617100 CAAGGTGGAAAGTTTGCACGTGG - Intronic
1184886821 22:47351712-47351734 CCAGTTGGAAACTTGGAATGTGG - Intergenic
951112433 3:18820134-18820156 TAAATTGGAAATGTGGAAAGAGG + Intergenic
951606472 3:24440196-24440218 CAAATTGGAATGATGGAACAAGG - Intronic
953805395 3:46063574-46063596 CAGGTGGAAAAGGTGGAAGGTGG + Intergenic
955933026 3:64077022-64077044 AAAGTGGGAAAGGAGGAAGGTGG + Intergenic
958960831 3:100508121-100508143 CATGGTGGAAATGTGGAACATGG - Intronic
960219392 3:115087119-115087141 TAAGTTGGAAAGGAGGACCATGG - Intronic
960524576 3:118695144-118695166 TAAGTTGGAAAGGTCGATTGAGG + Intergenic
966855033 3:184188034-184188056 CAATTTGGAGAGGTGAAACGGGG + Intronic
967787205 3:193510122-193510144 CAAGTTGCAGAGGAGGAGCGGGG + Intronic
970127172 4:12827860-12827882 AAAGTTAGAAATGTGGAACGGGG - Intergenic
973330795 4:48908449-48908471 CAAGTTGGAGGTGTGGATCGGGG - Intergenic
974466019 4:62257593-62257615 TAAGCTGGAAAGGTGGAAGAAGG - Intergenic
974778547 4:66521261-66521283 CAACTCTGAAAGGTGGAAAGAGG + Intergenic
978661174 4:111128367-111128389 CAAGTTTGATAGGTGGACCTGGG - Intergenic
981116695 4:140999066-140999088 AAAGTAGGGAAGGTGGAACATGG + Intronic
983762662 4:171431626-171431648 AGATTTGGAAAGGTGGAAAGAGG + Intergenic
986809026 5:11336331-11336353 TGAGTTCGAAAGGTTGAACGTGG + Intronic
990671177 5:58131817-58131839 CAAGTTTGAAGGCTGGACCGTGG - Intergenic
992061720 5:73056823-73056845 CAAGTTGGAAAGGGAGAGAGAGG + Intronic
994675128 5:102811384-102811406 CAAGCTGTAAAGATGGAAGGAGG - Intronic
995029825 5:107467595-107467617 AAAGTTGTGAAGGTGGCACGTGG + Intronic
996060989 5:119033249-119033271 CAAGTTGGCTAGGTGGTACAGGG - Intergenic
996907663 5:128619930-128619952 CAAGATGGAAGGGTGGAGAGTGG + Intronic
997724621 5:136110118-136110140 CCTGTTGGAAAGGTGGCATGGGG + Intergenic
999581755 5:153046254-153046276 CAAGACAGAAAGGTGGAAGGGGG - Intergenic
1000826314 5:166048784-166048806 CAAGTTGCAAAGGTGGCAATAGG - Intergenic
1000864802 5:166500567-166500589 AAAGTTGCAAAGGTGAAACTTGG + Intergenic
1007242436 6:40436697-40436719 CAAGTTGGAAAGGTGGCAGGTGG - Intronic
1008070399 6:47093579-47093601 CAAGTTGCAAAGTGGGAACATGG - Intergenic
1013330183 6:109093251-109093273 CATGTTGAAAAGGTGGACCCAGG - Intronic
1013986084 6:116195893-116195915 CAAGTTGGAAAGGGGGAAGGTGG + Intronic
1015634766 6:135264431-135264453 CAAGTTCCAAATGTGGCACGAGG + Intergenic
1015780065 6:136855806-136855828 CCAGTTGGCAAAGTGGAAAGAGG + Intronic
1015799730 6:137047921-137047943 CCAGCTGGAAAGTGGGAACGGGG + Intergenic
1016137133 6:140557717-140557739 CAAGTTAGAAAGGTGAAAAAAGG + Intergenic
1019004576 6:168785402-168785424 CAGGGTTGAAAGGTGGAAGGTGG + Intergenic
1019864661 7:3696042-3696064 CAAGTGGGAAAACCGGAACGCGG - Intronic
1020692478 7:11372936-11372958 CTCGTTAGAAAGGTGGAAAGAGG - Exonic
1023871479 7:44265343-44265365 CAAGTTGGAAAGGTGGAACGTGG - Intronic
1024583446 7:50820180-50820202 CTAATTGAAAAGCTGGAACGTGG + Intergenic
1026658239 7:72276030-72276052 AAAGTTGGGAAGGAGGAAGGGGG + Intronic
1026850119 7:73718927-73718949 GAAGGTGGATAGGTGGACCGGGG + Intronic
1026958159 7:74391174-74391196 CAAATTGCAAAGATGGAACATGG - Intronic
1028848013 7:95504471-95504493 GAAGATGAAAAGATGGAACGCGG - Intronic
1032810234 7:135406755-135406777 CAAGTTGTAAAGGGGGAAACAGG - Intronic
1035082941 7:156232960-156232982 CATGTTGTAAAGGTGGAGTGGGG + Intergenic
1037900799 8:22687554-22687576 CAAAGTGGAAATGTGGAACTTGG - Intergenic
1046744277 8:117860349-117860371 CAAGGTGGGAGGGTGGAAGGGGG + Intronic
1047346134 8:124030682-124030704 CTAGATGGAAAGCTGGAACCTGG - Intronic
1049748075 8:144271378-144271400 CAGGTGGGAGAGGCGGAACGAGG - Intronic
1051447822 9:17159740-17159762 TGAGCTGGAAAGGTGGAAGGAGG + Intronic
1053461112 9:38272219-38272241 CAAGTGGGACACGTGGAATGTGG + Intergenic
1056732196 9:89176314-89176336 CAAGTTTGAAAGGTCAAATGTGG - Intronic
1057975571 9:99602482-99602504 ATGGTGGGAAAGGTGGAACGGGG + Intergenic
1060001866 9:119966106-119966128 GAGATTGGAAAGGTGGAAGGTGG - Intergenic
1062042228 9:134409389-134409411 TAGGTTGGAGAGGTGGAGCGGGG + Intronic
1189303078 X:39966891-39966913 CAAGTTGGCAAGGAAGAACCAGG + Intergenic
1191174549 X:57485117-57485139 AAAGTTGGAAAAATGGAAAGTGG + Intronic
1192252530 X:69424564-69424586 CAAGTTAGAAGGGTGGAAAATGG - Intergenic
1192381970 X:70626419-70626441 CAAGTTGGAAAGGTAAGAGGCGG - Intronic
1192430098 X:71106008-71106030 TACGTTTGTAAGGTGGAACGTGG - Exonic
1194629720 X:96269061-96269083 CAAATTGGAAAAGAGGAAAGCGG + Intergenic
1199809845 X:151338522-151338544 ACAGTTAGGAAGGTGGAACGCGG + Intergenic
1202025907 Y:20523286-20523308 CAAGGTGTGAAGGTGGAAAGTGG + Intergenic