ID: 1023878732

View in Genome Browser
Species Human (GRCh38)
Location 7:44306902-44306924
Sequence CGGTGTGAGCAGGGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 440}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023878732 Original CRISPR CGGTGTGAGCAGGGGGAAGA GGG Intronic
900354476 1:2253676-2253698 CGGTGCGAGCAGATGGAGGATGG + Intronic
900742780 1:4340748-4340770 AGGTGGGACCTGGGGGAAGACGG + Intergenic
900996134 1:6124611-6124633 CTGTGTGAGCCGGGGGCGGATGG - Exonic
901388394 1:8926240-8926262 CGGAGTGAGGTGTGGGAAGACGG - Intergenic
901725466 1:11238508-11238530 GGGTGTGAGCAGGCGGGAGCAGG + Exonic
903330042 1:22592659-22592681 CGGGGTGAGCAGAGGGGAGGAGG + Intronic
903974135 1:27138188-27138210 TGGTGTGAGAATGGAGAAGAGGG - Intronic
904114244 1:28149928-28149950 TGGACTGAGCTGGGGGAAGAAGG - Exonic
904306559 1:29593905-29593927 GTGTGTGGGAAGGGGGAAGAGGG + Intergenic
904429087 1:30450407-30450429 GGGTTTGAGCAGGGGAATGATGG + Intergenic
904912502 1:33945788-33945810 CGGGCTGAGCAGGGGGCAGCAGG - Intronic
905607030 1:39310427-39310449 TGGTGTGTGCACTGGGAAGAGGG + Exonic
906290758 1:44617896-44617918 AGGAGTCAGCAGGGGAAAGAAGG - Intronic
906320184 1:44810796-44810818 CTGTGTGTGCTGTGGGAAGAGGG + Intronic
906868263 1:49447078-49447100 GGGTGTGTGCAGTGGGAAGAGGG + Intronic
907186377 1:52612511-52612533 GGGTGTCAGCAGGGTGTAGATGG - Intergenic
908437671 1:64122278-64122300 TGATGTGAGGATGGGGAAGAAGG + Intronic
910124430 1:83824948-83824970 TGTTGTGGGCTGGGGGAAGAGGG - Intergenic
910356720 1:86365875-86365897 GTGTGTGAGCAGGGGGTGGAGGG - Intronic
911154361 1:94624051-94624073 AGGAGAGAGCAGAGGGAAGAAGG + Intergenic
911301784 1:96183488-96183510 GGGGGAGGGCAGGGGGAAGAAGG + Intergenic
913387697 1:118277772-118277794 GGGTTAGAGCAGAGGGAAGAAGG + Intergenic
915074782 1:153299087-153299109 AGGGGTGAGCATGGGGTAGAGGG - Intronic
915449679 1:155995932-155995954 TGGTCTGAGCTGGAGGAAGAAGG - Intronic
915915392 1:159937601-159937623 TGGTGGGAGAAAGGGGAAGAGGG - Intronic
916028399 1:160855375-160855397 CAGTGTGGGAAGGAGGAAGATGG + Intronic
916427270 1:164692639-164692661 AGGTGTGAGCGTGGGGAATAGGG + Intronic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
917613196 1:176710922-176710944 TGTTTTGAGCAGGAGGAAGAAGG - Intronic
917776724 1:178345073-178345095 CGGTTTGAGTAGGGGCAAGGAGG - Intronic
918106417 1:181419208-181419230 CTGGCTGGGCAGGGGGAAGAGGG - Intronic
918624730 1:186644356-186644378 GGGTGTGGGCAGTGGGTAGATGG + Intergenic
920309660 1:205041616-205041638 CAGTGTGGGCAGGGGAAGGAAGG + Intergenic
920430727 1:205917236-205917258 GGGTGGGAGCAGGGCGAAGAGGG - Intronic
920552000 1:206869803-206869825 CAGAGTGAGGTGGGGGAAGAAGG - Intergenic
920561473 1:206941923-206941945 CGCTGTAAGCAGGAGGAAGCTGG + Intronic
921455822 1:215370337-215370359 GGGTGTGAGCAGGGGGGGAAGGG - Intergenic
921730829 1:218576239-218576261 TGGTGAGGGCATGGGGAAGAGGG + Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
923051018 1:230391562-230391584 AGGTGTGAGGAGGAGGGAGAGGG - Intronic
923482427 1:234397416-234397438 AGGGGGGAGGAGGGGGAAGAGGG + Intronic
923482436 1:234397435-234397457 AGGGGGGAGGAGGGGGAAGATGG + Intronic
923907504 1:238401778-238401800 CAGCCGGAGCAGGGGGAAGAGGG + Intergenic
924802311 1:247336359-247336381 ATGTGAGAGCAGGAGGAAGAGGG + Intergenic
1062901054 10:1147446-1147468 CGGTGTGTGTAGGGGGAGGAGGG + Intergenic
1063298826 10:4833506-4833528 GGGTGTGAGCACGGGGAGGAAGG - Intronic
1063386564 10:5619835-5619857 AGGGCTGAGGAGGGGGAAGAGGG + Intergenic
1064322867 10:14321957-14321979 TGGTGGGAGCAGGAGGAAGAGGG - Intronic
1064449183 10:15426189-15426211 TGGTGGGGGCGGGGGGAAGAGGG + Intergenic
1067145315 10:43689721-43689743 AGCTGTGAGCGGGAGGAAGAGGG + Intergenic
1067274050 10:44818982-44819004 CAGGGTGAGCAGGGGTCAGAAGG + Intergenic
1067431846 10:46250468-46250490 CTGTGGGAGGAGGGGGCAGATGG - Intergenic
1067441574 10:46311710-46311732 CTGTGGGAGGAGGGGGCAGATGG + Intronic
1067794083 10:49308131-49308153 GGATGTGAGCAGGGGGTAGCAGG - Intronic
1071829338 10:89356210-89356232 TGGGGTGAGTAGGGGGAGGAAGG + Intronic
1072188201 10:93061504-93061526 CAGTGGGAGCCGGGGGAAGAAGG - Intronic
1072264772 10:93716668-93716690 TGGTGGGAGCAGGAGGAAGTAGG + Intergenic
1072424707 10:95320291-95320313 ATGTGTGAGCAGGGGCAGGAAGG - Intronic
1072724268 10:97801790-97801812 CTGGGTGAGAAGGGGGAGGATGG + Intergenic
1072785036 10:98273562-98273584 CTGGGGGTGCAGGGGGAAGAGGG - Intergenic
1073570909 10:104580416-104580438 CGGTGTGAGGGGGGAGGAGATGG + Intergenic
1074082945 10:110182231-110182253 CTGTCTGGGCAGGAGGAAGAAGG - Intergenic
1074537954 10:114342279-114342301 AGGTATGAGCAGGGAGGAGAGGG - Intronic
1074735146 10:116423399-116423421 CAGAGTGAGCAGGGGGAAATCGG + Intergenic
1074945835 10:118279616-118279638 CGACTTGAGCAGGGGGAACAAGG + Intergenic
1075550908 10:123391614-123391636 CAGTCTGAGTTGGGGGAAGAGGG + Intergenic
1076120941 10:127935938-127935960 AGGTGAGAGCAGAGGGAAGAAGG - Intronic
1076194877 10:128510696-128510718 AGGCGTGAGCAGGGAGAAGGAGG + Intergenic
1077865898 11:6221570-6221592 TGTAGTGAGCAAGGGGAAGAAGG - Intronic
1078657954 11:13259965-13259987 CTGTGTGGGCGGGGGGCAGAGGG + Intergenic
1079117005 11:17646279-17646301 GGGTGAGAGCTGTGGGAAGATGG + Intronic
1080216380 11:29846359-29846381 CGGGGTGGGGATGGGGAAGAGGG - Intergenic
1080824283 11:35834869-35834891 AGCAGTGAGCAGGGGGAAGGTGG - Intergenic
1083397662 11:62402446-62402468 CGCTGTGGGCAGAGGGAAGAGGG - Intergenic
1083614107 11:64018058-64018080 GGGGGTGAGCTGGGGGCAGAGGG + Intronic
1083962225 11:66020851-66020873 CAGCGTGAGCAAGGTGAAGAGGG + Exonic
1085082795 11:73647894-73647916 AGGTGTGAGCAGGTGGGGGAGGG + Intronic
1085255443 11:75170077-75170099 ATGTGTGAGCAGGGGGCTGAGGG - Intronic
1085758759 11:79223819-79223841 TGGTGGGAGCAGTGGGAAAAAGG - Intronic
1085885501 11:80517329-80517351 TTGTCTGAGCAGGAGGAAGAGGG - Intergenic
1085986518 11:81794062-81794084 CGGTGAAAGCAGGAGCAAGAGGG - Intergenic
1086203132 11:84227328-84227350 CTGTGTGATCAGAGGGAATAAGG + Intronic
1087434143 11:98091206-98091228 CTGTGTGTGTAGGGGGATGAAGG + Intergenic
1089490774 11:118882489-118882511 AGGTGTGAAGAGGGGAAAGAGGG + Intergenic
1089785565 11:120904630-120904652 GGTTGTGAGCAGGGGCGAGATGG - Intronic
1090469733 11:126969474-126969496 AGGTGTGAACCAGGGGAAGAGGG + Intronic
1090986898 11:131775551-131775573 TGGTGTCAACAGAGGGAAGAGGG - Intronic
1091349054 11:134878440-134878462 AGTGGTGGGCAGGGGGAAGAAGG - Intergenic
1091935994 12:4434921-4434943 CTGTGTGTGGTGGGGGAAGAAGG + Intronic
1092247272 12:6870696-6870718 CGGTGTAAGAAGGGAGAGGATGG - Exonic
1092505455 12:9093941-9093963 AGGAGTGAGCTGGGGGAGGAGGG + Intronic
1093617702 12:21248284-21248306 CGGTGAGAGCAGGTGCAAAAGGG + Intergenic
1093958826 12:25251052-25251074 CGGTGTGGGAAGAGGGAAGAGGG + Intergenic
1095367983 12:41430938-41430960 TGGTGAGAGCAGGAGCAAGATGG + Intronic
1096258901 12:50078824-50078846 AGGTGTAAGCTGGGAGAAGATGG - Intronic
1096489309 12:52005114-52005136 AGGTGGGAGGAGGGAGAAGAAGG + Intergenic
1096534381 12:52261788-52261810 TGATGAGAGCAGGGGGAAGGAGG + Intronic
1098519929 12:71423621-71423643 CAGTGTGAGCAAGAGGATGATGG - Intronic
1098995736 12:77117401-77117423 CTTAGAGAGCAGGGGGAAGATGG - Intergenic
1099921601 12:88964511-88964533 CTGTGTGTCCAGGGGCAAGAAGG - Intergenic
1100172136 12:91986990-91987012 GGGTGGGAGAAGGTGGAAGAGGG - Intronic
1101350283 12:103923849-103923871 TGGTGTGAGCTGGGGTAACAGGG + Intergenic
1101999112 12:109545623-109545645 CGGTTTGAGCAGGCAGAAGAGGG + Intergenic
1102138391 12:110594313-110594335 CGAGGTCAGCAGGGGGAACATGG - Intergenic
1102642480 12:114379240-114379262 CGTTGTGTGCAAGGGGAAGCAGG - Intronic
1102910342 12:116708807-116708829 CGGAGGGTGCAGGAGGAAGAAGG + Intergenic
1104352219 12:128054505-128054527 CGGTGTCTGCAGGGGAAAGTCGG + Intergenic
1104374129 12:128249147-128249169 CGGTGTGAGCTGGGGTTAGCTGG + Intergenic
1104850826 12:131872739-131872761 GGACGTGAGGAGGGGGAAGAAGG - Intergenic
1105451263 13:20502335-20502357 CTGAGTGAGGAGGGGGAAGCGGG - Intronic
1109778972 13:67082243-67082265 CGCTGGGAGCAGGAGGAAGTAGG - Intronic
1112281155 13:98064235-98064257 AGTTGGGAGCAGGGGGATGAGGG - Intergenic
1112292500 13:98157304-98157326 GGGACTGATCAGGGGGAAGAGGG - Intronic
1113339918 13:109412432-109412454 CAGTGTGAGGGAGGGGAAGAGGG - Intergenic
1114317515 14:21522399-21522421 AGGAGAGAGGAGGGGGAAGAAGG + Exonic
1114638346 14:24201750-24201772 TGGTGGGAGCAGGAGCAAGAGGG + Intronic
1115140679 14:30167979-30168001 TGGTGAAAGCAGGAGGAAGAAGG + Intronic
1115697764 14:35919055-35919077 GGGAGAGAGAAGGGGGAAGAAGG + Intronic
1116152981 14:41165792-41165814 AGTTTGGAGCAGGGGGAAGAAGG - Intergenic
1117119311 14:52551945-52551967 ATCTGTGAGCAGGGGGAAGCTGG - Intronic
1117411109 14:55451975-55451997 GGGGTTGAGCAGGTGGAAGATGG - Intronic
1118333528 14:64832754-64832776 TGGTGTGATGAGAGGGAAGAAGG - Intronic
1118780529 14:69004842-69004864 CAGGGAGAGCTGGGGGAAGAGGG - Intergenic
1118891875 14:69916762-69916784 GGGTGTAAGGAGGGTGAAGATGG - Intronic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1121089820 14:91173514-91173536 CGATGTGAACAGGGGGATCATGG - Intronic
1121565645 14:94907436-94907458 CGGTGTGAACAGGGACCAGAAGG + Intergenic
1122809565 14:104281340-104281362 GGCTGTGAGCAGGGGGAGGGCGG - Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1123155797 14:106224675-106224697 CATGGTGAGCAGGGGAAAGAAGG + Intergenic
1123402527 15:20002802-20002824 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1123511865 15:21009456-21009478 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1124023706 15:25945663-25945685 CTGTGTGAGCAGTGGGCGGAGGG + Intergenic
1124114385 15:26827646-26827668 CAGTGTGAGCTGGGGCAGGAGGG - Intronic
1125909164 15:43420922-43420944 GGGTGTCAGGAGGGAGAAGAGGG - Intronic
1126158478 15:45587153-45587175 TGGTGGGAGCTGGGGGAGGACGG - Exonic
1126697668 15:51340026-51340048 TGGTGGGAGCAGGAGGAAGAGGG + Intergenic
1127062084 15:55196967-55196989 CGGTCGGGGAAGGGGGAAGAAGG - Exonic
1128498207 15:68210244-68210266 CGGTGTGTGGAGAGGGGAGAGGG - Intronic
1129108270 15:73323309-73323331 CGGGGTGAGCAGGGGAGAGTCGG + Exonic
1129281731 15:74490300-74490322 CAGGGTGAGCAGCCGGAAGAGGG - Intergenic
1130517734 15:84639126-84639148 GGGTGGGAGCAGGGGGGTGAGGG - Intergenic
1131983387 15:98017408-98017430 CAGAGGGAGCAGGGGGAGGATGG - Intergenic
1132066110 15:98732554-98732576 TGGAGTGAGCATGGGGAAGGGGG + Intronic
1132481546 16:168781-168803 AGGTGTGAGCAGGGAGAGGAGGG - Intergenic
1133285491 16:4688769-4688791 AGGTGGGAGCAGAGGGAGGAGGG - Intronic
1133423999 16:5671846-5671868 CAGTGTGAGCTGGGGGTTGAAGG + Intergenic
1133647247 16:7775856-7775878 AGGGGAGAGCAGGGGGAAGAGGG + Intergenic
1133978768 16:10618699-10618721 GGCTGTGAACTGGGGGAAGAAGG + Intergenic
1134233879 16:12450585-12450607 CGGTGTGAGAGAAGGGAAGACGG + Intronic
1134311168 16:13076462-13076484 AGGAGGGAGCAGGGGGAAGTGGG - Intronic
1134803560 16:17106729-17106751 GGGGGTGAGTAGGGGGAGGATGG + Exonic
1135524180 16:23201268-23201290 CAGTTTGAAAAGGGGGAAGAGGG - Intronic
1135627263 16:24006836-24006858 GGGGGTGGGGAGGGGGAAGAAGG + Intronic
1135695328 16:24581361-24581383 CGGTGGGGGGAGGGGGAAGATGG - Intergenic
1136153727 16:28368380-28368402 CGGTGGGAGCAGCGGGAAGCCGG - Intergenic
1136209365 16:28746890-28746912 CGGTGGGAGCAGCGGGAAGCCGG + Intergenic
1136450407 16:30351533-30351555 CGGTGTGAGCAGGCACTAGAAGG + Exonic
1136641443 16:31568904-31568926 CGCTGGGAGGAGGAGGAAGAAGG - Intergenic
1137481674 16:48856961-48856983 AGTTGTGTGCATGGGGAAGATGG + Intergenic
1137572820 16:49577971-49577993 CACTGTGGGCAGGTGGAAGAAGG + Intronic
1137637134 16:49996345-49996367 CTGCCTGAGCAGGTGGAAGAGGG - Intergenic
1137754352 16:50889601-50889623 CAGTCTGAGCAGGGTGATGAAGG - Intergenic
1138116289 16:54363041-54363063 GGGTGAGAGCAAGGGGAAGAGGG - Intergenic
1138496751 16:57413518-57413540 TGGCTTGAGCAGGGGGCAGACGG - Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140235194 16:73152794-73152816 CGGGGTGAGGAGGGGAGAGAAGG + Intergenic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1141150098 16:81558602-81558624 TGGAGTGAGCAAGGGGCAGAAGG + Intronic
1141380858 16:83575496-83575518 TGGTGTGAGCAGGGGCTGGATGG - Intronic
1141507289 16:84486267-84486289 CGGTGGGGGCAGGGGCAGGAAGG + Intronic
1141619594 16:85229873-85229895 CAGGGTGAGAAGGGGGTAGAGGG + Intergenic
1141623654 16:85250179-85250201 TGGTGTGGGCAAGGGGAAGAGGG - Intergenic
1141906820 16:87032225-87032247 GGGTGTGAGCTGGTGGGAGAGGG - Intergenic
1142183058 16:88681044-88681066 CGGTCTGGGCTGGGGGAAGAGGG - Intronic
1142359480 16:89619542-89619564 CGGGGGGAGCAGGGGGAAAGCGG - Intronic
1142359498 16:89619582-89619604 CGGGGGGAGCAGGGGGACCAGGG - Intronic
1142690669 17:1604719-1604741 AGGTGAGGGCAGGGGGCAGATGG - Intronic
1143003699 17:3812930-3812952 CTGTGTGAGCAGGAGCGAGAGGG + Exonic
1143594565 17:7906581-7906603 CTGTGTGAGCCTGGGGCAGACGG + Exonic
1144376716 17:14650197-14650219 TGGTAAGAGCAGGGAGAAGAGGG + Intergenic
1144450924 17:15377805-15377827 AGTTCTGAGCAGGGGGCAGAGGG + Intergenic
1144884919 17:18451338-18451360 CGGTGGGAGCAGGGAGGAGGGGG - Intergenic
1145147304 17:20493039-20493061 CGGTGGGAGCAGGGAGGAGGGGG + Intergenic
1145813857 17:27781542-27781564 CTGGGAGAGCAGGGGGAAGATGG - Intronic
1146215105 17:30972557-30972579 AGATGTGAGCAGGGGCTAGAGGG - Intronic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1147038068 17:37696487-37696509 GAGTGTGAGCAGGAGGGAGAAGG - Intronic
1149304630 17:55335827-55335849 GGGAGGGAGCAGAGGGAAGAGGG - Intergenic
1151159120 17:72150119-72150141 GGGTGGGGGCAGGGGGAACAGGG + Intergenic
1151649955 17:75460973-75460995 GGGTGGGAGCAGGGGGGAAATGG - Intronic
1151765356 17:76130876-76130898 TGGTGAGAGCAGGAGGAAGAGGG - Intergenic
1152190749 17:78885854-78885876 CGGGGTGAGCCAGGGGAAGCTGG + Intronic
1152232801 17:79123068-79123090 GGGTGTGGGCTGGGGGAAGGTGG + Intronic
1154241711 18:12658440-12658462 CGGGGGGCGCAGGGGCAAGAGGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156492012 18:37501899-37501921 TGGTGAGAGAAGGGGGAAAATGG - Intronic
1157811876 18:50703168-50703190 GGGAGTGAGCATGGGGAGGAGGG - Intronic
1157826109 18:50813846-50813868 GGGTGGGAGGAGGGTGAAGATGG + Intronic
1158431909 18:57396759-57396781 GGGTGAGAGGAAGGGGAAGAAGG + Intergenic
1158505608 18:58044197-58044219 CGGTGGGAGGAGGCGGAGGAGGG + Intergenic
1159060357 18:63508147-63508169 AGGGGTGAGCTGGGGGAGGAGGG + Intergenic
1159227515 18:65558131-65558153 CGTTGTGAGGTGGGGGAAGGGGG + Intergenic
1159730659 18:72023135-72023157 ATGTGTGAGTTGGGGGAAGAGGG - Intergenic
1160191878 18:76721506-76721528 CAGTAGGGGCAGGGGGAAGATGG + Intergenic
1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG + Intergenic
1161236660 19:3201635-3201657 CGGGGTGGGCAGGGGGATGGGGG + Intronic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161489090 19:4552125-4552147 GGGTGTGAGATGGAGGAAGAGGG - Intronic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161625608 19:5324834-5324856 CAGTGTGAGGATGGGGATGATGG - Intronic
1161934391 19:7362636-7362658 TGGTGAGGGGAGGGGGAAGATGG - Intronic
1164441536 19:28283623-28283645 TGGGGTGAGCAGGTGGAAAAAGG - Intergenic
1165245589 19:34496718-34496740 GAGTGAGGGCAGGGGGAAGAGGG + Intronic
1165996769 19:39849182-39849204 AGGTGTGATCATGGGAAAGAAGG - Intergenic
1166318539 19:42002575-42002597 GGATGTGAGGAGGGGGAGGAAGG + Intronic
1166391000 19:42408900-42408922 CAGAGTGAGCAGTGGGGAGAGGG + Intronic
1166410256 19:42552020-42552042 CGGTGTGTGCAGGTGGGATAAGG + Intronic
1166459010 19:42969541-42969563 AGATGAGAGCAGGGGTAAGAAGG + Intronic
1166475953 19:43124817-43124839 AGATGAGAGCAGGGGTAAGAAGG + Intronic
1167537734 19:50065751-50065773 GGGTGTGAGCAGGGGAGGGAGGG + Intergenic
1167619602 19:50553410-50553432 GCGAGTGAGCAGGGGGAGGAGGG - Intronic
1167744574 19:51342964-51342986 GGCTGTGAGCAGGGGGAGGCAGG - Intergenic
925606638 2:5666945-5666967 AGGGCTGAGCAGGGGGAGGAGGG - Intergenic
925831980 2:7904587-7904609 CTGTGTGAGCAGGGGACAGAGGG - Intergenic
927444011 2:23141915-23141937 AGGTGGGAGAATGGGGAAGAAGG + Intergenic
931423754 2:62152109-62152131 GGAGGTGAGCAGAGGGAAGATGG - Intergenic
932466476 2:71927398-71927420 CGCTGTGAGCTGGGGAAGGAAGG + Intergenic
933286627 2:80391239-80391261 TGGTGTGAACAGAGTGAAGAGGG - Intronic
935673685 2:105576288-105576310 CTCTGTGAGCAGGGGGAGGAGGG + Intergenic
936503026 2:113081505-113081527 AGGTGGGAGTAGTGGGAAGAGGG + Intergenic
937921802 2:127136547-127136569 GGGTGGGAGACGGGGGAAGACGG + Intergenic
937979582 2:127607166-127607188 AGGTGAGATCAGGGGCAAGAAGG - Intronic
938193030 2:129300226-129300248 CGGTCTGAGCAGGAGGAAACAGG - Intergenic
938583960 2:132670861-132670883 CGGTGCGCGCAGGCGGGAGAAGG - Intronic
938736650 2:134191893-134191915 TGGCGTGAGCAGGAGAAAGAGGG - Intronic
938757281 2:134392541-134392563 TGGTGGGAGCAGGGGAAGGAAGG + Intronic
938944127 2:136195582-136195604 CAAAGTGAGCTGGGGGAAGATGG - Intergenic
939103222 2:137920085-137920107 CGTTGTGAGGGGGAGGAAGAAGG - Intergenic
942299180 2:174545983-174546005 CTGGCTGAGCAGGTGGAAGAAGG + Intergenic
942541604 2:177020936-177020958 CAGTGTGAGCATGGGGGTGAGGG - Intergenic
943850905 2:192721542-192721564 TGGTGGGAGCAGGAGCAAGAGGG - Intergenic
944272719 2:197802050-197802072 GGGGGTGAGCAGGGGTAGGAAGG - Intergenic
944273052 2:197804821-197804843 CGATGTGAGCGGGAGGCAGAAGG - Exonic
944494673 2:200294815-200294837 AGCTGTGAGCAGGTGTAAGATGG - Intergenic
945188388 2:207163072-207163094 CGGTTTTGGGAGGGGGAAGAAGG + Intronic
945194714 2:207227380-207227402 AGGTGGGGGGAGGGGGAAGATGG + Intergenic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
946118695 2:217489682-217489704 AGGTCTGAGCTGGGGGAATACGG - Intronic
946178273 2:217935170-217935192 CAGGGTGAGGAGGGGGAGGAAGG + Intronic
946374737 2:219301326-219301348 GGGTGTGAGCAGGGAAAAGGAGG - Intronic
946396302 2:219445344-219445366 AGGTGGGAGCAGGGGGATGTGGG - Intronic
946965377 2:225031531-225031553 AGGTGTGAGCAGGGAGAAGGAGG + Intronic
948266309 2:236637682-236637704 GTGTGGGGGCAGGGGGAAGATGG - Intergenic
948889560 2:240900334-240900356 CGGTGTGAGAGAGGGGAAGGGGG + Intergenic
1169085247 20:2822089-2822111 GGGTGGGAGTAGGGCGAAGAGGG + Intergenic
1169347707 20:4841896-4841918 GGATGGGAGCAGGGGGGAGATGG - Intergenic
1171868152 20:30505616-30505638 AGGGGGGAGCAGGGGGAGGAAGG - Intergenic
1172101056 20:32484034-32484056 CGGTGGGGGCTGGGGGGAGAGGG + Intronic
1172402461 20:34661345-34661367 GGGTGGGAGGAGGGTGAAGATGG - Intronic
1172656999 20:36543453-36543475 GGGTTTGGGCAGAGGGAAGAGGG + Intronic
1172693048 20:36803642-36803664 GACTGTGAGCAGTGGGAAGAAGG + Intronic
1172758161 20:37302004-37302026 AGGTGTGGGCAGGGGCCAGAGGG + Intronic
1173619514 20:44426067-44426089 CTGTGGAATCAGGGGGAAGATGG + Intronic
1173654937 20:44693445-44693467 GGGTGCGAGCAGGGAGGAGAAGG - Intergenic
1173980152 20:47217855-47217877 GGGGGCGAGCAGGGGGAGGAAGG - Intronic
1175385537 20:58592630-58592652 CGGGGTGAGATGAGGGAAGATGG + Intergenic
1175966713 20:62663491-62663513 CGGTGTGAGCAGAGGCGACATGG + Intronic
1176142257 20:63549936-63549958 AGGTGCAAGGAGGGGGAAGATGG - Intronic
1176598236 21:8767587-8767609 TGGGGTGGGCAGGGGGAGGAGGG - Intergenic
1177019033 21:15829293-15829315 GGGTGGGAGCAGGGTGAGGATGG - Intronic
1177115066 21:17075313-17075335 TGGAGTGGGCAGGGGGGAGAGGG + Intergenic
1177259182 21:18706909-18706931 GAGGGTGAACAGGGGGAAGAGGG - Intergenic
1177558216 21:22718144-22718166 TGGTAAGAGCAGGGGCAAGAGGG + Intergenic
1178234269 21:30823238-30823260 TGGCTTGAGCAGGAGGAAGAGGG - Intergenic
1179366773 21:40765981-40766003 CTGTGATAGCAGGGGTAAGAGGG - Intronic
1179635070 21:42703553-42703575 CGCTGGGAGCAGAGGAAAGAGGG + Intronic
1179673940 21:42969078-42969100 GGGTGTGTGCAGGGGGCAGTGGG + Intergenic
1179769860 21:43606419-43606441 TGGTGTGAGCAGGAGGAAAGAGG + Intronic
1180393977 22:12312526-12312548 AGGTGTAAGCAGGAGGCAGAAGG - Intergenic
1180405770 22:12552224-12552246 AGGTGTAAGCAGGAGGCAGAAGG + Intergenic
1180669127 22:17539507-17539529 TGTTGTGAGGTGGGGGAAGAGGG + Intronic
1181324221 22:22032482-22032504 TCTTGTGAGCAGGGGGTAGAGGG - Intergenic
1182844835 22:33421834-33421856 GGGGGTAAGCAGGTGGAAGAGGG + Intronic
1183498057 22:38161690-38161712 AGGTGTGTGCATGGGGTAGAGGG + Intronic
1183705704 22:39473867-39473889 GTGTGTGGGCAGGGGGCAGATGG + Intronic
1184067663 22:42129566-42129588 AGGTGTGAGCATGGGGACGAGGG - Intronic
1184067775 22:42130006-42130028 AGGAGTGAGCAGGTGGAAGGAGG + Intronic
1184070510 22:42143678-42143700 AGGAGTGAGCAGGTGGAAGGAGG + Intergenic
1184072250 22:42153313-42153335 AGGAGTGAGCAGGTGGAAGGAGG + Intergenic
1184156542 22:42671227-42671249 GGGTGGGAGCAGGGTGAGGATGG + Intergenic
1184251609 22:43263558-43263580 CGGTGTGTCCCGGGGGAAGGAGG - Intronic
1185025453 22:48407479-48407501 CGGTGTGGGCAGGAGGGAAAAGG - Intergenic
949368641 3:3310460-3310482 CAGTGTGAGCTGGAGGCAGAGGG - Intergenic
950618090 3:14178465-14178487 CGGCGTGAGGAGGAGGAGGAGGG - Exonic
952883544 3:37999450-37999472 CTGGGTTAGCTGGGGGAAGATGG + Intronic
955128833 3:56143105-56143127 AAGTGTGAGGAGGGGGAATATGG + Intronic
955550472 3:60079480-60079502 TGGTGGGAGCAGGGAGCAGAGGG - Intronic
957553079 3:81731718-81731740 TGGTTGGAGCAGGAGGAAGAGGG - Intronic
957683462 3:83469854-83469876 AGGGGAGAGGAGGGGGAAGATGG + Intergenic
959717986 3:109454440-109454462 GGGTGTGTGTAGGGGGAAGTGGG + Intergenic
960885052 3:122384691-122384713 AGGAAGGAGCAGGGGGAAGAGGG - Intronic
961612613 3:128152971-128152993 CGGGGTGGGCGGGGGGAAGACGG - Intronic
962075192 3:132074099-132074121 GGGTGGGGGCAGGGGTAAGATGG + Intronic
962202817 3:133414844-133414866 AGGTGTGAGTAGATGGAAGAGGG - Intronic
962203070 3:133415826-133415848 AGGGGTGAGTAGAGGGAAGAGGG - Intronic
962203128 3:133416072-133416094 AGGGGTGAGTAGAGGGAAGATGG - Intronic
962273953 3:133998397-133998419 GGGTGGGAGCAGGGGGAGGCAGG - Intronic
962754455 3:138457354-138457376 CTGTGTGAGTAGGGGCAGGAAGG + Intronic
962756391 3:138468250-138468272 AGGTGTGTGCAGGTGGAGGAAGG + Intronic
962821741 3:139055018-139055040 AGGTGTGCAGAGGGGGAAGACGG + Intronic
962841916 3:139241314-139241336 CGGGGTGGGGAGGGGGAAGGAGG - Intronic
963327340 3:143877116-143877138 AGGTGTGGGGAGGGGGAGGAGGG - Intergenic
964662864 3:159140057-159140079 GGGGGTGAACAGGGGGAACATGG - Intronic
968248131 3:197176224-197176246 GTGTGTGAGCAGGGGGCATATGG - Intronic
968914350 4:3490741-3490763 AGGAATGAGCAGGAGGAAGAAGG - Intronic
969307737 4:6335463-6335485 AGGAGTGAGCAGGGGGAACAGGG + Intronic
969407278 4:7001924-7001946 CGGTCTGAGCTGTGGAAAGACGG + Intronic
969586461 4:8097005-8097027 GGGAGGGAGCAGGAGGAAGAAGG + Intronic
969884907 4:10206697-10206719 CAGTGTGAGGTGGGGGATGACGG + Intergenic
970613080 4:17743426-17743448 CGTTGAGAGCAGGTGGAAGCAGG + Intronic
971400859 4:26274175-26274197 GGGTGTGAGCATGGGGCAGATGG - Intronic
972287458 4:37662773-37662795 AGGTGGGAGGTGGGGGAAGATGG - Intronic
972840974 4:42929618-42929640 AGGTTTGAGAAGGTGGAAGACGG + Intronic
973979076 4:56291648-56291670 TGGTGAGAGCAGGAGAAAGAGGG - Intronic
974750479 4:66134009-66134031 TGTTGTGAGGTGGGGGAAGAGGG + Intergenic
975147062 4:70980143-70980165 GAGTGTGTACAGGGGGAAGATGG - Intronic
975177188 4:71301412-71301434 CGGAGTTAGGAGAGGGAAGAAGG + Intronic
976403702 4:84637433-84637455 TGGTCAGAGCAGGAGGAAGAGGG + Intronic
976953590 4:90865976-90865998 TGGTCAGAGCAGGAGGAAGAGGG + Intronic
977378452 4:96238342-96238364 TGGTGGGAGAAGGAGGAAGAGGG - Intergenic
977390158 4:96399020-96399042 CTGTGTGGACAGGGGAAAGAAGG - Intergenic
978924830 4:114230961-114230983 TGGTGGGAGCAGGAGAAAGAGGG + Intergenic
980563007 4:134502003-134502025 AGGTGGGGGCAGGGGGAAGGGGG - Intergenic
980826728 4:138082150-138082172 TGGTCTGAGCATGGGGAGGAGGG - Intergenic
982652921 4:158109322-158109344 TGGTGGGAGCAGGAGCAAGAGGG - Intergenic
983631455 4:169853486-169853508 TGGTCAGAGCAGGAGGAAGAGGG - Intergenic
984710651 4:182881331-182881353 GGGTGGGAGCAGGGAGGAGAGGG - Intergenic
986581459 5:9270701-9270723 GGGTGGGGGCAGGGGGAGGAGGG + Intronic
986811507 5:11364717-11364739 CGGTGTGTGCTGGCGGCAGAGGG + Exonic
987064994 5:14281302-14281324 TGGTTGGAGCAGGAGGAAGAGGG + Intronic
987299624 5:16585806-16585828 TGGTGGGAGCAGTGGCAAGAGGG + Intronic
989570723 5:42943902-42943924 CGGTGTCAGCTGGTGAAAGAAGG + Intergenic
990334779 5:54761846-54761868 CTGTGTCTTCAGGGGGAAGAAGG + Intergenic
990446201 5:55896608-55896630 GGGAGTGGGCAGGGGGAAGGTGG - Intronic
991680517 5:69134877-69134899 CGGGGTGGGTTGGGGGAAGAGGG + Intergenic
992232459 5:74676777-74676799 CGGTGCGGGAAGGTGGAAGAAGG + Intronic
992270935 5:75062300-75062322 TGGTGGGAGCAGGAGGAAGTGGG - Intergenic
994133211 5:96255111-96255133 GGGGGTTGGCAGGGGGAAGAAGG + Intergenic
994269276 5:97757982-97758004 AGGTGTGTACAGGAGGAAGATGG - Intergenic
995414314 5:111891725-111891747 TGGTGGGAGCAGGAGCAAGAGGG + Intronic
997415768 5:133727453-133727475 AGGTGTGCCCAGTGGGAAGATGG - Intergenic
998562121 5:143181424-143181446 AGGTGTAAGGAGGGGGAAGCAGG - Intronic
999720577 5:154396379-154396401 AGGTGGGAGCAGGTGGCAGAGGG + Intronic
1000427693 5:161112030-161112052 CTGTATGAGTAGGGGTAAGAAGG - Intergenic
1002060143 5:176621052-176621074 AGGTGGGAGCAGGGAGGAGAGGG - Intronic
1002597268 5:180332246-180332268 CGGGGGGAGCAGGGGGATGCGGG + Intronic
1002599930 5:180348295-180348317 CTGTGTGTGTTGGGGGAAGAGGG + Intronic
1002963117 6:1936257-1936279 CAATGTGAGCAGTGGCAAGAGGG + Intronic
1003285667 6:4731889-4731911 CTGTGGAAGGAGGGGGAAGATGG + Intronic
1003750742 6:9052416-9052438 CTGTGTGAGCAGGGCTAAAAGGG + Intergenic
1004273070 6:14212030-14212052 AGGTGGGAGCAGGGAGTAGAGGG - Intergenic
1004415221 6:15417146-15417168 GTGGGTGAGTAGGGGGAAGAGGG + Intronic
1004589311 6:17033219-17033241 AGGTGGGAGCATGGGAAAGACGG - Intergenic
1005556874 6:26994953-26994975 TGGCCGGAGCAGGGGGAAGAGGG + Intergenic
1005994482 6:30922998-30923020 CGGGGTGAGCAGAGGGCAGCGGG + Intronic
1006295324 6:33167577-33167599 GGGTGTGGGCAGGGGGCAGAGGG + Intronic
1007386615 6:41524368-41524390 AGGAGTGAAAAGGGGGAAGAGGG + Intergenic
1009935955 6:70234828-70234850 CGGGGTGTGCAGGGAGAACAGGG - Exonic
1011075074 6:83430711-83430733 TGGTGTGGGCAGAAGGAAGAAGG - Intronic
1011162462 6:84406815-84406837 CGGTTTTAGAAGGTGGAAGAAGG + Intergenic
1011394435 6:86891462-86891484 GGGTGGGGGCTGGGGGAAGAGGG + Intergenic
1015816781 6:137219270-137219292 GGGTGTGAGCAGGGCTGAGATGG - Exonic
1016404593 6:143716830-143716852 CTGGGTGAGCAGGGAGAGGAGGG + Intronic
1017521772 6:155208966-155208988 CGGGGTGGGCAGCGGGGAGAGGG - Intronic
1017939132 6:159036096-159036118 CGTGGTGAGCAGGTGGAAGAGGG + Exonic
1018211494 6:161487059-161487081 CGGAGTGAGACGGGGAAAGATGG + Intronic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1018908878 6:168090506-168090528 CAGTGAGAACAGGGAGAAGATGG - Intergenic
1018980630 6:168599077-168599099 CGGTGTGTGTTGGGGGAAGTGGG - Intronic
1019059098 6:169242836-169242858 AGGTGGGAGCAGTGGGAAGGTGG - Intronic
1019059137 6:169242952-169242974 AGGTGGGAGCAGTGGGAAGGTGG - Intronic
1019059177 6:169243075-169243097 AGGTGGGAGCAGTGGGAAGGTGG - Intronic
1019346217 7:531975-531997 CGCAGAGAGCAGGGGGAAGCTGG + Intergenic
1019404715 7:877382-877404 CGGAGGGAGCAGGGGGAGGCTGG - Intronic
1019463210 7:1172444-1172466 CTGAGTGAGTAGGGGGAAGCTGG - Intergenic
1020107354 7:5428265-5428287 CGGCGTGAGCAGCGGGAAGGAGG - Intergenic
1021668771 7:23014063-23014085 CAGTGAGAGGAGGGGGAAGATGG - Exonic
1022836980 7:34127492-34127514 TGGTGGGATCAGGGAGAAGAGGG - Intronic
1023465201 7:40447105-40447127 CAGTGGAAGCTGGGGGAAGATGG - Intronic
1023878683 7:44306727-44306749 GGGTGTGGGCAGGAGGAGGAGGG + Intronic
1023878719 7:44306845-44306867 GGGTGTGAGCAGGGGAAGGAAGG + Intronic
1023878724 7:44306865-44306887 AGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1023878754 7:44306982-44307004 GGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878757 7:44307002-44307024 GGGTGTGAGCAGGAAGAAGAGGG + Intronic
1023878769 7:44307042-44307064 GGCGGTGAGCAGGGGGAGGAGGG + Intronic
1023878776 7:44307062-44307084 GGGTCTGAGCAGGGGGAGGAGGG + Intronic
1023878793 7:44307119-44307141 GGGTGTGAGCAGGGGGAGGAGGG + Intronic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878806 7:44307179-44307201 GGGTGTGAGCAGAGAGAGGAGGG + Intronic
1023878816 7:44307216-44307238 GGGTATGAGCAAGGGGAGGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878826 7:44307256-44307278 GGGTGTGAGCAAGGGGAGGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878835 7:44307296-44307318 GGGTGTGAGCAGGCGGAGGAGGG + Intronic
1023878852 7:44307356-44307378 AGTTGTCAGCAGGGGGAGGAGGG + Intronic
1023878856 7:44307376-44307398 GGGTGTGAGCAGGGAGAAGAGGG + Intronic
1023878869 7:44307416-44307438 GGGTGTGATCAGGGGGAGGAGGG + Intronic
1024311613 7:47974671-47974693 AGGAGGGAGCAGGGGGAGGAGGG + Intronic
1025152906 7:56574428-56574450 TGGTGTGCGAAGGGGGAAGAGGG - Intergenic
1027529481 7:79312887-79312909 CGGTGGGTGGAGGGGGAGGAGGG - Intronic
1027659252 7:80969312-80969334 GGGTTTGGGCAGGGGGAAGGAGG + Intergenic
1027806349 7:82829309-82829331 GGGAGTAAGCAGGGGCAAGAGGG - Intronic
1028680759 7:93528423-93528445 TGTTGTGGGCTGGGGGAAGAGGG - Intronic
1028686329 7:93592320-93592342 CTTGGTGAGCAGGAGGAAGATGG - Intronic
1028965980 7:96801661-96801683 CAGTATGAGCTGGGGGAAGGGGG + Intergenic
1029043382 7:97600911-97600933 CAAGGTGAGCAAGGGGAAGAAGG + Intergenic
1029129221 7:98317584-98317606 CGGTGTGAACTGAGGGATGAGGG - Intronic
1030105536 7:105983903-105983925 CTGTTTGAGGTGGGGGAAGAAGG - Intronic
1031968831 7:128048915-128048937 CCGTGTGAACAGCTGGAAGAAGG - Intronic
1032492066 7:132331223-132331245 AGCTGAGAGCAGGAGGAAGATGG + Intronic
1034633936 7:152552475-152552497 GGGGGTGAGCAAGAGGAAGAAGG + Intergenic
1035108852 7:156463821-156463843 AGGTGTCACCTGGGGGAAGAGGG + Intergenic
1035160723 7:156948753-156948775 AGCAGTGAGCTGGGGGAAGACGG - Intergenic
1035339453 7:158151144-158151166 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339480 7:158151254-158151276 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339490 7:158151291-158151313 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339500 7:158151327-158151349 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339510 7:158151364-158151386 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339520 7:158151401-158151423 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339540 7:158151475-158151497 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035374103 7:158395939-158395961 CTCTGTGACCAGGGGGCAGAGGG - Intronic
1035655500 8:1302048-1302070 CTGTGTGTGCTGGGGGAAAAGGG + Intergenic
1036426485 8:8649635-8649657 GGGTGTGAGAAAGGGGAAGAGGG - Intergenic
1037116424 8:15235090-15235112 CGGTGTGATCAGTGGAGAGAGGG - Intronic
1037743493 8:21625644-21625666 TGGTGTGAAGAGGGGGAGGACGG + Intergenic
1038229337 8:25685836-25685858 GGGGGTGAGAAGTGGGAAGAGGG + Intergenic
1038243449 8:25831586-25831608 CGGTGGGGGCAGGGCCAAGATGG - Intergenic
1039364436 8:36915632-36915654 CAGTGTGAACAGGGTGAAGGAGG - Intronic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039468076 8:37797601-37797623 GGGTGGGAGCAGGGGGAAGGGGG + Intronic
1040626605 8:49157155-49157177 AGGAGTGAGCAGGGAGAAGATGG - Intergenic
1040972747 8:53154788-53154810 CGATGTGAACAGGCAGAAGATGG + Intergenic
1041329341 8:56707491-56707513 AGGTATGAGCAGGCGGGAGAGGG + Intergenic
1041950954 8:63501286-63501308 AGATTTGAGCAGGGAGAAGAAGG - Intergenic
1044681108 8:94778517-94778539 CGGAGGGAGCAGGGGACAGAGGG - Intronic
1044828829 8:96225080-96225102 AGGTTTGGGAAGGGGGAAGAGGG + Intergenic
1046131781 8:109975062-109975084 GGGTGTGAGCAGGTGGGGGAGGG + Exonic
1047157536 8:122337594-122337616 CGGTGGGTGGTGGGGGAAGATGG + Intergenic
1047171798 8:122500895-122500917 ATGTGTGAGCAGGGGCAACAGGG - Intergenic
1047682072 8:127264510-127264532 TGGTGGGAGCAGGAGGAAGAGGG + Intergenic
1047739257 8:127794121-127794143 CGGTGTGGGGAAGGGTAAGAGGG + Intergenic
1049108817 8:140630029-140630051 CGTTGTGAGCTGGGAGAAGCAGG - Intronic
1049412878 8:142481268-142481290 CGGTGTGAGCTGGACGAGGAAGG + Exonic
1049575845 8:143389241-143389263 CCCTGTGAGGAGGGGGAAGCCGG - Intergenic
1049616476 8:143577797-143577819 CGGAGTGAGTAGGGGTAAGCGGG - Exonic
1050062820 9:1728324-1728346 TGTGGTGAGCAAGGGGAAGATGG + Intergenic
1050151274 9:2621770-2621792 CGGGGTGAGCAGCGGGGAGGGGG - Intergenic
1052030107 9:23618927-23618949 CAGAGTGAGCAGGGAGAAGGAGG - Intergenic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1052973873 9:34398143-34398165 GGGTGTGGGCAAGGGGCAGATGG - Intergenic
1053621888 9:39828037-39828059 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053837821 9:42159895-42159917 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053883197 9:42616235-42616257 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1053889472 9:42678064-42678086 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1054222221 9:62423708-62423730 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1054228492 9:62485464-62485486 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1055398607 9:75899530-75899552 CGGGGTGAGGAGAGGGAGGAGGG - Intronic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1056544249 9:87600830-87600852 GGGTGTGAGGAGGGGGCAGAAGG + Intronic
1056546798 9:87620344-87620366 TAGTCTGAGGAGGGGGAAGAAGG - Intronic
1057117711 9:92541405-92541427 CGGGGTGGGGAGGGGGAAGGGGG - Intronic
1057169592 9:92953513-92953535 CAGTGTGAGCAGCGAGAAGCTGG - Intronic
1058075866 9:100650280-100650302 CAGTGTGAGCATGGGTAGGAAGG + Intergenic
1060106982 9:120878668-120878690 AGGTGAGAGCAGGGGGATCAAGG - Intronic
1061007464 9:127936306-127936328 AGGTGTGAGCAGAGTGATGATGG + Intronic
1061131866 9:128712994-128713016 TGGTGGTAGCAGTGGGAAGATGG + Intronic
1061836909 9:133335610-133335632 CGGTGTGGGGAGGAGGAGGATGG - Intronic
1062070811 9:134554086-134554108 CGGAGTGAGCAGGGGGGTGTGGG + Intergenic
1203767816 EBV:35435-35457 AGGTATGAGCAGGGGGAATCAGG - Intergenic
1185490942 X:516579-516601 CAGTGAGAGGAGGGGGGAGAAGG - Intergenic
1185647993 X:1628707-1628729 GGGAGAGAGGAGGGGGAAGATGG - Intronic
1187007614 X:15247870-15247892 CAGTGAGAGTAGGAGGAAGAAGG + Intronic
1187312446 X:18158214-18158236 TGGCCTGAGCAGGAGGAAGAGGG - Intergenic
1187356192 X:18574079-18574101 CAGTGTGAGAAGGAGGAAAATGG - Intronic
1188864240 X:35294914-35294936 TGCTATGAGCTGGGGGAAGAGGG - Intergenic
1189656344 X:43248786-43248808 CGGCTGGAGCAGGAGGAAGAGGG - Intergenic
1191965781 X:66756796-66756818 AGGTGTAAGCAGGGCCAAGAAGG - Intergenic
1193018172 X:76759376-76759398 CGCTGTGGGCTGGGGGAAGAGGG + Intergenic
1195318380 X:103700565-103700587 AGGGGTGGGTAGGGGGAAGAAGG + Intergenic
1195688159 X:107603618-107603640 TGCTGTGAGCAGAGTGAAGAGGG - Exonic
1195711802 X:107778925-107778947 TGGTGTGTGTAGGGGGAATAGGG + Intronic
1196396969 X:115274838-115274860 TGGTGAGAGCAGGAGCAAGAGGG - Intergenic
1196814791 X:119656472-119656494 AGGTTTGAGCAATGGGAAGACGG + Intronic
1197299324 X:124758870-124758892 AGTTGAGAGGAGGGGGAAGAGGG + Intronic
1198574401 X:137994169-137994191 GGTTATAAGCAGGGGGAAGAGGG + Intergenic
1198801010 X:140447762-140447784 GGGTGTGAGGTGGGGGATGAGGG - Intergenic