ID: 1023876757

View in Genome Browser
Species Human (GRCh38)
Location 7:44290377-44290399
Sequence AGGTCCTTCTGGAAGAGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023876748_1023876757 2 Left 1023876748 7:44290352-44290374 CCTCCCCGCTCAGGTCCTCCAGA 0: 1
1: 0
2: 1
3: 19
4: 206
Right 1023876757 7:44290377-44290399 AGGTCCTTCTGGAAGAGTCTGGG No data
1023876747_1023876757 3 Left 1023876747 7:44290351-44290373 CCCTCCCCGCTCAGGTCCTCCAG 0: 1
1: 1
2: 2
3: 46
4: 320
Right 1023876757 7:44290377-44290399 AGGTCCTTCTGGAAGAGTCTGGG No data
1023876750_1023876757 -2 Left 1023876750 7:44290356-44290378 CCCGCTCAGGTCCTCCAGAGCAG 0: 1
1: 0
2: 0
3: 29
4: 254
Right 1023876757 7:44290377-44290399 AGGTCCTTCTGGAAGAGTCTGGG No data
1023876746_1023876757 4 Left 1023876746 7:44290350-44290372 CCCCTCCCCGCTCAGGTCCTCCA 0: 1
1: 0
2: 3
3: 40
4: 372
Right 1023876757 7:44290377-44290399 AGGTCCTTCTGGAAGAGTCTGGG No data
1023876749_1023876757 -1 Left 1023876749 7:44290355-44290377 CCCCGCTCAGGTCCTCCAGAGCA 0: 1
1: 0
2: 0
3: 19
4: 166
Right 1023876757 7:44290377-44290399 AGGTCCTTCTGGAAGAGTCTGGG No data
1023876745_1023876757 5 Left 1023876745 7:44290349-44290371 CCCCCTCCCCGCTCAGGTCCTCC 0: 1
1: 0
2: 5
3: 80
4: 678
Right 1023876757 7:44290377-44290399 AGGTCCTTCTGGAAGAGTCTGGG No data
1023876751_1023876757 -3 Left 1023876751 7:44290357-44290379 CCGCTCAGGTCCTCCAGAGCAGG 0: 1
1: 0
2: 3
3: 18
4: 282
Right 1023876757 7:44290377-44290399 AGGTCCTTCTGGAAGAGTCTGGG No data
1023876742_1023876757 23 Left 1023876742 7:44290331-44290353 CCCTAGTAGCAAGCACAGCCCCC 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1023876757 7:44290377-44290399 AGGTCCTTCTGGAAGAGTCTGGG No data
1023876743_1023876757 22 Left 1023876743 7:44290332-44290354 CCTAGTAGCAAGCACAGCCCCCT 0: 1
1: 0
2: 1
3: 14
4: 163
Right 1023876757 7:44290377-44290399 AGGTCCTTCTGGAAGAGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023876757 Original CRISPR AGGTCCTTCTGGAAGAGTCT GGG Intronic
No off target data available for this crispr