ID: 1023873273

View in Genome Browser
Species Human (GRCh38)
Location 7:44274040-44274062
Sequence TGCTCTCATCCGGAGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023873273_1023873277 5 Left 1023873273 7:44274040-44274062 CCTACCACCTCCGGATGAGAGCA 0: 1
1: 0
2: 0
3: 6
4: 132
Right 1023873277 7:44274068-44274090 ACACATCCGCCCTCCCCAGCAGG No data
1023873273_1023873278 10 Left 1023873273 7:44274040-44274062 CCTACCACCTCCGGATGAGAGCA 0: 1
1: 0
2: 0
3: 6
4: 132
Right 1023873278 7:44274073-44274095 TCCGCCCTCCCCAGCAGGAGAGG 0: 1
1: 0
2: 0
3: 29
4: 330
1023873273_1023873282 16 Left 1023873273 7:44274040-44274062 CCTACCACCTCCGGATGAGAGCA 0: 1
1: 0
2: 0
3: 6
4: 132
Right 1023873282 7:44274079-44274101 CTCCCCAGCAGGAGAGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023873273 Original CRISPR TGCTCTCATCCGGAGGTGGT AGG (reversed) Intronic
902822052 1:18949370-18949392 GGCTGTGATCGGGAGGTGGTGGG + Intronic
903364658 1:22798582-22798604 TTCTCTCATAAGGAGCTGGTGGG + Intronic
907864597 1:58387487-58387509 TGAGCTCTTCGGGAGGTGGTGGG + Intronic
913218388 1:116639473-116639495 TTCTGTCATCTGCAGGTGGTTGG - Intronic
915190935 1:154149938-154149960 TGCTCTCAGCCGGGTGTGGTTGG + Intronic
916149202 1:161769690-161769712 TGGTCTCATCTGGGGGTGATGGG + Intronic
917757625 1:178118430-178118452 TGGTCTCATCTGGGGGTGATGGG + Intronic
917778228 1:178361860-178361882 TGGTCTCATCTGGGGGTGATGGG + Intronic
1064823431 10:19366227-19366249 TGGTCCCATCCGGGGGTGATGGG + Intronic
1066541583 10:36452414-36452436 TGGTCCCATCTGGAGGTGATGGG - Intergenic
1070726623 10:78796154-78796176 TGCCCTCATCCAGAGCTGGTGGG - Intergenic
1072572634 10:96672152-96672174 TGCTGGCTTCCAGAGGTGGTTGG + Intronic
1079682218 11:23312130-23312152 TGATATCATCAGGAAGTGGTAGG + Intergenic
1080684272 11:34502520-34502542 TGCTCTCCTCCACAGGTGGGAGG - Intronic
1084083116 11:66842247-66842269 TCTTCACATCCAGAGGTGGTCGG + Intronic
1084420436 11:69058006-69058028 CGCTCTCATCCGGGGCTGGACGG - Intronic
1087386964 11:97483495-97483517 TGCTCTAATCCTGTGGGGGTTGG - Intergenic
1089629692 11:119776684-119776706 TGTTCTCCTGCGGAGGTGCTGGG + Intergenic
1091956196 12:4645555-4645577 TGGTCTCATCTGGGGATGGTGGG + Intronic
1093714122 12:22362124-22362146 TGGTCTCATCTGGAGGTGCTAGG - Intronic
1100746231 12:97649368-97649390 TGGTTTCATCTGGAGGTGATGGG + Intergenic
1103860041 12:124004864-124004886 TGGTCCCATCTGGAGGTGTTGGG - Exonic
1105973463 13:25452289-25452311 TGCGCTCAGCCCGTGGTGGTGGG - Intronic
1107060489 13:36154898-36154920 TGCTGTCACTCGGAGGTGGCTGG - Intergenic
1107443486 13:40449172-40449194 TTGTCTCATCTGGAGGTGGGAGG - Intergenic
1107838514 13:44432652-44432674 TTCTCTCATCTAGAGCTGGTGGG - Intronic
1108003841 13:45928097-45928119 TTCTCTCATCTGGTGGAGGTAGG - Intergenic
1112369844 13:98784911-98784933 TGCTCTCCTCCTGAGCTGATGGG + Intergenic
1112377141 13:98853909-98853931 TGTTGTCCTCAGGAGGTGGTTGG - Intronic
1122118761 14:99540794-99540816 TGCTCCCATGAGGAGGGGGTGGG + Intronic
1124162761 15:27288409-27288431 TGGTCCCATCTGGAGGTGATGGG + Intronic
1132136867 15:99350259-99350281 TGCTCTCATACGTAGCTGGTAGG + Intronic
1133740881 16:8650342-8650364 TGCTCAACTCCGGAGTTGGTGGG - Intergenic
1134662365 16:15993741-15993763 TGCTCACATGCGGGGGTGGGTGG + Intronic
1135062401 16:19282172-19282194 TGCTGTCATTTGGAGGTTGTAGG - Intergenic
1136556669 16:31011034-31011056 GGCTCGCACCCAGAGGTGGTCGG - Intergenic
1137532345 16:49287246-49287268 TGCTGTCATCCGTGGGTGGCTGG + Intergenic
1138200116 16:55082140-55082162 TGCTCCCATCCTGAGGTTTTAGG - Intergenic
1139966327 16:70747564-70747586 TGCCCACAGCCCGAGGTGGTGGG + Intronic
1141378842 16:83557218-83557240 TGGTCTCATCTGGGGGTGATGGG - Intronic
1146315913 17:31806682-31806704 TGGTCCCATCTGGAGGTGATGGG - Intergenic
1146881297 17:36443790-36443812 TGGTCCCATCAGGAGGTGATGGG + Intergenic
1149599629 17:57885183-57885205 TGCTGTCCTCCAGTGGTGGTTGG + Intronic
1150074312 17:62179665-62179687 TGCCCTCATCAGGAGGAGATAGG - Intergenic
1151787511 17:76282378-76282400 TGTTCTCATGCTGAGCTGGTGGG - Intronic
1153495724 18:5696779-5696801 TGGTCCCATCTGGAGGTGATGGG - Intergenic
1156800877 18:41111823-41111845 TGATCTCATCTGGGGGTGATGGG + Intergenic
1159543787 18:69814400-69814422 TGGTCCCATCTGGAGGTGATGGG + Intronic
1159670881 18:71219233-71219255 TGCTCCCATCTGGGGGTGATGGG + Intergenic
1160074139 18:75655771-75655793 TTCTCTAATCAGGAGGTGTTGGG + Intergenic
1160334275 18:78023658-78023680 TGCTCCCATCTGGGGGTGATGGG + Intergenic
1161125224 19:2552352-2552374 TGGTCCCATCTGGAGGTGATGGG - Intronic
1161497693 19:4596536-4596558 GGCTCCCATCTGGAGGTGGGTGG - Intergenic
1162139429 19:8577106-8577128 AGCTCCCATCTGTAGGTGGTGGG - Intronic
1162218046 19:9152612-9152634 TGGTCCCATCTGGAGGTGATGGG - Intronic
1162676792 19:12305170-12305192 TGGTCTCATCTGGAGGTGACGGG + Intergenic
1163648007 19:18501294-18501316 TGCTCTCATCCGGGTCTGCTTGG - Intronic
1165145135 19:33725795-33725817 TTCTCTCATCTGGTCGTGGTGGG + Intronic
925504471 2:4545339-4545361 TGCTCTCATACATAGTTGGTGGG + Intergenic
925666998 2:6268390-6268412 TGGTCCCATCTGGAGGTGATGGG - Intergenic
926691956 2:15742757-15742779 TGCTCTCACCTGTGGGTGGTAGG - Intronic
928239840 2:29576857-29576879 TGGTCCCATCTGGGGGTGGTGGG - Intronic
934515009 2:94981021-94981043 TGGTCTCTTCAGGAGGTGATGGG - Intergenic
935294335 2:101635689-101635711 TGGTCCCATCTGGAGGTGATGGG - Intergenic
935423407 2:102894268-102894290 TGGTCCCATCTGGAGGTGATGGG - Intergenic
938732499 2:134157739-134157761 TGGTCTCATCTGGGGGTGATGGG + Intronic
1175550798 20:59816120-59816142 TGGTCCCATCTGGAGGTGATGGG + Intronic
1177043041 21:16136154-16136176 TGGTCCCATCCAGAGGTGATGGG - Intergenic
1178604945 21:34028042-34028064 TGGTCTCATCTGGGGGTGATGGG - Intergenic
1179011367 21:37558722-37558744 TTCGCTCACACGGAGGTGGTTGG - Intergenic
1179898125 21:44374780-44374802 TGCTCACAGCAGGAGGTGGGTGG - Intronic
1179986808 21:44926816-44926838 TGCTGTCATCAGGGGTTGGTTGG + Intronic
1180036222 21:45251699-45251721 TTCTCTAATCCTGAGGAGGTGGG - Intergenic
1180819689 22:18817553-18817575 TTCTGTCATCTGCAGGTGGTTGG - Intergenic
1181205914 22:21251998-21252020 TTCTGTCATCTGCAGGTGGTTGG - Intergenic
1181278341 22:21701343-21701365 TGCACTCATCCGGCGCTGGGAGG + Intronic
1181492358 22:23268566-23268588 TGTTCTCCTCGGGAGGTGGAGGG - Intronic
1183934717 22:41255558-41255580 AGATCTCATCCTGATGTGGTGGG - Intronic
1184538834 22:45106458-45106480 TGCTCTGATATGGAGGTGGGGGG - Intergenic
1203221007 22_KI270731v1_random:43415-43437 TTCTGTCATCTGCAGGTGGTTGG + Intergenic
1203269818 22_KI270734v1_random:43406-43428 TTCTGTCATCTGCAGGTGGTTGG - Intergenic
949743812 3:7265523-7265545 TTCTGTCATCCAGAGGTGTTTGG + Intronic
950670772 3:14524198-14524220 TGCTGTCACCAGGAGGTGGTGGG - Intronic
953806797 3:46077410-46077432 TGGTCCCATCTGGAGGTGATGGG - Intergenic
956877538 3:73478442-73478464 TGGTCTCATCTGGGGGTGATGGG - Intronic
957857811 3:85900743-85900765 AGCTCTCATCCGGTGATGGAGGG + Intronic
959045038 3:101464578-101464600 TGATCCCATCTGGAGGTGATGGG - Intronic
968551598 4:1226292-1226314 TGCAATCATCCGGATGGGGTGGG - Intronic
971541098 4:27817669-27817691 TGCTTTTATCTGGAGGTGATGGG - Intergenic
971917381 4:32890515-32890537 TGGTCCCATCTGGAGGTGATAGG + Intergenic
974401719 4:61416931-61416953 TGGTCCCATCTGGAGGTGATGGG + Intronic
975625366 4:76340664-76340686 TGGTCCCATCTGGAGGTGATGGG - Intronic
975960769 4:79901737-79901759 TGGTCCCATCTGGGGGTGGTGGG + Intronic
976122710 4:81800485-81800507 TGGTCCCATCTGGAGGTGATGGG + Intronic
981527712 4:145722932-145722954 TGGTCTCATCTGGGGGTGATAGG - Intronic
992460102 5:76953087-76953109 TGCTCTGCTCCGGAGGTCCTGGG - Exonic
995952475 5:117732700-117732722 TGGTCACATCCGGGGGTGATGGG + Intergenic
996540928 5:124629619-124629641 TGTGCTCATCCAGAGGTGGGAGG + Intergenic
997859430 5:137403208-137403230 TGCTCTCAACTGGAGGTGTGAGG - Intronic
999398139 5:151243879-151243901 TTCTCTCAGCAGGAGGTGGCAGG + Intronic
1001009573 5:168085767-168085789 TGGTCACATCCAGAGATGGTGGG - Intronic
1002699721 5:181114314-181114336 TGCTCGCCTCCGGAGGGGCTGGG + Intergenic
1003193302 6:3892828-3892850 TCCTCTCATCCTGAGCTGGTTGG - Intergenic
1004192147 6:13473251-13473273 TGCTTACATCCGATGGTGGTGGG - Intronic
1004852302 6:19712648-19712670 TGGTCCCATCTGGAGGTGATGGG - Intergenic
1008820101 6:55621593-55621615 TGGTCCCATCTGGAGGTGATGGG - Intergenic
1012614543 6:101260781-101260803 TGGTCCCATCTGGAGGTGATCGG - Intergenic
1013036076 6:106384492-106384514 TGGTCTCATCTGGGGGTGATGGG + Intergenic
1013377256 6:109529668-109529690 TGGTCCCATCTGGAGGTGATGGG + Intronic
1014335076 6:120123019-120123041 TGGTCGCATCTGGAGATGGTGGG - Intergenic
1019624353 7:2008532-2008554 TGTTCTGATGCGGAGATGGTGGG + Intronic
1019705291 7:2494546-2494568 TGCTCACATCCAGAGGGGGAAGG + Intergenic
1019754940 7:2762161-2762183 AGCTCTCACCCTGAGGTGGAGGG + Intronic
1020759397 7:12249646-12249668 TGCTCTCAAGCAGAGGAGGTAGG - Intergenic
1023873273 7:44274040-44274062 TGCTCTCATCCGGAGGTGGTAGG - Intronic
1025744975 7:64234585-64234607 GGCTCTCATCTAGAGGTGCTGGG - Intronic
1025751983 7:64301818-64301840 GGCTCTCATCTAGAGGTGCTGGG + Intergenic
1026663421 7:72322160-72322182 TGGTCCCATCCGGGGGTGCTGGG + Intronic
1027345517 7:77255596-77255618 TGCTCTCACCCAGCAGTGGTGGG + Intronic
1027661961 7:80997978-80998000 TTTTCTCATCCTGAGGTGGCGGG + Intergenic
1029241704 7:99167821-99167843 TGGTCCCATCTGGAGGTGATGGG - Intergenic
1029639741 7:101813589-101813611 TGCTCTCTGCAGGGGGTGGTGGG - Intergenic
1030097121 7:105910363-105910385 TGCTCTGCTCCAGAGGTGCTTGG + Intronic
1031574728 7:123401282-123401304 TGGTCTCATCTGGCGGTGATGGG + Intergenic
1032698892 7:134361522-134361544 TGGTCCCATCCGGGGGTGATTGG + Intergenic
1033543213 7:142376177-142376199 TGCTGGCATCAGGAGGCGGTTGG + Intergenic
1034414307 7:150956693-150956715 TCTTCTCATAGGGAGGTGGTGGG - Intronic
1035791683 8:2311966-2311988 TGGTCTCATCTGGGGGTGATGGG + Intergenic
1035801122 8:2409739-2409761 TGGTCTCATCTGGGGGTGATGGG - Intergenic
1039013923 8:33125181-33125203 TGATCCCATCTGGGGGTGGTGGG - Intergenic
1041028037 8:53707065-53707087 TGGTCTCATCTGGGGGTGATGGG - Intergenic
1043050999 8:75385440-75385462 TGGTCTCATCTGGGGGTGATGGG - Intergenic
1048449271 8:134518385-134518407 TGCTCTCATACGTTGCTGGTGGG - Intronic
1049351435 8:142166871-142166893 TGCCTTCATCCTGAGGTGGGGGG + Intergenic
1055687665 9:78794679-78794701 TGGTCCCATCTGGAGGTGATGGG + Intergenic
1186204810 X:7190201-7190223 TGGTCCCATCTGGAGGTGATGGG + Intergenic
1195922354 X:109996150-109996172 TGGTCCCATCTGGAGGTGATGGG + Intergenic
1198035802 X:132800323-132800345 TGGTCCCATCTGGAGGTGATGGG - Intronic
1198518574 X:137430557-137430579 TGCTCGTTTCCGGAGGAGGTGGG - Intergenic