ID: 1023877283

View in Genome Browser
Species Human (GRCh38)
Location 7:44293928-44293950
Sequence CACTGCCCAGACCCACTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 370}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023877278_1023877283 14 Left 1023877278 7:44293891-44293913 CCGTGTTCAATTTCAGCCTCAGG 0: 1
1: 0
2: 3
3: 28
4: 205
Right 1023877283 7:44293928-44293950 CACTGCCCAGACCCACTGCCAGG 0: 1
1: 0
2: 3
3: 52
4: 370
1023877281_1023877283 -2 Left 1023877281 7:44293907-44293929 CCTCAGGGACCTCACATCTCACA 0: 1
1: 0
2: 2
3: 26
4: 382
Right 1023877283 7:44293928-44293950 CACTGCCCAGACCCACTGCCAGG 0: 1
1: 0
2: 3
3: 52
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023877283 Original CRISPR CACTGCCCAGACCCACTGCC AGG Intronic
900214725 1:1475365-1475387 CCCTGCCCTGCCCCTCTGCCTGG + Intronic
900221935 1:1513715-1513737 CCCTGCCCTGCCCCTCTGCCTGG + Intronic
900283535 1:1888280-1888302 CACTGCCCAGGCCCAGTGTGAGG - Intronic
900358433 1:2275918-2275940 CACTGCCCACCCTCCCTGCCCGG + Intronic
900477212 1:2881636-2881658 CTCCGGCCAGTCCCACTGCCGGG + Intergenic
900667871 1:3827803-3827825 CGCAGCACAGACCCACTGCCTGG + Intronic
900762077 1:4479945-4479967 CACTGGCCATGCCCTCTGCCTGG + Intergenic
901005890 1:6171333-6171355 CACAGCCCAGGGCCTCTGCCTGG + Intronic
902239125 1:15076607-15076629 CACAGCCCAGACTCAGGGCCTGG - Intronic
903810820 1:26034141-26034163 CACTGCCCTTACTCACTGCATGG - Intronic
906213344 1:44024451-44024473 GCCTGCCCAGGCCCTCTGCCAGG + Intronic
906317085 1:44793379-44793401 AACTTTCCAGACCCACTCCCTGG + Intergenic
910742079 1:90530453-90530475 CACTTCACAGACTCACTGCAGGG - Intergenic
914678656 1:149923590-149923612 CTCCACCCAGACCCACTCCCCGG - Exonic
914812974 1:151042966-151042988 TGGTGCCCAGACCCTCTGCCCGG - Exonic
916264932 1:162881493-162881515 CACAGCCCCGTCCCCCTGCCTGG - Intergenic
916287751 1:163129475-163129497 CACTGTCCAGACCAACGTCCAGG - Intronic
918313635 1:183304686-183304708 CACTTCCCAGAGCCCCTGGCAGG + Intronic
920275279 1:204799898-204799920 CTCTGCCCTGGCCCAATGCCTGG + Intergenic
920366859 1:205452518-205452540 CACTTCTCAGACCCACTGCCTGG + Intronic
920440248 1:205975956-205975978 CCCTGCACAGCCCCACTGCGAGG - Intergenic
920502451 1:206493853-206493875 CCCTGCCCAGACCCTTTTCCTGG - Intronic
920512394 1:206560663-206560685 CACTGCCCAAGCCCACAGGCTGG - Intronic
922241075 1:223755823-223755845 CACAACCCAGAGCCACTGCAGGG - Intronic
923343003 1:233023322-233023344 CACTTTCCAGACCCTCTTCCAGG + Intronic
924392816 1:243581251-243581273 CACTGCCCAGCCCCAGGGTCAGG - Intronic
1063024673 10:2166095-2166117 AACTGCACAGACCCTCTCCCAGG + Intergenic
1063450363 10:6146162-6146184 CACAGCACAGGCCCAGTGCCAGG - Intronic
1063916923 10:10892698-10892720 CATTCCCCAGATCTACTGCCAGG + Intergenic
1067430590 10:46240940-46240962 CAGTGCCCAAGCACACTGCCTGG + Intergenic
1067942417 10:50668009-50668031 CCTTGCCCAGACCCATTTCCTGG - Intergenic
1068737248 10:60428122-60428144 CACTGCCTAGACTCACTGCATGG - Intronic
1069688519 10:70334703-70334725 CTCTGCCCACACCCACCCCCAGG + Intronic
1069747682 10:70726208-70726230 CCCTGCCCAGTCCCACTGTAAGG + Intronic
1070593412 10:77816476-77816498 CAGAGCCCAGGCCCGCTGCCGGG + Intronic
1070834864 10:79441895-79441917 GGCTGCCCAGAGCCCCTGCCAGG - Intronic
1070863661 10:79692967-79692989 CCTTGCCCAGACCCATTTCCTGG - Intergenic
1072256955 10:93630174-93630196 CTGTGCAGAGACCCACTGCCTGG + Intronic
1072727839 10:97825517-97825539 CCCTGGCCGGCCCCACTGCCTGG - Intergenic
1074121820 10:110498707-110498729 CACCGGGCAGACCCGCTGCCGGG - Intronic
1074312296 10:112332640-112332662 CAATGCCCAGACCCATGGCAAGG + Intergenic
1074462468 10:113650796-113650818 CTCTGCCCAGGCCCAGTGCCTGG - Intronic
1075438766 10:122463060-122463082 CACTGCCAAGCCCCGCTGTCTGG - Intronic
1075684023 10:124351641-124351663 CCCTGCCCAGGCAAACTGCCAGG + Intergenic
1075684051 10:124351753-124351775 CCCTGCCCAGGCAAACTGCCAGG + Intergenic
1075735480 10:124662114-124662136 CCCTGCCCAGACCCCCTCCTGGG + Intronic
1076136203 10:128046933-128046955 CTCTGCCCAGCCCCAGGGCCAGG + Intronic
1076351228 10:129816327-129816349 TGCTGCCCACACCCACTGCATGG + Intergenic
1076713475 10:132351798-132351820 CACAGCCCAGTCCCAGTTCCGGG - Intronic
1077018157 11:406103-406125 CTTGGCCCAGACCCACTGCCAGG + Intronic
1077021391 11:418676-418698 CACTGCCCAGACCCACTCCGAGG + Intronic
1077046928 11:550893-550915 CACTCTCCAGACCCAAGGCCGGG - Intronic
1077151143 11:1073645-1073667 TGCTGCCCAGACCCAGGGCCTGG - Intergenic
1077326710 11:1967119-1967141 CCCTGCCCAGGCACCCTGCCTGG + Intronic
1077338377 11:2015455-2015477 CATTGCCCAGACCCACCCCTCGG - Intergenic
1077390375 11:2298250-2298272 CAGGGCCCAGGCCCATTGCCAGG - Intronic
1077420808 11:2449035-2449057 CACTGCCCAGGCCACCTGCAAGG - Intronic
1077431716 11:2518937-2518959 CGCTTCACAGACCCACAGCCTGG - Intronic
1077727301 11:4687673-4687695 CAGTGAACAGACCCAGTGCCTGG + Intronic
1078763906 11:14275201-14275223 CACTGCCCTGGCCATCTGCCTGG + Intergenic
1078977475 11:16495183-16495205 CCCTGCCCATAGCCACTACCTGG + Intronic
1079373995 11:19875619-19875641 CAATCCCCAAACCCACTCCCAGG - Intronic
1080556038 11:33418377-33418399 TAGTGCCCAGACCCCATGCCAGG - Intergenic
1080760577 11:35245225-35245247 CTCTGCCCAGACCCCCTTCCTGG + Intergenic
1081483148 11:43507293-43507315 TTCTGCCCAGCCCCAGTGCCTGG - Intergenic
1081999946 11:47388769-47388791 CACTGACTAGTCCCTCTGCCCGG - Intergenic
1083587455 11:63870555-63870577 CAGTGCCCAGCCACAGTGCCTGG - Intronic
1083666141 11:64275775-64275797 CAGTGCCCAGGCCAAGTGCCTGG - Intronic
1083895258 11:65616513-65616535 CACTGCCCTGAATCCCTGCCAGG - Intronic
1084045252 11:66564433-66564455 CCCTGTCCTTACCCACTGCCTGG - Intronic
1084170872 11:67400508-67400530 CATTCCCCAGACCCCATGCCAGG + Intronic
1084567937 11:69942236-69942258 CATGGCCCAGGACCACTGCCTGG + Intergenic
1085029210 11:73259472-73259494 CACTGCCCTGGCCACCTGCCTGG + Intergenic
1085045543 11:73350897-73350919 CACTGCACAGACCCCCTGTGGGG - Intronic
1085171853 11:74456426-74456448 CACTTCCCAGCCACATTGCCAGG - Exonic
1086989342 11:93286335-93286357 CACTGTCCAGACCTCTTGCCTGG + Intergenic
1088053967 11:105553133-105553155 GACTGGCCAGAACCACTCCCAGG + Intergenic
1088820975 11:113457237-113457259 AACTACCCAGACCCACTGGAGGG - Intronic
1088925336 11:114295826-114295848 CACTGCCATGACCCAGTGTCTGG - Intronic
1089095512 11:115916851-115916873 GAATGCCCAGACCCAGTACCAGG + Intergenic
1089786398 11:120910422-120910444 CACTGCCCAGACACAGCCCCAGG - Intronic
1090222209 11:125037610-125037632 CCCTGCCCTGTGCCACTGCCTGG + Intronic
1090902525 11:131045643-131045665 GACTCCCAAGTCCCACTGCCAGG - Intergenic
1091215544 11:133899210-133899232 TACGGCCCACAGCCACTGCCAGG - Intergenic
1202809691 11_KI270721v1_random:22299-22321 CCCTGCCCAGGCACCCTGCCTGG + Intergenic
1202821361 11_KI270721v1_random:70637-70659 CATTGCCCAGACCCACCCCTCGG - Intergenic
1091663459 12:2401244-2401266 CCCTGCCCAGGCCCAGTGCCAGG + Intronic
1091777152 12:3191996-3192018 CTCTTCCTGGACCCACTGCCTGG - Intronic
1092281341 12:7099928-7099950 CAAGGTCCAGAACCACTGCCAGG - Exonic
1096366773 12:51034780-51034802 CACTGCCCAGAATCAGTGCCTGG - Intergenic
1097419025 12:59350817-59350839 CATTGGCCACATCCACTGCCAGG - Intergenic
1097431021 12:59507023-59507045 CACTGCCCACTCCAACTCCCAGG + Intergenic
1097813795 12:64049070-64049092 CTTTGCCCAGACCAATTGCCTGG + Intronic
1097938478 12:65278834-65278856 CACTTCCCAGAGCCGCGGCCAGG - Exonic
1100799514 12:98216540-98216562 CACTGGCCATTCCCTCTGCCTGG + Intergenic
1102759573 12:115374031-115374053 CACTTCCCAGTCCCCCTGCAGGG - Intergenic
1103565200 12:121811884-121811906 CCCTGCCAAGGCCCCCTGCCTGG - Intronic
1103941397 12:124503263-124503285 CACGGCCCACACCCAGTGACAGG + Intronic
1104151737 12:126090835-126090857 CCCTGCCCAGCCCCACAGTCTGG - Intergenic
1105843661 13:24276860-24276882 CAATGGCCAGACCCACAGGCCGG - Intronic
1105951326 13:25231752-25231774 CCCATCCCAGCCCCACTGCCAGG + Intergenic
1108228975 13:48318295-48318317 CACTGCCCAGATGCACTTCCTGG - Intronic
1108945706 13:56019989-56020011 CTCTGTGCTGACCCACTGCCAGG - Intergenic
1110474044 13:75892281-75892303 CACTTCTCAGGCCCACTCCCCGG + Intergenic
1110609821 13:77475713-77475735 CACTGCCCCGGCCCGCTGGCCGG + Intergenic
1111017076 13:82394933-82394955 CTTTGCCCAGACCAACTTCCTGG - Intergenic
1113216352 13:108045168-108045190 CACCTCTCAGACCCACTGCAAGG + Intergenic
1113695108 13:112340176-112340198 CACTGTAGAGACCCACTGCTTGG + Intergenic
1118316125 14:64727190-64727212 CACAGCCCAGCCCCACTGCTGGG - Intronic
1118319240 14:64743495-64743517 CCCTTCCCAGCCCCACTGCAGGG + Exonic
1119179946 14:72598898-72598920 CAGTGCCCAGACCGATTGCCTGG - Intergenic
1121338240 14:93090099-93090121 CCCTGCCCAGACTCACCCCCTGG + Intronic
1121457547 14:94048190-94048212 CCCTGGCCAGTCCCACTTCCTGG + Exonic
1122233217 14:100317612-100317634 GACTGCACCCACCCACTGCCTGG + Intergenic
1122283281 14:100636759-100636781 CCCTGCCCTGCTCCACTGCCCGG + Intergenic
1122327241 14:100890207-100890229 CAGTGCCCAGAGCCTCTGTCGGG + Intergenic
1122446800 14:101775687-101775709 CTGGGCCCAGCCCCACTGCCAGG - Intronic
1122470913 14:101965165-101965187 CCCTCGCCACACCCACTGCCCGG + Intronic
1122880311 14:104687902-104687924 CACTGCCCAGCACCGCTGCCAGG + Intergenic
1123402867 15:20004174-20004196 TTCTGCCCAGACCCTCGGCCAGG - Intergenic
1123512206 15:21010828-21010850 TTCTGCCCAGACCCTCGGCCAGG - Intergenic
1123706584 15:22955337-22955359 AACCGCCCTGACCCAGTGCCGGG + Intronic
1124093726 15:26629438-26629460 CACAGCCAAGAGCCAGTGCCAGG - Intronic
1124235226 15:27984287-27984309 CACTGCCCGGGCCCACTCCCAGG - Intronic
1124342634 15:28900081-28900103 CACGGCCCAGTCCCCCTGTCTGG - Intronic
1124400921 15:29346472-29346494 CACTGACCACAGCCCCTGCCTGG - Intronic
1127380652 15:58428186-58428208 CACTCCCCTGACCCCATGCCTGG - Intronic
1127802380 15:62488378-62488400 CTCAGCTCAGACCCACTGCTTGG - Intronic
1128664937 15:69531108-69531130 CCCTGCCCAAGCCCACTGGCTGG - Intergenic
1128684224 15:69671757-69671779 CTCTGCTGAGACCCAGTGCCTGG + Intergenic
1128799724 15:70489778-70489800 CACTTACCAGCCCCACTGCTGGG + Intergenic
1129538092 15:76330444-76330466 AACTGCTCAGAACCACTCCCAGG + Intergenic
1130378494 15:83351828-83351850 CACTGCCAAGAGCCGCTTCCCGG - Intergenic
1131260851 15:90886951-90886973 CTCTCCCTAGACCCACAGCCAGG + Exonic
1131343812 15:91627649-91627671 CCCTGCAGAGCCCCACTGCCAGG - Intergenic
1131978756 15:97974321-97974343 AACCGCCCAGACCCTCTGCCTGG + Intergenic
1132586880 16:709460-709482 CACTGCCCCTGCCCCCTGCCTGG + Intronic
1132743473 16:1427368-1427390 CCGGGCCCAGCCCCACTGCCGGG + Intergenic
1132743817 16:1428616-1428638 CAGTGCCCAGACCCCAGGCCGGG + Intergenic
1132865201 16:2089811-2089833 CACTGCCCAGCCGCCTTGCCCGG - Exonic
1133228873 16:4356971-4356993 CACTGCCCTCCCCCACTTCCCGG + Intronic
1134232195 16:12437860-12437882 CCCAGCCCAGGGCCACTGCCTGG + Intronic
1136112774 16:28075265-28075287 CACTGCACAGCCACACTCCCAGG - Intergenic
1137274903 16:46926994-46927016 CTCTGCCCAAAGCCACTGCCGGG - Exonic
1137974841 16:53022559-53022581 CATTGTCCAGGACCACTGCCTGG + Intergenic
1138118764 16:54381336-54381358 CAGTGCCCATGCCCACTGCCTGG - Intergenic
1138551811 16:57752638-57752660 CACAGCCACGCCCCACTGCCGGG - Intronic
1139427827 16:66894211-66894233 CCCATCCCAGACCCACTGCACGG - Intronic
1139640001 16:68284649-68284671 CACTCCTCAGACCCACTAACTGG - Intronic
1139953110 16:70681366-70681388 CTCAGCCCAGATCCCCTGCCAGG - Intronic
1140475943 16:75239351-75239373 CACAGCACAGGCCCACTGCCAGG + Intronic
1140888253 16:79263115-79263137 CACTGCCTAGTCCCAGTTCCTGG - Intergenic
1142050670 16:87956045-87956067 CACTGCCCAGCACCTGTGCCTGG - Intronic
1142251958 16:88996147-88996169 CTCTTCCCAGACCCAGTGCCCGG + Intergenic
1142435341 16:90053140-90053162 GACTGGCCGGAACCACTGCCTGG + Intergenic
1142805678 17:2369970-2369992 CTCTTCCCAGACCCACGGCCGGG - Intronic
1143189891 17:5033525-5033547 CACTGCCCAGCACCACAGCCAGG + Exonic
1143738674 17:8935249-8935271 ATCTGCCCAGACCCTGTGCCAGG - Intronic
1144994573 17:19258661-19258683 CACTGGCTAGACCCACAGCCTGG - Intronic
1146574095 17:33976829-33976851 CCCTGCCCACACCCACCCCCAGG - Intronic
1146935050 17:36808165-36808187 CGCCGCGCAGACCCCCTGCCCGG - Intergenic
1147164244 17:38585073-38585095 GTGTGCCCCGACCCACTGCCTGG + Intronic
1147247635 17:39132658-39132680 CTCTGCCCAGTGCCTCTGCCAGG - Intronic
1147984527 17:44297797-44297819 CACTGCCAACCTCCACTGCCCGG + Intergenic
1148324373 17:46774617-46774639 CACTGCCCACACCCAACACCAGG + Intronic
1149036038 17:52135322-52135344 GACTGGCCAGAACCACTGCATGG - Intronic
1151261205 17:72917300-72917322 CACAGCCCAGACACAGTGCTTGG - Intronic
1151351245 17:73533392-73533414 CAATGACCAGACAGACTGCCAGG - Intronic
1152195662 17:78916735-78916757 CACTGCCAGGTCCCACTGCCGGG + Intronic
1152230698 17:79112739-79112761 CCCTGGCCACACCAACTGCCAGG + Intronic
1152527275 17:80895522-80895544 CCCTGTCCACACCCAGTGCCTGG + Intronic
1152544389 17:80993391-80993413 CCCTGCCCAGCCCCACTGCTGGG - Intronic
1152563422 17:81089775-81089797 CCCCGCCCAGACCCACTCACAGG - Intronic
1152564048 17:81092314-81092336 CACTGCCCGCCTCCACTGCCGGG + Intronic
1152574745 17:81135075-81135097 CCCTTGCCAAACCCACTGCCAGG + Intronic
1152630505 17:81408759-81408781 CCCTGCCCAGCCCCCCTGGCTGG + Intronic
1152702459 17:81825811-81825833 CTCTGCCCAGTCCTCCTGCCAGG + Exonic
1152747883 17:82049587-82049609 CACTGCCCCGGCCCGATGCCCGG - Intronic
1152890953 17:82881418-82881440 CACAGCCCAGACCCACGTTCCGG - Intronic
1152940738 17:83171871-83171893 CACTGCCCACACCAAGTCCCAGG - Intergenic
1152987598 18:334700-334722 CACTGCCCTGTCCCCCTGGCTGG + Intronic
1153027825 18:687402-687424 CTCTCCCCAGACCCGCTGCCTGG - Intronic
1153165831 18:2261306-2261328 GACTGCTGAGACCCACTGGCAGG - Intergenic
1155166033 18:23233194-23233216 CACAGCCCATGCCAACTGCCTGG + Intronic
1155999683 18:32371189-32371211 CACTGCAGAGAGCCACTGGCAGG + Intronic
1157278927 18:46333395-46333417 CACTCCCCAGGCTCTCTGCCTGG - Intronic
1157445508 18:47743692-47743714 CACTGCACAGATCCACTTACAGG + Intergenic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1159104276 18:63987613-63987635 CTCTGCCCACCACCACTGCCAGG + Exonic
1160365579 18:78323421-78323443 CCTTCCCCAGACCCACTGTCTGG + Intergenic
1160778956 19:869338-869360 CTCTGCCCAGACACCCGGCCTGG + Intronic
1161282599 19:3453973-3453995 CCCTCCCCAGCCCCACTGCCAGG + Intronic
1161453536 19:4359474-4359496 CACTCCCAAAACCCGCTGCCAGG - Intronic
1162782609 19:13014329-13014351 CTGGGCCCTGACCCACTGCCTGG + Intronic
1163374335 19:16921205-16921227 CACTGCACAGTCACAGTGCCAGG - Intronic
1163621886 19:18365854-18365876 TACAGTCCACACCCACTGCCAGG - Exonic
1164080372 19:21857120-21857142 CACTGCCCACAGCCACTGGCTGG + Intergenic
1164605202 19:29593060-29593082 CAGGGCCCAGGGCCACTGCCTGG + Intergenic
1165527813 19:36370750-36370772 GGCTGCCCAGAACCACTGCATGG + Intronic
1165892926 19:39125714-39125736 CACTGGCCCTGCCCACTGCCCGG + Intergenic
1166625160 19:44345115-44345137 CAATGCCCAGACCCAAGTCCAGG + Intronic
1166734700 19:45077113-45077135 CAATGCCCAGGCCCACTGGCTGG - Intergenic
1167468334 19:49662078-49662100 CTGGGCCCAGAGCCACTGCCCGG + Exonic
1168130754 19:54317017-54317039 CACGGCAAAGACCCACTGACCGG + Intergenic
1168151740 19:54452761-54452783 CCCTGCCCCGCCCCACTGGCTGG - Intronic
1168719787 19:58548659-58548681 CCCTGCCCACCCCCCCTGCCTGG - Intronic
925180798 2:1815727-1815749 CACTGGCCTGACCGACTGTCTGG - Intronic
925291008 2:2748758-2748780 CACTGCCCAGCCCCAGGGCCAGG - Intergenic
925311852 2:2890444-2890466 CAGTGCCCAGCCCCACTGCTGGG + Intergenic
925312951 2:2900177-2900199 GACTGGCCAGAACCACTCCCTGG - Intergenic
925381842 2:3433618-3433640 CACTGCCCAGCACCAAGGCCCGG + Intronic
926758459 2:16254468-16254490 GACTGGCCAGACCCACTTCATGG - Intergenic
927693242 2:25223002-25223024 AACTCCCCACACCCACTGCTGGG + Intergenic
928015960 2:27657407-27657429 CACTGCCAATACCCACTTCATGG + Exonic
928196348 2:29219232-29219254 CCCTGCCCAGTCCTCCTGCCAGG + Intronic
931052430 2:58428878-58428900 CACTGCCCGGCCCCACCTCCCGG - Intergenic
931590350 2:63876186-63876208 CACTGTCCACACCCTCTACCAGG - Intronic
932036374 2:68251589-68251611 CCCTGCCAAGACTCACTGCTGGG + Intronic
933781850 2:85807930-85807952 CACTGCCCCCACCCAGGGCCTGG - Intergenic
934135956 2:88996731-88996753 CACAGCCCAGGGCCAGTGCCTGG - Intergenic
934234361 2:90217042-90217064 CACAGCCCAGGGCCAGTGCCTGG + Intergenic
934745450 2:96756621-96756643 CTGTACCCAGACCCACAGCCAGG - Intergenic
936489745 2:112959896-112959918 CACTGCCCACACCCTCTTCAAGG - Intergenic
937347405 2:121134900-121134922 CTCTGACCCGGCCCACTGCCCGG - Intergenic
938954133 2:136282846-136282868 CACTGGGCAGCCCCAGTGCCAGG - Intergenic
941851340 2:170185242-170185264 CATTGCCCAGACCAACGTCCTGG + Intronic
942089981 2:172480459-172480481 CACAGCACAGAGTCACTGCCAGG + Intronic
942244979 2:173999442-173999464 CCGTGCCCAGAATCACTGCCTGG + Intergenic
945234011 2:207617795-207617817 CTCTGTCCACTCCCACTGCCTGG - Intronic
945768864 2:214015204-214015226 GACTGGCCAGACCCACTTCATGG + Intronic
945966252 2:216190407-216190429 CACGGCCCAGACTCATTTCCAGG - Intronic
946159691 2:217828537-217828559 CAGTGCCCAGAACCACACCCTGG + Intronic
946414279 2:219531820-219531842 CACTGCCCATGCCCCCTGCCCGG - Exonic
947579597 2:231306813-231306835 CACTGCCCAGATCCTCTGTGTGG - Intronic
947737927 2:232467322-232467344 CTCTGCCCAGACCCATGGCATGG + Intergenic
948397415 2:237656515-237656537 CACAGCCAAGAACCACTGCTTGG - Intronic
948698725 2:239747513-239747535 CTCTGCCCACGCCCAGTGCCCGG + Intergenic
948816437 2:240512675-240512697 CACTGCCCAGGCCCCAAGCCAGG + Intronic
948840822 2:240648059-240648081 CTCTGCCCCAAGCCACTGCCTGG - Intergenic
1168862099 20:1052843-1052865 CACTGCCCAACCCCAGTGCCAGG + Intergenic
1171523672 20:25794027-25794049 CACTGGCCACACCCTCTACCGGG - Intronic
1171553155 20:26061856-26061878 CACTGGCCACACCCTCTACCGGG + Intergenic
1172691583 20:36793950-36793972 CACTGGCCAGGCCCACCGTCTGG + Exonic
1173454621 20:43192197-43192219 CACCGGCCAGTCCCTCTGCCTGG + Intergenic
1175773899 20:61641172-61641194 CTCTCCCCAGACCCTGTGCCAGG - Intronic
1175972941 20:62696293-62696315 CGCTGCACAGCCCCACTGCCTGG - Intergenic
1175972948 20:62696332-62696354 CACTGCACAGCCCCACTGCACGG - Intergenic
1176130564 20:63495087-63495109 CACTGCGCAGTCCGCCTGCCCGG + Exonic
1178877246 21:36422752-36422774 CACTGCCCCGCCACATTGCCTGG + Intergenic
1179083561 21:38196093-38196115 CACTGCCCAGGCCCCCTTGCAGG + Intronic
1179947025 21:44685452-44685474 GACTGACCAGACCCACAGCGAGG + Intronic
1180176756 21:46094303-46094325 CACTGCTCTGACCCACGGCTTGG - Intergenic
1180708990 22:17826929-17826951 CACGGGCCACACCCCCTGCCAGG - Intronic
1180726950 22:17953378-17953400 CATTGCCCACCCCCACTGCCCGG - Intronic
1180762881 22:18222729-18222751 CACCTCCCAGACGCACTTCCAGG + Intergenic
1180772765 22:18401818-18401840 CACCTCCCAGACGCACTTCCAGG - Intergenic
1180804144 22:18651434-18651456 CACCTCCCAGACGCACTTCCAGG - Intergenic
1180806630 22:18718043-18718065 CACCTCCCAGACGCACTTCCAGG + Intergenic
1181217576 22:21343825-21343847 CACCTCCCAGACGCACTTCCAGG + Intergenic
1181621969 22:24097428-24097450 TGTTGCCCAGACCCACTGTCAGG - Intronic
1182275825 22:29188061-29188083 CACTGCCCAGGCCCATGGCCAGG - Intergenic
1183296785 22:37034378-37034400 CTCTGCCCACACTCACGGCCAGG - Intergenic
1183347123 22:37314028-37314050 CACAGCTCAGACCCACGGACAGG + Exonic
1183395864 22:37570448-37570470 CACTGCCCTGGCCCATTTCCAGG - Intronic
1183542354 22:38436852-38436874 CATTGCCCAGGCCCACATCCTGG - Intronic
1183688470 22:39375309-39375331 CACCTCCCAGAGGCACTGCCAGG - Intronic
1183758134 22:39790000-39790022 CACTGCAGAGACCCACAGGCAGG + Intronic
1183960896 22:41411299-41411321 CCCTGCCCAGTCCCTCTGCGGGG - Intergenic
1184033499 22:41908111-41908133 CACTGCCCACAGCCTCAGCCTGG + Intergenic
1184189597 22:42885922-42885944 CACTGCCCGTGCCCACTACCTGG + Intronic
1184504601 22:44893315-44893337 CACCCCCCAGCCCCACTCCCAGG + Intronic
1184690459 22:46115029-46115051 CCCTCCCCACTCCCACTGCCAGG + Intergenic
1184943978 22:47788028-47788050 CCCTGCCCAGCTCCAGTGCCTGG - Intergenic
1185070061 22:48651305-48651327 CACAGCGCAGACCCATTGTCAGG + Intronic
1185246387 22:49775406-49775428 CACTGCCCAGCCCCCTCGCCGGG - Intronic
1185266996 22:49909607-49909629 CACTGCCCAGAACCACCGCCTGG + Intronic
1203234600 22_KI270731v1_random:142806-142828 CACCTCCCAGACGCACTTCCAGG - Intergenic
949522245 3:4868236-4868258 TAATGCCCAGAGCCTCTGCCAGG + Intronic
949966572 3:9361808-9361830 GACTGGCCAGAACCACTCCCTGG - Intronic
950196873 3:11015556-11015578 CACAGCCCAGACGCCCTGGCAGG + Intronic
952503200 3:33983472-33983494 CACTGCCCCCACCCCCTGACAGG - Intergenic
953241814 3:41156087-41156109 CAGTGCCCAGACCAGCTGCCGGG - Intergenic
954126523 3:48533968-48533990 TACTGCCCAGAGGCACTTCCTGG + Intronic
954438533 3:50508957-50508979 CTTTGCTCAGACCCTCTGCCAGG - Intergenic
955093331 3:55773269-55773291 CACTGGCCATGCCCTCTGCCTGG + Intronic
959574832 3:107923678-107923700 ATCTGTCCATACCCACTGCCTGG + Intergenic
960997949 3:123351881-123351903 CTCTTCCTAGACCGACTGCCTGG - Intronic
961415828 3:126756021-126756043 CCCTGCACAGACCCACTGCACGG - Intronic
961470032 3:127105743-127105765 GTCTCCCCAGCCCCACTGCCTGG - Intergenic
966890546 3:184404647-184404669 CGCTGCCCAGACCCCATTCCTGG - Intronic
966939888 3:184739203-184739225 CACGGCCCAGCTCCACTGCATGG + Intergenic
966947818 3:184789746-184789768 CACTGGCTGGCCCCACTGCCTGG - Intergenic
967844736 3:194034700-194034722 TCCTCCCCAGTCCCACTGCCCGG - Intergenic
968642676 4:1722179-1722201 CTCTGCCCAGAGCCCCTCCCGGG + Intronic
968660450 4:1796675-1796697 CACTGCAGAGACCCAGAGCCTGG + Intronic
968813788 4:2811522-2811544 CCCTGCCCAGGCCCAGAGCCCGG - Intronic
968814496 4:2814970-2814992 CAGTGCCCAGCCCCTCTTCCAGG - Intronic
968908316 4:3464451-3464473 CCGTGCCCAGACCTCCTGCCTGG + Intronic
969170184 4:5356052-5356074 CACTGAGCAGACCCACACCCTGG + Intronic
969246805 4:5939883-5939905 GACTGGCCAGAACCACTGCATGG - Intronic
969624955 4:8297670-8297692 CCCTTCCCACTCCCACTGCCTGG - Intronic
969858100 4:10015986-10016008 ATCTGCCCAGATCCACGGCCTGG - Intronic
972511317 4:39770737-39770759 CAATGCCCAGGCCCCCTCCCAGG + Intronic
972924439 4:43985757-43985779 CACTGCTTAGATCCACTGCAAGG - Intergenic
974067731 4:57095629-57095651 CAATCCCCATACCCATTGCCTGG + Intronic
974985659 4:69023356-69023378 CACAGCCCATATCCAATGCCTGG + Intronic
976554191 4:86431942-86431964 CACTGCCCAGAACCACTTCATGG + Intronic
976792004 4:88889015-88889037 CACTCCCTATACCCACTCCCAGG + Intronic
977566890 4:98589606-98589628 AACTGCCTAGACCCACAACCCGG + Intronic
978673334 4:111278221-111278243 CATTGCCCAGACCCATGTCCTGG - Intergenic
981568948 4:146131539-146131561 CACTGCCCATTTCCTCTGCCTGG + Intergenic
983561606 4:169107100-169107122 CACTGCCCAGCTCCACTTCTAGG + Exonic
983671777 4:170246304-170246326 CCCTGTCCACACCCCCTGCCTGG + Intergenic
985951071 5:3221683-3221705 CCGTGCCCAGAAGCACTGCCTGG + Intergenic
986132482 5:4943766-4943788 CATTGCTCAGAAGCACTGCCTGG + Intergenic
986985872 5:13500598-13500620 CACTGCCCAGGGCCACTTCAAGG + Intergenic
989297492 5:39847078-39847100 CACTGCCCCAACCCTCTGACTGG + Intergenic
989760984 5:45016097-45016119 ACCTGCCCAGATCCACTTCCAGG - Intergenic
990137848 5:52668838-52668860 CACTGCCCAGAAGCACAGCTCGG + Intergenic
990709311 5:58563981-58564003 CTCTGCCCGGACACCCTGCCTGG - Intergenic
991269870 5:64767411-64767433 CAATGCCCAGTACCAGTGCCTGG + Intronic
992774663 5:80078959-80078981 CCCTGGACATACCCACTGCCAGG - Exonic
995481193 5:112594928-112594950 CACTGCCCAGATCCCCTGCAGGG + Intergenic
997523499 5:134538160-134538182 CACTGCCCGTGCCCTCTGCCAGG - Intronic
997588010 5:135055581-135055603 CACTGCCCTGACCGTCTGCCTGG - Intronic
998375633 5:141688808-141688830 CACTGCACAGACCCATTTACAGG + Intergenic
999523388 5:152376254-152376276 CAAAACCCAGACCCACTGCATGG - Intergenic
1002019919 5:176356939-176356961 CACTCCCCCCACCCACTCCCTGG - Intronic
1002566822 5:180116812-180116834 CACCACACACACCCACTGCCTGG + Intronic
1002571340 5:180140910-180140932 CACTTCCAGGAGCCACTGCCTGG - Intronic
1004318024 6:14608563-14608585 CACAGCCCAGGGCCACTGCCTGG + Intergenic
1004913874 6:20313264-20313286 GACTGGCCAGACCCACCCCCTGG + Intergenic
1005825675 6:29630458-29630480 CACCCCCAAGCCCCACTGCCAGG - Exonic
1006136768 6:31900600-31900622 CAATGCCCAGACCCCCTCCCAGG + Exonic
1006926855 6:37661067-37661089 CACAGCCCAGACTCACTGCAGGG - Intronic
1007368639 6:41412032-41412054 CTCTGCCCTGACCCACTAACCGG - Intergenic
1007371755 6:41430773-41430795 CACTGCAGAGAGTCACTGCCAGG + Intergenic
1007593963 6:43040125-43040147 CAGTCCCCAGTCCCTCTGCCTGG + Intronic
1011300149 6:85865188-85865210 CAATGCCCAGCCCCACTGGCTGG - Intergenic
1011340545 6:86308252-86308274 CACAAGCCAGACCCAGTGCCAGG + Intergenic
1013599244 6:111688905-111688927 GACTGCCCAGATCCACTGACTGG + Intronic
1014342844 6:120230029-120230051 CCCAGGCCACACCCACTGCCAGG + Intergenic
1015685252 6:135851695-135851717 CAGTGCCCAGACCAACTGACTGG - Exonic
1017975115 6:159350318-159350340 GACTGCCCAGAACCACTCCATGG + Intergenic
1018271326 6:162081518-162081540 CACTGTTGAGACCCACTGCTCGG - Intronic
1019345972 7:531146-531168 CCCTGCCCGGCCCCACTCCCAGG - Intergenic
1019346564 7:533665-533687 GGGTGCACAGACCCACTGCCTGG + Intergenic
1019404592 7:876940-876962 CGCGGCCCAGACCCTCCGCCGGG - Intronic
1019577246 7:1743487-1743509 CAGTGCCAAGTCCCAGTGCCGGG + Intronic
1019649324 7:2148282-2148304 CTCCGCACAGACCCACGGCCTGG + Intronic
1020016860 7:4836313-4836335 CACTGCCCGGTGCCACTGCAGGG - Intronic
1020029016 7:4920121-4920143 CCCTGCCCCGACCCCCTACCCGG + Intronic
1020278029 7:6636704-6636726 CACTGGCCATGCCCTCTGCCTGG + Intergenic
1023741744 7:43287330-43287352 CACTCCCTACTCCCACTGCCAGG - Intronic
1023877283 7:44293928-44293950 CACTGCCCAGACCCACTGCCAGG + Intronic
1024963853 7:55004804-55004826 CAGCGCCCAGCCCCACTGTCAGG - Intergenic
1026431678 7:70353721-70353743 CATGGCCCAGACTCACTGTCAGG + Intronic
1026514101 7:71052675-71052697 CATTGCCTAGACCCACTTCATGG - Intergenic
1026931029 7:74223062-74223084 CTCTCCCTAGAGCCACTGCCGGG - Intronic
1027269054 7:76510423-76510445 CAGTATCCAGCCCCACTGCCAGG - Intronic
1028262531 7:88683843-88683865 TACTGCCCACTCCCGCTGCCGGG + Intergenic
1029438697 7:100575948-100575970 CACTGGCCAGAGCCTCGGCCAGG + Exonic
1033648341 7:143321806-143321828 CACTGCCCAGGCCCGCAGTCAGG - Exonic
1033660698 7:143399827-143399849 CAATTCCCAGACACTCTGCCTGG - Exonic
1034214545 7:149395016-149395038 CACTTCCCAACCCCACTGTCTGG + Intergenic
1034274778 7:149819326-149819348 CAGTTCCCAGCCCCACAGCCAGG - Intergenic
1035314780 7:157991028-157991050 CACTGCTCATCTCCACTGCCAGG + Intronic
1035566653 8:645572-645594 CCCAGCCCTGACCCACTTCCAGG + Intronic
1035621980 8:1042053-1042075 CACGGCCCAGAGACACTCCCTGG - Intergenic
1036626849 8:10479434-10479456 CACAGCCCAGCCTGACTGCCTGG + Intergenic
1036659253 8:10697525-10697547 CAGAGCCCACATCCACTGCCTGG + Intronic
1037315638 8:17596282-17596304 CACTGGCCAGATCGGCTGCCAGG + Intronic
1038911297 8:31967653-31967675 CACTGCACAGAACTGCTGCCTGG - Intronic
1039847033 8:41332829-41332851 CACTGCCCAGTCGGAATGCCTGG + Intergenic
1041102720 8:54412704-54412726 CACTGTCCAAGCCCACTGACAGG + Intergenic
1042516297 8:69662859-69662881 CACATCCCACACTCACTGCCTGG + Intergenic
1043666068 8:82815792-82815814 CTTTGCCCAGACCAACGGCCTGG + Intergenic
1043913086 8:85886962-85886984 AACTTCTCAGACCCACTACCTGG - Intergenic
1045137218 8:99233967-99233989 CACTGAGCAGACCCAGTCCCGGG - Intronic
1045202418 8:99997843-99997865 CACTCCCCAAACCCATTCCCAGG + Intronic
1048517063 8:135120753-135120775 CAATGCCCAGCTCCACCGCCAGG - Intergenic
1048553230 8:135453399-135453421 AGCTGCCCAGCCCCAGTGCCTGG - Intergenic
1049009113 8:139875582-139875604 CGCCCCCCACACCCACTGCCGGG + Intronic
1049081546 8:140447002-140447024 CACGGCCCACAGCCACAGCCGGG + Intronic
1049353313 8:142175677-142175699 CTCCAGCCAGACCCACTGCCTGG + Intergenic
1049661036 8:143819865-143819887 CCCTGACCAGACCCCCAGCCCGG + Intronic
1049767206 8:144360425-144360447 CACTGCCCAGCACCACAGCCAGG - Exonic
1049823949 8:144655014-144655036 AAGTGCTCAGTCCCACTGCCTGG + Intergenic
1049865166 8:144930639-144930661 CACTTCCCAGACCGAAAGCCTGG - Exonic
1053081810 9:35183573-35183595 CTCTGCCCAGCCGCCCTGCCTGG - Intronic
1053286037 9:36850113-36850135 TTCTGCCCAGCCCCACTGCCGGG - Intronic
1054452290 9:65409725-65409747 GACTCCCCAGTCCCTCTGCCTGG + Intergenic
1056763069 9:89428319-89428341 CACTGCCCAAACACAGTCCCTGG + Intronic
1057250988 9:93501660-93501682 CACTGCCCAAACTTCCTGCCTGG - Intronic
1057642255 9:96835818-96835840 CACTGCAGAGACCCTCTGCTAGG + Intronic
1059841493 9:118222575-118222597 CACTGGCCTGACCAACTCCCTGG + Intergenic
1060733793 9:126053620-126053642 CATTTTCCAGACCCACTGTCCGG - Intergenic
1060904001 9:127288215-127288237 ACCTTCCCTGACCCACTGCCTGG - Intronic
1061385431 9:130286753-130286775 CAGTGCCCAGCACCACTGCCTGG - Intronic
1061800353 9:133110217-133110239 CATTGCCAAGACCCGCAGCCAGG + Intronic
1061942287 9:133890218-133890240 CACTGCCCAGACTCCCGGCCTGG - Intronic
1062231927 9:135486685-135486707 CACAGCCCAGACGCACTTCTTGG + Exonic
1062252475 9:135605270-135605292 CACCGCCAAGGCCCGCTGCCTGG + Intergenic
1062341095 9:136094369-136094391 CACCTCCCAGCCCCTCTGCCAGG - Intronic
1062379531 9:136280636-136280658 CACTCCCAAGCCCCACAGCCGGG + Intergenic
1062463858 9:136672737-136672759 CCCCTCCCAGACCCACTGCTGGG + Intergenic
1062495605 9:136830179-136830201 CCCAGGCCAGACCCACTGCTGGG - Intronic
1062514184 9:136924036-136924058 CACTGCCCAGAGGGACTCCCAGG - Intronic
1062580485 9:137227265-137227287 CACTGCCCTGACCCTGTGCCAGG + Exonic
1185675452 X:1845523-1845545 CACTTCCAAAACCCACTGCCTGG - Intergenic
1185736566 X:2500685-2500707 CCCCGCCCAGCCCCACTTCCGGG + Intronic
1187011546 X:15285082-15285104 CAGTGCCCAGAGACACTGACAGG + Intronic
1188858006 X:35221545-35221567 CACTGACCTGCCCCACTGTCTGG - Intergenic
1189987826 X:46569861-46569883 CTCTGCCCTGACACATTGCCAGG + Intergenic
1192180850 X:68914670-68914692 CCCTCCCCAGACCCACCACCTGG - Intergenic
1193685070 X:84567940-84567962 CAAAACCCAGACCAACTGCCTGG + Intergenic
1195007704 X:100702475-100702497 CACTGCAGAGACCAGCTGCCTGG - Intronic
1195240050 X:102942217-102942239 CACTGCCCCCACCCACAACCTGG + Intergenic
1195698530 X:107684593-107684615 CACAGCCACCACCCACTGCCAGG - Intergenic
1197167644 X:123395425-123395447 CACTGCCCCCACCCTTTGCCTGG - Intronic
1197559253 X:127997685-127997707 CATTGCCCAGTCCAATTGCCTGG - Intergenic
1197716077 X:129706918-129706940 CACTGCCCACTCCCACTGCAGGG + Intergenic
1200069672 X:153521936-153521958 CACCTCCCACACCCACTCCCTGG + Intronic
1200096379 X:153666062-153666084 CCCTGCCCTGCCCCACTTCCAGG + Intergenic
1200135036 X:153870645-153870667 CCCTGCCCAGACCCCTTCCCAGG - Intronic
1201589060 Y:15593644-15593666 AACTGCCCAGCCTCACTACCTGG + Intergenic