ID: 1023873423

View in Genome Browser
Species Human (GRCh38)
Location 7:44274710-44274732
Sequence TCTGCTGGCGGGTGGCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 2, 1: 0, 2: 6, 3: 43, 4: 304}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023873416_1023873423 -6 Left 1023873416 7:44274693-44274715 CCTTGCTGGGCCTACAGTCTGCT 0: 1
1: 0
2: 1
3: 18
4: 257
Right 1023873423 7:44274710-44274732 TCTGCTGGCGGGTGGCCTGGAGG 0: 2
1: 0
2: 6
3: 43
4: 304
1023873415_1023873423 -5 Left 1023873415 7:44274692-44274714 CCCTTGCTGGGCCTACAGTCTGC 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1023873423 7:44274710-44274732 TCTGCTGGCGGGTGGCCTGGAGG 0: 2
1: 0
2: 6
3: 43
4: 304
1023873414_1023873423 -1 Left 1023873414 7:44274688-44274710 CCTGCCCTTGCTGGGCCTACAGT 0: 1
1: 0
2: 4
3: 29
4: 328
Right 1023873423 7:44274710-44274732 TCTGCTGGCGGGTGGCCTGGAGG 0: 2
1: 0
2: 6
3: 43
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023873423 Original CRISPR TCTGCTGGCGGGTGGCCTGG AGG Intronic