ID: 1023877087

View in Genome Browser
Species Human (GRCh38)
Location 7:44292609-44292631
Sequence GACTTCTCAGGGCCTTGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 2, 2: 4, 3: 24, 4: 162}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023877083_1023877087 -6 Left 1023877083 7:44292592-44292614 CCTTTCTTTAACTGCAGGACTTC 0: 1
1: 0
2: 0
3: 28
4: 377
Right 1023877087 7:44292609-44292631 GACTTCTCAGGGCCTTGAATGGG 0: 1
1: 2
2: 4
3: 24
4: 162
1023877082_1023877087 -2 Left 1023877082 7:44292588-44292610 CCTTCCTTTCTTTAACTGCAGGA 0: 1
1: 0
2: 0
3: 28
4: 289
Right 1023877087 7:44292609-44292631 GACTTCTCAGGGCCTTGAATGGG 0: 1
1: 2
2: 4
3: 24
4: 162
1023877079_1023877087 23 Left 1023877079 7:44292563-44292585 CCAGTAGGTTAGACAGTGTTTCC 0: 1
1: 0
2: 0
3: 12
4: 84
Right 1023877087 7:44292609-44292631 GACTTCTCAGGGCCTTGAATGGG 0: 1
1: 2
2: 4
3: 24
4: 162
1023877080_1023877087 2 Left 1023877080 7:44292584-44292606 CCTTCCTTCCTTTCTTTAACTGC 0: 1
1: 0
2: 8
3: 191
4: 2321
Right 1023877087 7:44292609-44292631 GACTTCTCAGGGCCTTGAATGGG 0: 1
1: 2
2: 4
3: 24
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023877087 Original CRISPR GACTTCTCAGGGCCTTGAAT GGG Intronic
902112572 1:14094992-14095014 AGCTTCAGAGGGCCTTGAATGGG - Intergenic
902212996 1:14917143-14917165 GACTTCTGTGGGCCTTTCATGGG - Intronic
905066336 1:35187440-35187462 CACTGCTCCCGGCCTTGAATAGG - Intronic
906957102 1:50383450-50383472 GACATCTCATGTCCATGAATTGG - Intergenic
910081108 1:83342618-83342640 GACTTCTCAGGGCCTTTAATGGG + Intergenic
914315891 1:146511313-146511335 CCATTCTCAGGGCATTGAATTGG + Intergenic
914498464 1:148222048-148222070 CCATTCTCAGGGCATTGAATTGG - Intergenic
915024948 1:152818871-152818893 GACCAGTCAGGGCCTTGAAGGGG - Intergenic
915500881 1:156316433-156316455 GACTTCACATGGCCATGAGTTGG - Intronic
916470892 1:165121126-165121148 GACTTATCAGAGCCTTAAATAGG - Intergenic
921188003 1:212686247-212686269 GACTTCTGAAGGCCTAGAAGTGG + Intergenic
922914113 1:229241443-229241465 GACTGTTCAGGGCCCTGATTTGG - Intergenic
923036194 1:230286834-230286856 GGCTTCTCAGGCCCTGGAATGGG + Intergenic
923930941 1:238695941-238695963 GGGTTCCCAGGGCCTTGAAGGGG + Intergenic
1066071525 10:31819565-31819587 GGCTTCTCAGGGCCTAGATTTGG - Intronic
1068409927 10:56641492-56641514 GACATCCCATGGCCATGAATAGG - Intergenic
1070680004 10:78442323-78442345 GATTTCTCAGAGACTTTAATAGG - Intergenic
1070785668 10:79160905-79160927 GACTGTTCACGGCCTTGCATCGG + Intronic
1073158810 10:101371730-101371752 AACTTCTCACGGACTTGAAGAGG - Intronic
1073575140 10:104616530-104616552 CACTTCTCAGAGCCTTGAATAGG - Intergenic
1074858343 10:117490108-117490130 AACTTCTCAGGCTGTTGAATTGG + Intergenic
1076081871 10:127589582-127589604 GACTGCTCAGAGCCTTAAAGGGG - Intergenic
1076753101 10:132553557-132553579 GCCTTCTCAGAGCCTTGATGTGG + Intronic
1078627814 11:12973767-12973789 GACTTCTAAGGGTCATGAACAGG - Intergenic
1080868589 11:36216399-36216421 GACTTGTCAGAGCCTTTACTAGG - Intronic
1081770722 11:45649330-45649352 GACTTCTCAAGCTTTTGAATGGG - Exonic
1082821765 11:57548881-57548903 GAATTCTCAGAGCCTGGAAGAGG + Intronic
1082939998 11:58694579-58694601 GTCTTCTCAGGACCTTGGATTGG + Intronic
1085261110 11:75205203-75205225 GACTTGGCAGGGCCTTCAAGAGG + Exonic
1085439521 11:76545932-76545954 GTCTTCTCAGAGGCCTGAATGGG - Exonic
1088711274 11:112511137-112511159 GAACTCTCGGGGCTTTGAATTGG - Intergenic
1089129567 11:116201117-116201139 CACTTCTCAGGGTCTTGCAAAGG - Intergenic
1090349527 11:126098678-126098700 GACATCTGAGGGCCAGGAATGGG - Intergenic
1090789341 11:130076919-130076941 GACTTCTCAGGGCCTGCTTTTGG + Intronic
1091296681 11:134478631-134478653 GACTTCTCAGAGAGTTGAATGGG + Intergenic
1092420849 12:8330464-8330486 AACTTCTCTGTGCCTGGAATGGG + Intergenic
1094034531 12:26053550-26053572 GACTTCTCTGAGACTTTAATAGG - Intronic
1094406215 12:30119013-30119035 GTCTTCTCAAGTACTTGAATAGG - Intergenic
1096387823 12:51206620-51206642 GATTTCTCAGGGCCTGGGTTTGG - Intronic
1099743866 12:86676968-86676990 GACTACACAGGTCCTTCAATAGG - Intronic
1101292698 12:103387839-103387861 GACGTCTCAGGACTTTGAAAAGG - Intronic
1106769914 13:32952040-32952062 GAGTTCTCAGGGCCTCTCATAGG - Intergenic
1107716133 13:43201357-43201379 GAATTCTTAGAGCCTTCAATAGG + Intergenic
1108695192 13:52896924-52896946 GAATTGTCAGGGCCTGGAAAAGG + Intergenic
1110189450 13:72714559-72714581 TAGTTCTCAGGGCCTGTAATGGG - Intronic
1114614791 14:24062644-24062666 CACCTCCCAGGGCCTTGAAGGGG - Intronic
1119266875 14:73267948-73267970 CACTTCTCAGGGCCTGCAGTGGG + Intronic
1119996563 14:79260414-79260436 TAGTTCTCTGGGCCTTAAATGGG - Intronic
1121774907 14:96584212-96584234 GAGTTCTCTGGGCCTGGTATAGG - Intergenic
1126738490 15:51754750-51754772 GACTTTTCAGAGCCTTTCATGGG + Intronic
1128215799 15:65933279-65933301 GACCTCTGAGGGCCTTGGACTGG + Intronic
1130986924 15:88850649-88850671 CACTGCTCCTGGCCTTGAATTGG - Intronic
1132574254 16:657362-657384 GTCTCCTCAGGGCCTTGACAAGG - Intronic
1133174658 16:4005134-4005156 GACTTCTCGGAGCCTTCACTAGG - Intronic
1133921227 16:10155016-10155038 GACTTCTCAGAGCTTTGAAGAGG + Intronic
1138316051 16:56071307-56071329 AACTTTTCAGGTCCTTGAATGGG + Intergenic
1138378790 16:56585811-56585833 GATTTGTCAGGGACTTAAATGGG - Intergenic
1138531422 16:57636376-57636398 GACTTCTCAGAGCCTTTATCGGG + Intronic
1140421309 16:74821625-74821647 GATTTTTCAGGACCTTTAATAGG - Intergenic
1141168687 16:81677544-81677566 GACTTGTCAGAGCCTTGACCTGG - Intronic
1143015859 17:3890875-3890897 GACTTCTAAGGGGTTTGACTTGG - Intronic
1143581708 17:7831380-7831402 GCCTGCTCAGGTCCTTGAGTTGG + Exonic
1146448697 17:32954404-32954426 GACCTCTCTGCGCCTTGAGTTGG - Intergenic
1146827714 17:36037836-36037858 GGCTTCTCAGTCCCTTGACTTGG - Intergenic
1148955656 17:51351600-51351622 GACTTCTCAAGGTCTTTAAATGG + Intergenic
1149757454 17:59199334-59199356 CACTTCTTAGTTCCTTGAATAGG - Intronic
1150170182 17:62986451-62986473 TACTTCTCTGGCCCTTGATTTGG + Intergenic
1151924615 17:77185815-77185837 AAATTCTTAGGGCTTTGAATGGG + Intronic
1153130055 18:1845148-1845170 GACTTCTCAAGCCCCTTAATAGG - Intergenic
1153937384 18:9941067-9941089 GTTTTCTCAGAGCCTTTAATAGG - Intronic
1156844931 18:41654738-41654760 GACTTCTCAGGACCTTTAATAGG + Intergenic
1160259173 18:77275130-77275152 GCCTCCTGAGGGCCTTGCATGGG + Exonic
1161748928 19:6080026-6080048 GAATCCTCAGAGCCTAGAATGGG - Intronic
1161985102 19:7648734-7648756 GACTTATCAGGGCCTTCGGTGGG + Intergenic
1163633797 19:18429426-18429448 AACTGCTCAGGGCCTAGAGTTGG + Intronic
1164694856 19:30235771-30235793 GACTTCCCAGCCCCTTCAATAGG - Intronic
1165121717 19:33563908-33563930 AAGTTCTTAGGGCCTTGAACTGG + Intergenic
925547928 2:5038522-5038544 CACTTCTCAGGGCCTTCTTTTGG - Intergenic
926112523 2:10192310-10192332 GACTTCTCAGAGCCTTTAATGGG + Intronic
927304912 2:21559908-21559930 TACTTCTCTGGGCCTTCAAGAGG - Intergenic
927551362 2:24002932-24002954 GACTTCACAGTGCCCTGAATGGG + Exonic
932127862 2:69160729-69160751 GACTTCTCAGAGTCATTAATAGG + Intronic
933240802 2:79918323-79918345 GACTTTTCATGGCCTAGACTTGG + Intronic
936737920 2:115468890-115468912 CACTTCTCAGGCCACTGAATGGG + Intronic
938192745 2:129298428-129298450 CAATTCTCAGGGCCCTGAAAAGG - Intergenic
940550121 2:155143253-155143275 GAAATCTCAGGGCCTTGTAGCGG + Intergenic
944583822 2:201156267-201156289 GAATTCTCAGAGCCTTTAATAGG - Intronic
946455206 2:219819950-219819972 TACTTCTCAGGGACTTATATGGG + Intergenic
946635641 2:221722708-221722730 GACATCTCATGCTCTTGAATTGG - Intergenic
946680663 2:222211799-222211821 GACTTGTCAGGGCCTTTAGTAGG + Intronic
947665201 2:231901035-231901057 AACTCCTCAGGGCGTGGAATGGG - Intergenic
947932170 2:233973170-233973192 GACTTCCCAGGGCAGTGCATGGG - Intronic
948723208 2:239916628-239916650 GACTTCTCAGCCTCTGGAATGGG - Intronic
948784245 2:240343227-240343249 GACTTCTCATGGCCTAGGCTGGG - Intergenic
1174853423 20:54019334-54019356 GACTTCTCAGAGCCTTTAGTAGG + Intronic
1175459998 20:59145410-59145432 GACTTCTCAGAGCCTTTACCTGG + Intergenic
1176263951 20:64198897-64198919 CACCTCGCAGGGCCTTGGATCGG - Exonic
1176365228 21:6028800-6028822 GATTTCTCAGAGCCTTTAACTGG - Intergenic
1178123121 21:29489586-29489608 GACTTTTCTGGGCCTCGAGTGGG + Intronic
1179032745 21:37734803-37734825 GATTTCTCAGAGCCCTTAATAGG - Intronic
1179758290 21:43509745-43509767 GATTTCTCAGAGCCTTTAACTGG + Intergenic
1180863993 22:19105447-19105469 GAATAATAAGGGCCTTGAATGGG + Intronic
1181922698 22:26333156-26333178 GGCTGCTCAGGCCCTTGAAGGGG + Intronic
1183115126 22:35685967-35685989 GAGCTCTCAGGGTCATGAATCGG - Intergenic
1184381675 22:44148657-44148679 GACTTGTCAGAACCTTTAATAGG + Intronic
1184691904 22:46121254-46121276 GCCTTGTCAGAGCCTTCAATAGG - Intergenic
949170901 3:995197-995219 GACTTCCCAGGGTCTAGAACTGG + Intergenic
949866585 3:8552411-8552433 AACTTCTCAGAGCCTTTAGTAGG + Intronic
950015040 3:9749495-9749517 GACGCCTAAAGGCCTTGAATGGG + Intergenic
950271531 3:11619950-11619972 GACTTTTCAGGGAATTGACTGGG + Intronic
950480555 3:13241121-13241143 GACTTCTCAGAGCCTGCAGTGGG - Intergenic
950484494 3:13265062-13265084 CACTTCTCAGGGGCTGGAAATGG - Intergenic
950499749 3:13356085-13356107 GACTGATTAGGGGCTTGAATGGG - Intronic
953906057 3:46868749-46868771 GACTTCTCAGGGGCCTGGACTGG + Intronic
954696818 3:52431976-52431998 GACTTCTCAGGGCCTTCACAGGG + Intergenic
955013055 3:55038619-55038641 GACTTCTCAGGGTCTTTAACAGG - Intronic
955082589 3:55671945-55671967 GCCTTCTCAGAGCCTTCAATAGG - Intronic
960913923 3:122678752-122678774 GTCTTCTCAGGGCCTGGGGTGGG - Intergenic
962346937 3:134625374-134625396 GACTTCTCAGAGTCTACAATAGG - Intronic
962750734 3:138433319-138433341 GACTTCTCAGAGCCTTTACTAGG + Intergenic
963287510 3:143447585-143447607 GCCTTTTCTGGGCCTTGAAATGG - Intronic
963933135 3:151024916-151024938 GAGGTCTCAGTGCCTTGTATGGG - Intergenic
963941659 3:151101857-151101879 GACTGATCAGGGCTTTAAATAGG + Intronic
965729208 3:171752940-171752962 GTCTTCTCAGTGCATTGAAGAGG - Intronic
967407678 3:189135626-189135648 GATTGCTCAGAGCCTTTAATAGG + Intronic
973269980 4:48252986-48253008 CATTTCTCAGGGGCTTTAATAGG + Intronic
978559799 4:110021203-110021225 GATTGCTCAGAGCCTTGAAGTGG + Intergenic
979963587 4:127050601-127050623 GAGTTCTAAGGGCCTTAACTAGG - Intergenic
980159970 4:129149118-129149140 GACATTTCAAGGCCTTTAATTGG + Intergenic
980950113 4:139366940-139366962 GACTTCTGAAGGCCTTGAAATGG - Intronic
981557691 4:146013188-146013210 GACTTCTCAGAACCTGCAATGGG + Intergenic
981914792 4:150022143-150022165 GACTTCTCATGCCTTTGATTAGG + Intergenic
984104675 4:175530249-175530271 GACTTCTCAGAGCTTTTAATAGG - Intergenic
985119720 4:186627903-186627925 GGCTTCTCAGAGCCTTGAACTGG + Intronic
986021610 5:3809490-3809512 CACTTCTCAAGGCCTTAGATGGG + Intergenic
986937404 5:12906310-12906332 GAAATCTCTGGGCCTTGACTGGG + Intergenic
987824283 5:23008364-23008386 AAGTTCTCATGGCCTGGAATTGG + Intergenic
988498861 5:31767357-31767379 GACTTCTCAGAGACTTCAACAGG + Intronic
988670326 5:33374666-33374688 GCCATCTCAGAGTCTTGAATAGG + Intergenic
993401899 5:87463814-87463836 GACTTCTCAGGCTCATGGATTGG - Intergenic
993900783 5:93583049-93583071 GACTGGTCAGAGCCCTGAATCGG - Intergenic
996160155 5:120151959-120151981 TACTGCTCAGGGCATTGAAAGGG - Intergenic
997584472 5:135036037-135036059 CACTTCTCAGGGGTTTGGATTGG + Intronic
1001297411 5:170507982-170508004 CACTGCTCCTGGCCTTGAATGGG + Intronic
1007822528 6:44571193-44571215 AACTTCTCAGAGCCTTTCATAGG - Intergenic
1011282019 6:85687056-85687078 GACTTCTCTGTGCCCTGAACAGG + Intergenic
1013289028 6:108705086-108705108 GACTTCTCAGGGCCTTTCAAAGG - Intergenic
1017254056 6:152313389-152313411 GACTTCGTAGGGGCCTGAATAGG - Intronic
1018448974 6:163887751-163887773 GAATTCACAGGGCATTGAATAGG + Intergenic
1019510041 7:1413152-1413174 GACTTCGCAGGGTCTTGGAGGGG + Intergenic
1019934353 7:4244678-4244700 CTCTGCTCAGGGCCTTGCATGGG + Intronic
1023347568 7:39287038-39287060 GACTTTTCAGAGCTTTTAATAGG + Intronic
1023627555 7:42131233-42131255 GACTTCTCAGGAGAATGAATTGG + Intronic
1023663215 7:42492223-42492245 GATTTCTCAGAGCCTTTAATAGG + Intergenic
1023819904 7:43974914-43974936 GACCTCTCAGGGCCTGGGAAGGG - Intergenic
1023877087 7:44292609-44292631 GACTTCTCAGGGCCTTGAATGGG + Intronic
1024871679 7:53970572-53970594 GACTTCTCCTGTCCTTGAACTGG - Intergenic
1027298581 7:76804878-76804900 GGCTTCTCAGAGCCTTTAATGGG + Intergenic
1028983243 7:96989879-96989901 CAATTCTCAGGGCCAAGAATAGG + Intergenic
1029748179 7:102528367-102528389 GACCTCTCAGGGCCTGGGAAGGG - Intergenic
1029766126 7:102627454-102627476 GACCTCTCAGGGCCTGGGAAGGG - Intronic
1029838620 7:103338997-103339019 GACTTCTCAGAGCCTTTCTTAGG - Intronic
1031115191 7:117659556-117659578 GATGTCTGAGGGCCTTGACTGGG + Intronic
1033864487 7:145672255-145672277 GACTGCTCAGGGGCCAGAATAGG + Intergenic
1034386209 7:150743305-150743327 CACTTCTCAGGGACCTGCATGGG - Exonic
1037947137 8:22996680-22996702 GACTCCTCAGGGCCTGGGGTGGG + Intronic
1038416509 8:27400256-27400278 GACTTCTCAGAACCTTAAATAGG + Intronic
1038667685 8:29554522-29554544 GAATTCACACAGCCTTGAATTGG - Intergenic
1039107974 8:34009917-34009939 CCCCTCTCAGGGCCTTGGATAGG - Intergenic
1039377444 8:37050126-37050148 CACTGCTCAGAGCCTTGGATGGG + Intergenic
1040394158 8:46979541-46979563 TAGTTCTCAGGGCCTGGAAGAGG - Intergenic
1044859054 8:96504464-96504486 GACTTCTCATGGCTTTTAAGTGG - Intronic
1049335223 8:142080721-142080743 GACTTCTCAGAGCCTTGAATCGG - Intergenic
1049921991 9:373247-373269 CACTTCTCAGTTCCTTGCATAGG + Intronic
1050647062 9:7731658-7731680 GGCTTCTTAGGCCCTTGAGTTGG - Intergenic
1051179710 9:14397618-14397640 GACTTCATATGGTCTTGAATAGG - Intronic
1054814545 9:69462602-69462624 GACTTCTCAGAGCCTTGAAGAGG + Intronic
1056121203 9:83491043-83491065 GACTTCACAGAGACTTCAATAGG - Intronic
1056765618 9:89442946-89442968 GACTTTTAAGGGCCTTCACTGGG + Intronic
1057732067 9:97618602-97618624 GACTTCTCAGAGCCTTTAAGAGG - Intronic
1060770655 9:126329522-126329544 GCCCTCTCAGGGCCTTGGAAGGG + Intronic
1061393747 9:130332119-130332141 GACTGCCCAGGGCCCTGCATGGG + Intronic
1061625379 9:131838179-131838201 GACTTATCAGGACCATAAATAGG + Intergenic
1061757259 9:132823860-132823882 GACTTCTAAAGGACTCGAATTGG + Intronic
1186144807 X:6614188-6614210 GACTTCTCAGCTCCTTGGAGGGG - Intergenic
1187896165 X:23981573-23981595 GACTTCTGGGAGCCTTTAATAGG + Intergenic
1189681433 X:43520378-43520400 GATTTCTCAGTGCCTTGAGAAGG + Intergenic
1190089001 X:47421340-47421362 GACTCCCCAGTGCCTAGAATAGG + Intergenic
1191736043 X:64388801-64388823 GGCTTCTCGGAGCCTTTAATAGG + Intronic
1192849170 X:74935912-74935934 CACTTCTGAGTGCCTAGAATAGG + Intergenic
1192993908 X:76492235-76492257 GACTTCTCAGGGAAGTGAAGTGG + Intergenic
1197343657 X:125305458-125305480 GACTTCTCTGAACCTTTAATAGG + Intergenic
1200068399 X:153515876-153515898 GACTTCCCATGGCCCCGAATGGG - Intergenic