ID: 1023873832

View in Genome Browser
Species Human (GRCh38)
Location 7:44276431-44276453
Sequence CCCTTTGTGCAGTGGGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 210}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023873832_1023873854 24 Left 1023873832 7:44276431-44276453 CCCGCCACCCACTGCACAAAGGG 0: 1
1: 0
2: 4
3: 39
4: 210
Right 1023873854 7:44276478-44276500 TGGGGAAAGGGGGGGCGTGCAGG 0: 1
1: 0
2: 0
3: 37
4: 525
1023873832_1023873850 13 Left 1023873832 7:44276431-44276453 CCCGCCACCCACTGCACAAAGGG 0: 1
1: 0
2: 4
3: 39
4: 210
Right 1023873850 7:44276467-44276489 AGGCTTCTGGCTGGGGAAAGGGG No data
1023873832_1023873849 12 Left 1023873832 7:44276431-44276453 CCCGCCACCCACTGCACAAAGGG 0: 1
1: 0
2: 4
3: 39
4: 210
Right 1023873849 7:44276466-44276488 CAGGCTTCTGGCTGGGGAAAGGG No data
1023873832_1023873841 -7 Left 1023873832 7:44276431-44276453 CCCGCCACCCACTGCACAAAGGG 0: 1
1: 0
2: 4
3: 39
4: 210
Right 1023873841 7:44276447-44276469 CAAAGGGGTCCCAGGCAGGCAGG 0: 1
1: 0
2: 2
3: 37
4: 333
1023873832_1023873852 15 Left 1023873832 7:44276431-44276453 CCCGCCACCCACTGCACAAAGGG 0: 1
1: 0
2: 4
3: 39
4: 210
Right 1023873852 7:44276469-44276491 GCTTCTGGCTGGGGAAAGGGGGG 0: 1
1: 0
2: 3
3: 53
4: 453
1023873832_1023873853 16 Left 1023873832 7:44276431-44276453 CCCGCCACCCACTGCACAAAGGG 0: 1
1: 0
2: 4
3: 39
4: 210
Right 1023873853 7:44276470-44276492 CTTCTGGCTGGGGAAAGGGGGGG 0: 1
1: 1
2: 24
3: 153
4: 890
1023873832_1023873847 6 Left 1023873832 7:44276431-44276453 CCCGCCACCCACTGCACAAAGGG 0: 1
1: 0
2: 4
3: 39
4: 210
Right 1023873847 7:44276460-44276482 GGCAGGCAGGCTTCTGGCTGGGG No data
1023873832_1023873845 4 Left 1023873832 7:44276431-44276453 CCCGCCACCCACTGCACAAAGGG 0: 1
1: 0
2: 4
3: 39
4: 210
Right 1023873845 7:44276458-44276480 CAGGCAGGCAGGCTTCTGGCTGG No data
1023873832_1023873848 11 Left 1023873832 7:44276431-44276453 CCCGCCACCCACTGCACAAAGGG 0: 1
1: 0
2: 4
3: 39
4: 210
Right 1023873848 7:44276465-44276487 GCAGGCTTCTGGCTGGGGAAAGG 0: 1
1: 0
2: 5
3: 45
4: 423
1023873832_1023873846 5 Left 1023873832 7:44276431-44276453 CCCGCCACCCACTGCACAAAGGG 0: 1
1: 0
2: 4
3: 39
4: 210
Right 1023873846 7:44276459-44276481 AGGCAGGCAGGCTTCTGGCTGGG 0: 1
1: 0
2: 6
3: 58
4: 408
1023873832_1023873842 0 Left 1023873832 7:44276431-44276453 CCCGCCACCCACTGCACAAAGGG 0: 1
1: 0
2: 4
3: 39
4: 210
Right 1023873842 7:44276454-44276476 GTCCCAGGCAGGCAGGCTTCTGG No data
1023873832_1023873851 14 Left 1023873832 7:44276431-44276453 CCCGCCACCCACTGCACAAAGGG 0: 1
1: 0
2: 4
3: 39
4: 210
Right 1023873851 7:44276468-44276490 GGCTTCTGGCTGGGGAAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023873832 Original CRISPR CCCTTTGTGCAGTGGGTGGC GGG (reversed) Intronic
900479479 1:2891205-2891227 CTCTTTGTGGAGGGGGTGGGGGG - Intergenic
901242201 1:7702052-7702074 CCTGTGGTGCAGTGAGTGGCAGG + Intronic
901531875 1:9858926-9858948 GCCTTAGTGCTGTGGGTGACTGG - Intronic
902747258 1:18482194-18482216 CCCCATGTGCAGCCGGTGGCCGG + Exonic
903159562 1:21476389-21476411 ACGTTTTTGCAGTGGCTGGCTGG + Intronic
908268325 1:62399659-62399681 CCCCTTGTACAGTGGGAGCCAGG - Intergenic
909319510 1:74265516-74265538 CCCTTTATGAAGAGTGTGGCAGG - Intronic
911136289 1:94444717-94444739 CCCTCAGTTCTGTGGGTGGCTGG + Intronic
912629705 1:111236102-111236124 CCCTCTGAGCAAGGGGTGGCAGG + Exonic
912666111 1:111581090-111581112 CCCTTTATGAAGTGGGATGCAGG + Intronic
914248944 1:145906391-145906413 CACGTTGGGCAGTGGGTGCCAGG + Exonic
915540939 1:156565766-156565788 CCCATTATGCAGGGGGTGGGAGG - Intronic
915807751 1:158872432-158872454 CCTGTTGTGCAGTGGGGGGGAGG + Intergenic
920764009 1:208813585-208813607 CTCTCTGTGCAGTGGGCAGCAGG - Intergenic
924153149 1:241149585-241149607 CCCTTTGTCCAGTAAATGGCTGG + Intronic
1064910257 10:20393521-20393543 CCTTGTGTGCCTTGGGTGGCTGG + Intergenic
1067163647 10:43847836-43847858 CCCATTGTTCTGTGGTTGGCTGG + Intergenic
1067683071 10:48452229-48452251 GCCTTTGTGGTGAGGGTGGCAGG - Intronic
1072436254 10:95417016-95417038 CCCTTTGTGTGGTGGTGGGCTGG - Intronic
1073293699 10:102425652-102425674 CCCTTTGTGCAGAGGGTGGGTGG - Intronic
1074104323 10:110377031-110377053 TCCTTGTTGGAGTGGGTGGCAGG - Intergenic
1075556236 10:123434573-123434595 TCCTTTGTGTGGTGGGTGGCTGG + Intergenic
1076532497 10:131154369-131154391 GCCTTTGTGTAGTGGGGGACTGG - Intronic
1077014540 11:393842-393864 CCCTTCATGCTGGGGGTGGCAGG + Intronic
1077543564 11:3159094-3159116 CCTTGTGTTCAGAGGGTGGCTGG - Intronic
1080604456 11:33853200-33853222 CACTTTGGGCAGAGGGTTGCAGG + Intergenic
1083853379 11:65380338-65380360 GCCTGTGTGGAGGGGGTGGCAGG - Intronic
1084008514 11:66335374-66335396 TCATCTGTGCAATGGGTGGCAGG + Intronic
1084409220 11:68996855-68996877 CCCTCTGAGCAGTGGGAAGCCGG + Intergenic
1085474126 11:76778868-76778890 GTCTTTGTGCAGGAGGTGGCAGG + Intergenic
1086810370 11:91302290-91302312 CCCATTGTGTAGTGGATGACTGG - Intergenic
1088364896 11:109030461-109030483 CCTTTTGTGGAGTGGGGGGGAGG - Intergenic
1089489249 11:118871618-118871640 ACCTTTGCGTTGTGGGTGGCCGG + Intergenic
1090424117 11:126595171-126595193 CCACTTGTGGAGGGGGTGGCGGG + Intronic
1091561081 12:1614047-1614069 CTCTTTGTGCAGTGGATGCTGGG + Intronic
1092926419 12:13276300-13276322 CCTTTTGGGAAGTGGGTGGGTGG + Intergenic
1095639967 12:44476454-44476476 CCCATTGGGCAGTTGGAGGCTGG - Intergenic
1096778719 12:53979719-53979741 TGCTTTGTGCAGTGGGTTGGAGG - Intergenic
1096905933 12:54935507-54935529 CAGTTTGTCCAGTGGGTGTCAGG - Intergenic
1097201193 12:57280267-57280289 TCTCTTGTGCTGTGGGTGGCAGG - Intronic
1098275616 12:68808581-68808603 GCCTTTGTGCGGTTCGTGGCTGG + Intronic
1100938580 12:99699155-99699177 GTCTGTGTGAAGTGGGTGGCAGG - Intronic
1101735453 12:107459810-107459832 CCCTGTGTGCTGTGGGTGGCAGG + Intronic
1103908016 12:124337112-124337134 CCCAGTGGGCAGTGGGTGGCAGG + Exonic
1105989310 13:25602620-25602642 GCATTTGAGCAGTGTGTGGCTGG + Intronic
1106787594 13:33122577-33122599 CCCTTTCTCAAGAGGGTGGCTGG - Intronic
1107483595 13:40805433-40805455 CTTTTTATGCAGTGGGTGGTGGG - Intronic
1107560346 13:41552202-41552224 GCCTCTGTGCAGTGAATGGCTGG + Intergenic
1108642525 13:52395923-52395945 ACTTGGGTGCAGTGGGTGGCTGG + Intronic
1109693816 13:65927551-65927573 CACTTTGGGCAGTGGGTTTCAGG + Intergenic
1109915774 13:68983552-68983574 CCCATTGTTCAGTGAGTGGGAGG + Intergenic
1110860678 13:80341779-80341801 CCCTTTGCGGAGCGGGTGACGGG + Intergenic
1112521519 13:100099675-100099697 CCCTGTTTGCAGTGGCTGGAAGG + Intronic
1113113397 13:106848645-106848667 GCCTTTCTGCAGAGGGTGGGGGG - Intergenic
1113786960 13:113006961-113006983 CCCTTGGGGGAGAGGGTGGCAGG + Intronic
1113899967 13:113791305-113791327 CACTTTCAGAAGTGGGTGGCAGG - Intronic
1114524040 14:23357158-23357180 CCCTTTAGGCCTTGGGTGGCTGG - Exonic
1114720500 14:24876070-24876092 TCATTTGTGCTGTGGGTGGAAGG + Intronic
1118346873 14:64947342-64947364 CCCTTTGTGGAGTGCATGGTTGG + Exonic
1118421742 14:65613378-65613400 CTCTTTGTGAATTAGGTGGCTGG - Intronic
1122270533 14:100566917-100566939 CCCTTAGTGCCGTGGGTGAGTGG - Intronic
1122324623 14:100874958-100874980 CCCTTTGTGCCCAGGGTGGAGGG + Intergenic
1122325611 14:100879403-100879425 GCCTTAGGGCAGTGGGAGGCGGG - Intergenic
1122773728 14:104108152-104108174 CCTTTTGTGAAGTGGGTGACTGG + Intronic
1122789669 14:104178957-104178979 CCCCTTGGGCAGTGGGTGGGTGG + Intronic
1124007283 15:25804631-25804653 ACCTGTGTGGAGTGGGTGGCCGG - Intronic
1127647289 15:60971423-60971445 CCCTAACTGCAGTGGGTGGCTGG + Intronic
1128129171 15:65214416-65214438 CTCTTTCTGTAGTGGGAGGCAGG + Intergenic
1129603881 15:77015426-77015448 CCCTTGGTGCAGTGTGTGCCAGG + Intronic
1129787021 15:78316329-78316351 CCCTCTGACCAGGGGGTGGCTGG - Intergenic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1132626348 16:893508-893530 CCCTTTGTGCCGCAGGGGGCGGG - Intronic
1133673577 16:8047877-8047899 CCATTTGTGCTGTGGCTTGCAGG + Intergenic
1135585467 16:23667439-23667461 CCCTTGGTCCTGTGGATGGCTGG + Exonic
1135830412 16:25768032-25768054 CCCATTTTACAGGGGGTGGCAGG + Intronic
1136282310 16:29221028-29221050 CCGTCTCTGCAGTGGGGGGCAGG - Intergenic
1137789386 16:51162171-51162193 CCCTTAGTGCTCAGGGTGGCTGG + Intergenic
1138724236 16:59118502-59118524 CCTTGTCTGCAGTGGGTGGGTGG + Intergenic
1139143222 16:64293308-64293330 TGCTTTGTGCAGTGGATGGAAGG + Intergenic
1142086682 16:88186946-88186968 CCGTCTCTGCAGTGGGGGGCAGG - Intergenic
1145064963 17:19755937-19755959 CCATTGGTGGTGTGGGTGGCAGG - Intergenic
1146255227 17:31388483-31388505 CCCTTTGCTTAGTGGGTGGGAGG - Intergenic
1150122592 17:62616520-62616542 CCCTTATTGCAGTAGTTGGCTGG - Intergenic
1150248539 17:63693472-63693494 CTCTTTCTGCAGTGGTGGGCAGG + Intronic
1151731777 17:75915513-75915535 CGCCTTGTGCTGTGTGTGGCTGG - Intronic
1152294142 17:79456861-79456883 CCCTGTGCTGAGTGGGTGGCTGG - Intronic
1152327285 17:79648788-79648810 CCCTGTGGCCAGTGGGTTGCGGG + Intergenic
1152877426 17:82794937-82794959 CCCTTACTGCAGATGGTGGCGGG + Intronic
1155309313 18:24508866-24508888 TCCATTGTGATGTGGGTGGCTGG - Intergenic
1159883794 18:73885120-73885142 CCCATTGTGCAGAAGCTGGCTGG + Intergenic
1160085845 18:75777067-75777089 CCCTTTGCTAAGTGGCTGGCAGG - Intergenic
1160217090 18:76941493-76941515 CCACCTGTGCAGTGGGTGGGAGG - Intronic
1160277593 18:77451837-77451859 CCCTTTGGGCAGTGGGGCACAGG + Intergenic
1160301151 18:77680055-77680077 GCCTTTGTGTAGTGAGTGACAGG + Intergenic
1160348362 18:78153167-78153189 CCCTTTGTGCCCTGGGTCTCGGG + Intergenic
1160506035 18:79427376-79427398 GCCTCTGTGCAGTGGGTTGGGGG + Intronic
1160506048 18:79427413-79427435 GCCTCTGTGCGGTGGGTGGGGGG + Intronic
1160506081 18:79427520-79427542 GCCTCTGTGCAGTGGGTGGGGGG + Intronic
1160506091 18:79427556-79427578 GCCTCTGTGCAGTGGGTCGGGGG + Intronic
1160506143 18:79427733-79427755 GCCTCTGTGCAGTGGGTGGGGGG + Intronic
1160506202 18:79427949-79427971 GCCTCTGTGCAGTGGGTGGCGGG + Intronic
1161429654 19:4224264-4224286 CCTTCTGTACAGTGGGAGGCTGG + Intronic
1161556423 19:4945170-4945192 CATTTTGTGGAGTGAGTGGCAGG + Intronic
1163695105 19:18760051-18760073 CCCCCTGTGTTGTGGGTGGCGGG - Exonic
1163722603 19:18905353-18905375 CTCTCTATGCAGTGGGTGGCAGG - Intronic
1164608674 19:29617813-29617835 CTCTTTGAGCAGTGGGTCGCTGG - Intergenic
1166668706 19:44697324-44697346 CTGTTTGTGCAGTGGGTGGGGGG - Intergenic
1166994699 19:46714531-46714553 TCCTTTGAGCATTGGGTGGCAGG - Intronic
1168345447 19:55648401-55648423 CCCTTTGTCCCGCGGGTGGGAGG - Exonic
925301234 2:2814237-2814259 CCCTTCCTGCTGTGGGTGGTGGG - Intergenic
926010540 2:9402671-9402693 CTTTTTGTGGAGTGGGTGGGGGG - Intronic
927211595 2:20642265-20642287 CCCTTGGTGCAGGGTGTGTCTGG + Intronic
928125153 2:28610566-28610588 CCATGTGTGCAATGAGTGGCTGG - Intronic
930443418 2:51438199-51438221 CTGTGTGTGCAGTGGGTGGAGGG + Intergenic
932401481 2:71483551-71483573 CCCTGTGAGAAGTGGGTGGTGGG + Intronic
942875173 2:180786492-180786514 CCTTTTGTGGGGTGGGGGGCAGG + Intergenic
946836338 2:223776384-223776406 CCCATTGTGAAGTGGGAGGGTGG - Intronic
947005795 2:225509585-225509607 CCCCTTGTGTAGTGGGTAACGGG - Intronic
947615496 2:231554535-231554557 CCCTGTGTGCAGTTGGTGCTGGG - Intergenic
948082350 2:235216595-235216617 CCCACTGTGGAGTGGGAGGCAGG + Intergenic
948396338 2:237647833-237647855 CCCTGCGTGCAGTGAGTGGCCGG - Intronic
1171233951 20:23509539-23509561 CCCTGTCTGAAGTGGGAGGCAGG - Intergenic
1172181721 20:33007837-33007859 ACCCTTCTGCAGAGGGTGGCTGG - Intronic
1173443389 20:43096808-43096830 CCCTCTGGGATGTGGGTGGCAGG + Intronic
1174670556 20:52303748-52303770 CCATTTTGGCAGTGGGTGGCGGG - Intergenic
1175213253 20:57375086-57375108 CACTTTATGAAGGGGGTGGCAGG + Intronic
1176020625 20:62960814-62960836 GCCTTTCTGGAGTGGCTGGCAGG + Intronic
1178919065 21:36726728-36726750 CCCTGTGTGCGGTGTGTGGGGGG + Intronic
1179503685 21:41825539-41825561 TCCTCCGTGCAGTGGATGGCTGG - Intronic
1179514404 21:41897071-41897093 CCCTTTGGGGACTGGGTGTCGGG - Intronic
1180091599 21:45536386-45536408 CCATCTGGTCAGTGGGTGGCAGG + Intronic
1180593552 22:16959911-16959933 CCATCTGTGGAGTGGGTGGTTGG - Intergenic
1180945258 22:19689024-19689046 GCCTGTGAGCAGAGGGTGGCAGG - Intergenic
1181177575 22:21046300-21046322 CCCTTGGTGCACTGTCTGGCGGG - Intronic
1184252863 22:43270864-43270886 CCCTTTGGGCACTGGGTGCAGGG - Intronic
1184345023 22:43907883-43907905 CCCAGTCTGCAGTGAGTGGCTGG + Intergenic
1184357000 22:43988618-43988640 CTCGCTGTGCAGTGGGTGGCAGG + Intronic
1184503383 22:44887257-44887279 CCCTGAGTGTGGTGGGTGGCGGG - Intronic
1185383952 22:50523095-50523117 CCCTTTGCGGAGCTGGTGGCTGG + Exonic
949999296 3:9644209-9644231 CCTGTTGTGGGGTGGGTGGCTGG + Intergenic
950331225 3:12157760-12157782 CCGTTTGTGCAGTGGGGCACAGG + Intronic
953381321 3:42474745-42474767 CCCTATGAGAAGGGGGTGGCTGG - Intergenic
953553205 3:43921141-43921163 ACATTTGTGCGGTGGGGGGCTGG + Intergenic
954590024 3:51775332-51775354 CTCCGTGTGCAGAGGGTGGCAGG - Intergenic
956048073 3:65217822-65217844 CCTGTTGTGGAGTGGGTGGAAGG - Intergenic
957632475 3:82735034-82735056 TCCTTTGTTAAGTGGGTTGCAGG - Intergenic
958943002 3:100335158-100335180 ACCTTTGTGCAGGGCGGGGCTGG - Intronic
960561016 3:119084323-119084345 CCCTAAGTGCAGTTGGAGGCAGG - Intronic
960986496 3:123284529-123284551 CTCTGTGTGCCGGGGGTGGCGGG - Exonic
961115208 3:124323394-124323416 CCCTGTGGGCAGGGGGTGGATGG + Intronic
961817810 3:129560287-129560309 CCCTCTGTGCAGTGGGTACAAGG - Intronic
963069925 3:141295688-141295710 CCTGTTGTGGAGTGGGGGGCTGG - Intergenic
963199157 3:142568950-142568972 GCCTCGGTGTAGTGGGTGGCAGG + Intronic
963835850 3:150057134-150057156 CCCTGTGTTCAGTTTGTGGCAGG - Intergenic
964620276 3:158714253-158714275 CCCATTGGGCTATGGGTGGCAGG - Intronic
967282304 3:187834042-187834064 CCCTGTGTGAAGAAGGTGGCTGG + Intergenic
968595642 4:1481015-1481037 CCCCTTCTACACTGGGTGGCAGG - Intergenic
969861704 4:10041040-10041062 CCCTTTGTGCCTTGAGTGGGAGG + Intronic
971867539 4:32191391-32191413 CCTGTTGTGCAGTGGGGGGAGGG + Intergenic
972694599 4:41433478-41433500 CCCTGTGTTCAGTTGGTGCCGGG + Intronic
975058502 4:69966799-69966821 GCCTCTGTGCTGTGTGTGGCAGG + Intergenic
975596826 4:76055248-76055270 GTATTTGTGCAGTTGGTGGCTGG + Intronic
978441319 4:108737270-108737292 CACTTTGTGAAGAGGGTGGAGGG - Intergenic
979199294 4:117957648-117957670 CCATTTGTCCAGGTGGTGGCTGG - Intergenic
981589248 4:146339584-146339606 CTCTTTGTGTTGGGGGTGGCAGG - Intronic
982274960 4:153629157-153629179 CACTATGTGAAGTGGGTGGTGGG - Intronic
982828709 4:160031940-160031962 CCCGTAGGGCAGTGGGGGGCTGG - Intergenic
983411488 4:167403724-167403746 CCCGTTGTGGGGTGGGGGGCGGG + Intergenic
984113041 4:175643925-175643947 CCGCATGTGCAGTGGGTGGCCGG - Intronic
984639067 4:182143660-182143682 CCTTTTCTGCTGCGGGTGGCGGG - Intergenic
985515490 5:342802-342824 CCCTCTCTGAGGTGGGTGGCAGG + Intronic
986195122 5:5531333-5531355 TCCCTTGTGCTGTGGGAGGCTGG + Intergenic
986231677 5:5869965-5869987 CCCGTTGTGCGGTGGGGGGAGGG + Intergenic
986243435 5:5982233-5982255 AGGGTTGTGCAGTGGGTGGCTGG + Intergenic
987115209 5:14721025-14721047 CCTTTGGAGCAGTGGGTGGGGGG + Intronic
988943346 5:36168437-36168459 CCCATTGTCAAGTGAGTGGCAGG + Exonic
989259818 5:39406265-39406287 GCCTTGGTGCAGTGGCTGGTGGG + Intronic
994087117 5:95771452-95771474 CCCTGTGTGCAGTGTGAGCCTGG + Intronic
997215165 5:132103937-132103959 TCCTTTCTGCAGTGGGTGGGGGG - Intergenic
997714146 5:136029487-136029509 CCCTTTCTGCAGTGGCTGGGAGG - Intronic
1002027389 5:176404749-176404771 CCCTTTGTGCAGCAGGTCCCGGG + Intronic
1002194391 5:177494466-177494488 CCCTGTGGGCAGGGAGTGGCTGG - Intronic
1003162337 6:3646789-3646811 CCATGTGCGAAGTGGGTGGCCGG + Intergenic
1004840336 6:19576746-19576768 CCTGTTGTGCAGTGGGGGGAGGG + Intergenic
1005424141 6:25683442-25683464 CCCTGTGTGCCCTGGGAGGCTGG + Intronic
1006392577 6:33767278-33767300 CCCTTTGGGCAGTGTGTGGTGGG + Intergenic
1007282215 6:40721007-40721029 CCATCTGAGCAGTGGCTGGCAGG - Intergenic
1007634157 6:43287895-43287917 CCCTTCGTGCACGGTGTGGCTGG - Exonic
1007936012 6:45732690-45732712 CTCATTGTTCAGTGGGGGGCAGG - Intergenic
1009446961 6:63754340-63754362 CCTGTTGTGGAGTGGGGGGCTGG - Intronic
1009999527 6:70934385-70934407 CCCTTTGTGAAGTGGGAGAAGGG - Intronic
1013173019 6:107654655-107654677 TCCTCTGTGCAGTGGGGGCCTGG - Intronic
1016506049 6:144780706-144780728 CCCCTTGGGCAGTGTGTGCCTGG + Intronic
1018712272 6:166505656-166505678 CCCTGTGTGAAGCGGGTGCCCGG - Intronic
1019434955 7:1017799-1017821 CCTTGTGTGCAGTGGGGGGCGGG - Intronic
1022839166 7:34146400-34146422 TCCTTTGTGCCATAGGTGGCGGG - Intronic
1023381657 7:39614240-39614262 CCCCTTGAGGGGTGGGTGGCAGG + Intergenic
1023873832 7:44276431-44276453 CCCTTTGTGCAGTGGGTGGCGGG - Intronic
1024034758 7:45497769-45497791 CCCTTTGTACAGTTGGTGATGGG + Intergenic
1026105328 7:67416523-67416545 CTCTTTGTGCAGTGGGAGGCTGG + Intergenic
1027539178 7:79446159-79446181 CCTGTTGTGCAGTGGGAGGAGGG + Intronic
1028469028 7:91184832-91184854 CCCTGTATGCAGTTGGGGGCAGG + Intronic
1028631232 7:92936059-92936081 AACCTTGTGCAGTGGGTTGCAGG - Intergenic
1029250365 7:99232243-99232265 CCATCTGTAAAGTGGGTGGCTGG - Intergenic
1029595496 7:101535535-101535557 CCCTTGGTGGAGAGGGTGTCAGG - Intronic
1034056789 7:148043914-148043936 CCCTTTGTGCAATGAGGGGCAGG - Intronic
1034202174 7:149289571-149289593 CCCAGTGTGCTGTGGGAGGCAGG + Intronic
1034633864 7:152551903-152551925 GACTCAGTGCAGTGGGTGGCAGG + Intergenic
1036648145 8:10625004-10625026 CACTTTGTCCAGTGGATGACAGG + Intronic
1039140979 8:34387984-34388006 CCTGTTGTGGAGTGGGGGGCAGG - Intergenic
1039454799 8:37699357-37699379 CCCTATGCGCGGAGGGTGGCGGG - Exonic
1041036943 8:53801868-53801890 CAGTATGTGCAGTGCGTGGCCGG - Exonic
1042613793 8:70626821-70626843 CCTGTTGTGGGGTGGGTGGCTGG - Intronic
1042893209 8:73636002-73636024 ACTTTTCTGCATTGGGTGGCAGG - Intronic
1043890397 8:85646869-85646891 ACCTTTTTACAGTGGGTGGCAGG + Intergenic
1043892013 8:85659059-85659081 ACCTTTTTACAGTGGGTGGCAGG + Intergenic
1043894091 8:85723638-85723660 ACCTTTTTACAGTGGGTGGCAGG - Intergenic
1043894448 8:85726723-85726745 ACCTTTTTACAGTGGGTGGCAGG - Intergenic
1043894804 8:85729808-85729830 ACCTTTTTACAGTGGGTGGCAGG - Intergenic
1043895160 8:85732893-85732915 ACCTTTTTACAGTGGGTGGCAGG - Intergenic
1043897516 8:85748915-85748937 ACCTTTTTACAGTGGGTGGCAGG + Intergenic
1043897872 8:85752003-85752025 ACCTTTTTACAGTGGGTGGCAGG + Intergenic
1043898228 8:85755088-85755110 ACCTTTTTACAGTGGGTGGCAGG + Intergenic
1043899842 8:85767283-85767305 ACCTTTTTACAGTGGGTGGCAGG + Intergenic
1043901449 8:85779476-85779498 ACCTTTTTACAGTGGGTGGCAGG + Intergenic
1043901804 8:85782561-85782583 ACCTTTTTACAGTGGGTGGCAGG + Intergenic
1043903415 8:85794751-85794773 ACCTTTTTACAGTGGGTGGCAGG + Intergenic
1043905025 8:85806944-85806966 ACCTTTTTACAGTGGGTGGCAGG + Intergenic
1043906636 8:85819135-85819157 ACCTTTTTACAGTGGGTGGCAGG + Intergenic
1045205545 8:100035951-100035973 CCTGTTGTGGAGTGGGGGGCTGG + Intronic
1048560991 8:135537116-135537138 GCCCTCGTGCAGTAGGTGGCAGG + Intronic
1048589025 8:135803818-135803840 CCTGTTGTGCAGTGGGGGCCGGG - Intergenic
1049362999 8:142221374-142221396 CCATTTGGGAAGTGTGTGGCGGG - Intronic
1049423767 8:142528263-142528285 CGCTTTGTGCAGACGGAGGCAGG + Intronic
1049492293 8:142911848-142911870 CCATTTGTGCAGGAGCTGGCTGG + Exonic
1050461724 9:5883002-5883024 CCTGTTGTGGAGTGGGGGGCTGG + Intronic
1055489217 9:76787795-76787817 TCCTGTGGGCAGTGGGAGGCGGG - Intronic
1056707610 9:88965416-88965438 CCCCTTCAGCAGTGGGAGGCAGG + Intergenic
1061015338 9:127978081-127978103 CCCCTTGTGGTGGGGGTGGCTGG - Intronic
1061498624 9:130989962-130989984 GACTCTGTGCAGTGGGTGCCTGG - Intergenic
1062145155 9:134984972-134984994 CCATGTGTGCAGAGGGTGTCTGG + Intergenic
1062278963 9:135743571-135743593 CCCATGGTGCAGAGGGTGACGGG + Intronic
1062415817 9:136449117-136449139 CCCTTTGAGAAGTGGAAGGCGGG + Intronic
1186878257 X:13838684-13838706 CCCTTTGGGCAGGGGAAGGCAGG - Intronic
1187149639 X:16669771-16669793 CCCACTGTGCAGTGGATGGCTGG - Intronic
1189267218 X:39726055-39726077 CCCTGTGTGCAGGGGCTGGCAGG + Intergenic
1189379220 X:40489890-40489912 TCCTTTTTGCAGTGAGGGGCTGG + Intergenic
1189600175 X:42615677-42615699 AACTTTGTGCTGTTGGTGGCGGG - Intergenic
1192095532 X:68206823-68206845 CCCTGTGTGCAGTAGGTAGGTGG - Intronic
1194609172 X:96019583-96019605 CACCTTGTTCAGAGGGTGGCAGG - Intergenic
1197926368 X:131650764-131650786 CCCTTTCTGCAGTAGGCAGCAGG + Intergenic
1199840193 X:151638287-151638309 CCTTTTGGGGAGTGGGGGGCTGG + Intronic
1201916313 Y:19185276-19185298 CCTGTTGTGCAGTGGGGGGAAGG - Intergenic