ID: 1023878803

View in Genome Browser
Species Human (GRCh38)
Location 7:44307159-44307181
Sequence GGGTGTGAGCAGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1599
Summary {0: 2, 1: 4, 2: 19, 3: 179, 4: 1395}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023878803 Original CRISPR GGGTGTGAGCAGAGGGAGGA GGG Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900156269 1:1204495-1204517 GGGTGTGGGGGGAGGGAGGGAGG + Intronic
900244102 1:1629821-1629843 GGGTGTGAGCCTTGGGAGGGCGG - Intronic
900320875 1:2082996-2083018 GGACATGAGGAGAGGGAGGACGG - Intronic
900337092 1:2169685-2169707 GGGTGCGCACAGAGGGATGACGG + Intronic
900337111 1:2169738-2169760 GGGTGTGCGCAGAGGGGAGGTGG + Intronic
900354476 1:2253676-2253698 CGGTGCGAGCAGATGGAGGATGG + Intronic
900471688 1:2858138-2858160 GGGTGTGAGCAAAGGGAGCCTGG - Intergenic
900505526 1:3028342-3028364 GGGTGTGAGCACAGGGCTGGGGG - Intergenic
900546257 1:3230896-3230918 AGGTGTGAGCAAAGGGAGCAGGG + Intronic
900565677 1:3330853-3330875 GGCTGGAGGCAGAGGGAGGAGGG - Intronic
900595613 1:3478906-3478928 CCATGTGAGCAGAGGGAGGTGGG + Intronic
900601265 1:3503750-3503772 GGGGGTGGGGAGCGGGAGGAAGG + Intronic
900623508 1:3597957-3597979 GCATGTGAGCAGCGGGAGGATGG + Intronic
900641783 1:3691065-3691087 TGGGGTGAGCAGAGGTAGGAAGG + Intronic
900831258 1:4967253-4967275 TGGTGTGAGCAGAGAGTGCAGGG - Intergenic
900932839 1:5747648-5747670 GGGAGGGAGGAGAGGGAGGGAGG + Intergenic
901010978 1:6201957-6201979 GGGTGTGGGGTGAGGGATGAGGG - Intronic
901052078 1:6430270-6430292 GGGTGAGCACTGAGGGAGGAAGG + Intronic
901216197 1:7556707-7556729 GGGTGTGAGCAGAGGAGGGGAGG - Intronic
901226189 1:7614067-7614089 GGGTGGGAGGAGAGGGATGGTGG + Intronic
901422767 1:9162215-9162237 TGGTGGGAGCAGAGAGGGGAGGG - Intergenic
901652564 1:10751706-10751728 TGGTGTGAGCAGAAGGGGGCCGG - Intronic
901740338 1:11338069-11338091 GAGGGGGAGGAGAGGGAGGAGGG - Intergenic
902230343 1:15023531-15023553 GAATGTGAGCTGGGGGAGGATGG + Intronic
902364100 1:15959535-15959557 GGGAGGGAGGAGAGGGAGGGAGG + Intronic
902482163 1:16717744-16717766 GGGTGAGTGCTGAGGGAGGAAGG - Intergenic
902544960 1:17184365-17184387 GGGGGTGGGGACAGGGAGGAGGG + Intergenic
902689627 1:18102173-18102195 GAGTGAGAGCAGGGGAAGGAGGG + Intergenic
902709744 1:18230617-18230639 GGATGGGGGCAGAGGAAGGAAGG + Intronic
902841243 1:19075325-19075347 GGAGGTGGGCAGAGGAAGGAGGG - Intronic
903011745 1:20336209-20336231 GGGTGTGAGCAGAGGTGGTGCGG - Intronic
903278886 1:22238911-22238933 GGCTGTGAGCATATGGAGGGTGG - Intergenic
903350006 1:22711467-22711489 GGCAGGGAGCAGAGGGAGGGAGG + Intronic
903834598 1:26195179-26195201 TGGTGGGAGAAGAGGGATGAGGG - Intronic
904230124 1:29062672-29062694 GGGTAGGAGAAGGGGGAGGAGGG - Intronic
904255978 1:29255151-29255173 GGGCCTGAAGAGAGGGAGGAGGG + Intronic
904265019 1:29313168-29313190 GGGAGAAAGCAGAGAGAGGAGGG - Intronic
904277418 1:29393506-29393528 GGGTGGGAGGAGAAGGAGGAAGG + Intergenic
904375828 1:30081903-30081925 GTGGGGGAGCAGAGGGAGGGAGG - Intergenic
904429087 1:30450407-30450429 GGGTTTGAGCAGGGGAATGATGG + Intergenic
904811743 1:33167665-33167687 GGCTGTGAGCAGTGCCAGGAAGG + Intronic
904825550 1:33271671-33271693 GGGTGTGAGGTGAGTGGGGAGGG + Intronic
904955869 1:34283445-34283467 GGGAGTGAGCTGTGGGAGGGTGG - Intergenic
904993461 1:34612754-34612776 GGGTGAGAGAAGAGTGAGGTTGG - Intergenic
905256416 1:36688390-36688412 GGAGGGGAGGAGAGGGAGGAGGG + Intergenic
905256622 1:36688971-36688993 GGGTGTGGGAAGGGGAAGGAAGG + Intergenic
905262846 1:36731495-36731517 GGGTGGGAGGAGAGAGAGGTGGG + Intergenic
905545195 1:38792251-38792273 GTGTTTGAGCAGAGACAGGATGG - Intergenic
905913041 1:41666884-41666906 TGGTGGGAGCATAGGGTGGATGG - Intronic
905923714 1:41735551-41735573 GGGAGTGAGCAGAGCCTGGATGG - Intronic
906034322 1:42741095-42741117 GGGAGAGAGAAGAGGGAGGTGGG - Intergenic
906040347 1:42784357-42784379 GGGTGAGAGCAGCGAGAGGGAGG - Intronic
906095030 1:43217104-43217126 GAGTGTGTGCAGAGGGATGAGGG + Intronic
906543454 1:46605355-46605377 GGGGGTGCTCAGAGGAAGGAGGG + Intronic
906679190 1:47713639-47713661 GACTGAGAGCAGAGGCAGGATGG + Intergenic
906689684 1:47784414-47784436 GGGGCTGGGCAGAGGGAGGAGGG + Intronic
906712817 1:47944192-47944214 GGGTGTGGAGAGAGGGAGCAGGG + Intronic
906868263 1:49447078-49447100 GGGTGTGTGCAGTGGGAAGAGGG + Intronic
907270649 1:53288962-53288984 GGGTGGTAGCAGAGGCAGGCAGG - Intronic
907303563 1:53502296-53502318 GGGAAAGAGGAGAGGGAGGAAGG + Intergenic
907307489 1:53521432-53521454 GGGAGTAAGAAGAGGTAGGATGG - Intronic
907457767 1:54586360-54586382 GGATGTGAGCAGAGGTTGAATGG - Intronic
907486879 1:54784177-54784199 AGGCATGAGCAGAGGGAGGTGGG + Intronic
907523141 1:55038200-55038222 GGGTGTGTTCTGAGGGAGGTGGG - Intergenic
907575020 1:55518635-55518657 AGGTGAAATCAGAGGGAGGAAGG + Intergenic
907921591 1:58919202-58919224 AGGAGTGAGCAGAAGGAGAATGG + Intergenic
908796170 1:67833196-67833218 GGGAGGGAGCGGAGGAAGGAAGG - Intronic
909243181 1:73240511-73240533 GGGGGTGGGGAGAGGGGGGAGGG + Intergenic
910042417 1:82868662-82868684 GAGAGTGAGGAGAGTGAGGAAGG + Intergenic
910135472 1:83963371-83963393 GGCTGTGTGTAGAGGAAGGATGG - Intronic
910257675 1:85264575-85264597 GAGTGAGATGAGAGGGAGGAAGG + Intergenic
910356720 1:86365875-86365897 GTGTGTGAGCAGGGGGTGGAGGG - Intronic
910601872 1:89041002-89041024 GGGAGGGAGGAAAGGGAGGAAGG + Intergenic
911073658 1:93851946-93851968 GGGAGGGAGGAGAGGGAGGGAGG + Intergenic
911154361 1:94624051-94624073 AGGAGAGAGCAGAGGGAAGAAGG + Intergenic
911315730 1:96354586-96354608 AGGTAGGAGTAGAGGGAGGATGG - Intergenic
911332536 1:96541869-96541891 TGGTGAGAGCACAGGGTGGAGGG - Intergenic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
911995696 1:104763182-104763204 GCGGGTTAGAAGAGGGAGGAAGG - Intergenic
912285589 1:108365157-108365179 GAGTGGGAGCAGAAAGAGGAAGG - Intergenic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
912647838 1:111411736-111411758 GGGTGGGAGAAGTGGGAGGAGGG + Intergenic
912952020 1:114126804-114126826 GGCTGCGAGCAGAGGGAGGGAGG + Intronic
912967834 1:114251713-114251735 GGGTAGGAGCAGAGTGATGAGGG - Intergenic
913106065 1:115615152-115615174 TGGAGTGAGCAGAGAGAGGATGG - Intergenic
913387697 1:118277772-118277794 GGGTTAGAGCAGAGGGAAGAAGG + Intergenic
913466343 1:119147126-119147148 GGGTGAGAGGAGAGAGAGGCAGG - Intergenic
914226334 1:145721941-145721963 GGCTGTGAGGAGAGGGACAAAGG + Intronic
914689147 1:150010401-150010423 GGGCGGGAGCAGACGGGGGACGG + Intronic
914847966 1:151293242-151293264 GCATGTGGGCAGAGGAAGGAAGG + Intronic
914983396 1:152436021-152436043 GGGTGTGAGGAGGGGTAGGGAGG - Intergenic
915040683 1:152965946-152965968 GGGAGGGAGCTGAGGGAGGAGGG - Intergenic
915091376 1:153428659-153428681 ATGTGTGGGCAGAGGGAGGAGGG + Intergenic
915117503 1:153609932-153609954 GGGTTTGGGCAGGCGGAGGAGGG - Intronic
915286621 1:154857425-154857447 GGGTAAGGGTAGAGGGAGGAGGG - Intronic
915300857 1:154950901-154950923 GGGCCTGGGCAGAGGGAAGATGG - Intronic
915342998 1:155186380-155186402 GAAGGAGAGCAGAGGGAGGAGGG - Intronic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
915847679 1:159285090-159285112 GGGTGTGAGGTGAGTTAGGAGGG + Intergenic
916020652 1:160789320-160789342 GGCTGGCAGGAGAGGGAGGAAGG + Intergenic
916175376 1:162033661-162033683 GGCAGTGAGCAGAGCGAGGCTGG + Intergenic
916452152 1:164931104-164931126 GAGTGAGAGCAGAGAGAGTAGGG - Intergenic
916481621 1:165219435-165219457 TGTTGTGAGTGGAGGGAGGAGGG + Intronic
916715133 1:167441481-167441503 GGGTGTGTGTAGTGGGAGGAGGG - Intronic
916720441 1:167481461-167481483 AGTTGGGAGCAGAGGGAGGATGG + Intronic
916880837 1:169018245-169018267 GGCAGTGAGCAGAGGGAGACAGG + Intergenic
917284128 1:173406940-173406962 GGTTCTGAGCAGGGCGAGGAGGG + Intergenic
917579605 1:176361834-176361856 GGGGGTGGGGAGAGGGGGGAGGG + Intergenic
917958593 1:180125167-180125189 AGGTGTGAGCAGAAGCAGAAAGG + Intergenic
917979438 1:180259939-180259961 GGGAGTGAGCGGTGGGAGGGAGG + Intronic
918050031 1:180965665-180965687 GGCTGTGAGCTGCTGGAGGATGG + Intergenic
918059665 1:181050037-181050059 GGCTGTGAGCTGCTGGAGGATGG + Exonic
918216530 1:182396657-182396679 AGGTGGGAGGGGAGGGAGGAAGG - Intergenic
918260093 1:182787914-182787936 GTGTGTGTGAAGAGGCAGGAGGG - Intergenic
918482864 1:184998372-184998394 GGTTGTGAGGAGGGAGAGGATGG + Intergenic
918624730 1:186644356-186644378 GGGTGTGGGCAGTGGGTAGATGG + Intergenic
918874815 1:190027062-190027084 TGGGGTGGGCAGAGGGGGGAGGG - Intergenic
918961077 1:191278774-191278796 GGTTGTCAGGAGATGGAGGAGGG - Intergenic
919085590 1:192917280-192917302 AGATGTGAGCAGAGCGAGGCTGG - Intergenic
919102247 1:193109008-193109030 AGGTGGGGGCAGAGGGAGAAGGG + Intergenic
919639752 1:200036417-200036439 GTGAGTGCTCAGAGGGAGGAGGG + Intronic
919749001 1:201024940-201024962 GGGTGTGAGTGGAGGAGGGAAGG - Intergenic
919754516 1:201058519-201058541 GGGGGTGAGCTTTGGGAGGAAGG + Intronic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920093901 1:203473431-203473453 GGGAGATAGGAGAGGGAGGAAGG + Intergenic
920173303 1:204084699-204084721 GGGCCTGAGAGGAGGGAGGAAGG - Intronic
920247586 1:204600034-204600056 CGGTGGGCGCAGAGGAAGGATGG + Intergenic
920305409 1:205015290-205015312 GGGTCTGAGCAGTGGGAGTCTGG - Intronic
920339697 1:205268079-205268101 AGGTGTCAGCAGAGGCAGGGTGG + Intronic
920345193 1:205301767-205301789 GGGTGGGAGGAGAAGGAGGCAGG + Intergenic
920430727 1:205917236-205917258 GGGTGGGAGCAGGGCGAAGAGGG - Intronic
920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG + Intergenic
921455822 1:215370337-215370359 GGGTGTGAGCAGGGGGGGAAGGG - Intergenic
921699206 1:218248110-218248132 GAGGGTGAGCAGGGGGAGGTTGG + Intergenic
921875027 1:220186217-220186239 GGGGGTGGGGAGAGGGAGGTAGG - Intronic
922581713 1:226703348-226703370 GGGCCTGAGCTGAGGGCGGAGGG - Intronic
922934273 1:229411472-229411494 GGGGGAGGGGAGAGGGAGGAAGG - Intergenic
923344594 1:233039246-233039268 GGGAAGGAACAGAGGGAGGAAGG - Intronic
923450360 1:234111658-234111680 TGGAGTCAGCAGAGGGAGCATGG - Intronic
923482378 1:234397318-234397340 GAGTGGGAGGAGAGGGAGGAGGG + Intronic
923490899 1:234483232-234483254 GGGTGTTAGCAGCAGGAGAAAGG - Intergenic
923784494 1:237054297-237054319 GGAGGGGAGAAGAGGGAGGAAGG - Intronic
923970588 1:239199186-239199208 GGGTGGGGGGAGAGGGAGAAAGG - Intergenic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
924715176 1:246566494-246566516 AGGGGTGCGCAGAGGGAGGCGGG + Exonic
924883390 1:248187685-248187707 GAGAGTGAGCAGAAGCAGGATGG + Intergenic
1062891855 10:1068070-1068092 GGGTGTGAGTCGGGGGCGGAGGG + Intronic
1062901054 10:1147446-1147468 CGGTGTGTGTAGGGGGAGGAGGG + Intergenic
1062907281 10:1187409-1187431 GGATGGGAGCAGGAGGAGGAGGG - Intronic
1062940925 10:1420969-1420991 CTGTGAGAGCAGAGAGAGGAAGG - Intronic
1062979347 10:1708886-1708908 GTATGTGAGCAGAGGGCTGAGGG + Intronic
1063216454 10:3930150-3930172 GGGTGGGAGAAGAAGCAGGAAGG + Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063298826 10:4833506-4833528 GGGTGTGAGCACGGGGAGGAAGG - Intronic
1063556430 10:7084062-7084084 TGGTGGGAACAGAAGGAGGAGGG + Intergenic
1063917863 10:10902903-10902925 GGGAGGGAGAAGAGGGAGGGAGG + Intergenic
1064011182 10:11737788-11737810 GTGGGTGAGCAGAGGGAGGGAGG - Intergenic
1064167219 10:12996930-12996952 GGGTGGGAGGAGGGTGAGGATGG + Intronic
1064640795 10:17414066-17414088 GGGTGTGAGTTGGGGAAGGAGGG - Intronic
1064686489 10:17867223-17867245 GGGGGAGAGAGGAGGGAGGATGG - Intronic
1064961501 10:20970167-20970189 TTGTGTGAGCAGAGCGAGGATGG + Intronic
1065309111 10:24396983-24397005 GAGTGTTAGCAGAGTGAGCAGGG + Intronic
1065627730 10:27648916-27648938 GGGTGGGAACAGAGAGAGGTGGG + Intergenic
1065825728 10:29568870-29568892 GGGAGGGAGCAGAGGAAGGAAGG + Intronic
1066055952 10:31680203-31680225 GTGTATGACCAGAGGGAAGAGGG + Intergenic
1066060802 10:31721992-31722014 GGGTGTGTGCAGATCAAGGATGG - Intergenic
1066075843 10:31875841-31875863 GGGACTGGGGAGAGGGAGGATGG - Intronic
1066107019 10:32165248-32165270 GAGTGGGAGGAGAGGGAGGCTGG + Intergenic
1066113643 10:32220206-32220228 GGGAGGGAGAAGAGTGAGGATGG + Intergenic
1067204054 10:44198666-44198688 GTGTGTGGGCAGAGTGGGGAGGG + Intergenic
1067233286 10:44426662-44426684 GGTTGTGAAAAGAGGGAGGGAGG - Intergenic
1067984290 10:51124371-51124393 GGGGGTGTGGAGTGGGAGGATGG + Intronic
1068373124 10:56144862-56144884 GGGGTGGAGCAGGGGGAGGAGGG + Intergenic
1068637135 10:59360351-59360373 GGGTGTGAGTAGAAGGATGTAGG + Intronic
1068681742 10:59827458-59827480 GAGTGTGAGGACAGGCAGGAAGG + Intronic
1068753605 10:60624957-60624979 GTGTGTGTGCACAGGGAAGAAGG - Intronic
1069608979 10:69759722-69759744 GGGTGGGAGCAGGGGGAGTCTGG - Intergenic
1069697283 10:70396126-70396148 GGGTGTGAGCACCAGGAGGTGGG + Intergenic
1070043610 10:72807640-72807662 GTGTGAGAGGAGAGGGAGGGTGG - Intronic
1070383459 10:75902385-75902407 GGGTGGGAGGGGATGGAGGAGGG + Intronic
1071499591 10:86193844-86193866 GGGAGTGAGCAGTGGAAGGGAGG - Intronic
1071553669 10:86586149-86586171 GGGTCTTAGCAGAGGGAGTCAGG + Intergenic
1071829338 10:89356210-89356232 TGGGGTGAGTAGGGGGAGGAAGG + Intronic
1071993320 10:91122394-91122416 GGATGAGAGAAGAGGGAGAAGGG + Intergenic
1072001708 10:91201581-91201603 GGCTGTGGGTGGAGGGAGGAGGG - Intronic
1072167875 10:92831207-92831229 GGGTGGGAGTAGAGGGAGGGTGG + Intergenic
1072424707 10:95320291-95320313 ATGTGTGAGCAGGGGCAGGAAGG - Intronic
1072686054 10:97537616-97537638 AGGTCTGAAAAGAGGGAGGAGGG + Intronic
1072686803 10:97542430-97542452 GTGGGAGAGCAGAGGGAGGGAGG - Intronic
1072917237 10:99545556-99545578 GAGGGGGAGCAGTGGGAGGAGGG + Intergenic
1073080799 10:100859458-100859480 AGGGGTGAGCAGAGGAGGGAAGG - Intergenic
1073284832 10:102381349-102381371 GTCTGTGAGCCGAGGGAAGAAGG + Intronic
1073425366 10:103452521-103452543 GGGTCTGGGCCGAGGGCGGAGGG - Intergenic
1073453566 10:103623360-103623382 GGGTCTGAGCAGAGGGTGCAGGG - Intronic
1073605919 10:104895544-104895566 GAGTGTGAGCTGAGGGATGCTGG - Intronic
1074059288 10:109950283-109950305 GGGTGTGAGAAGTAGGAGGAGGG + Intronic
1074270406 10:111947915-111947937 GAGTGTGGGGAGTGGGAGGAGGG + Intergenic
1074406055 10:113181128-113181150 GGGGGTGAGGAGGGGGAGGCTGG - Intergenic
1074438278 10:113453008-113453030 GAGAGTCAGCTGAGGGAGGAAGG - Intergenic
1074542285 10:114374826-114374848 GGATGGGGGCAGAGGGAGGGAGG + Intronic
1074763914 10:116686784-116686806 TGGTGTGGGAAGAGGGATGAGGG - Intronic
1074763934 10:116686847-116686869 TGGTGTGGGAAGAGGGATGAGGG - Intronic
1074959171 10:118423900-118423922 GGGTGTTAGCACAGGAAGAAAGG - Intergenic
1075400726 10:122159667-122159689 GGTGGCGAGCAGAGGGAGGCTGG - Intronic
1075840547 10:125498708-125498730 GGGTGGGAGGAGGGAGAGGAAGG - Intergenic
1075873690 10:125789360-125789382 GGGTCTGATCAAGGGGAGGATGG + Intronic
1076120941 10:127935938-127935960 AGGTGAGAGCAGAGGGAAGAAGG - Intronic
1076411107 10:130251624-130251646 GGGGGTGAGGAGAGAGAGGAAGG - Intergenic
1076571632 10:131437215-131437237 GGCTGTGGGCAGTGGGTGGAGGG - Intergenic
1076635157 10:131876773-131876795 GGGTCTGCCCGGAGGGAGGAGGG + Intergenic
1076640024 10:131909087-131909109 GGGTATAAGAAGAGGGAGGAAGG + Intronic
1076827838 10:132978733-132978755 GGGAGTGAGCAGAGGCACCAGGG + Intergenic
1077015139 11:395995-396017 GTGGGTGGGCAGAGGGTGGAGGG - Intronic
1077239297 11:1502313-1502335 AGGTGCCACCAGAGGGAGGAAGG + Intergenic
1077878720 11:6329962-6329984 GGAGGTGAGCAAGGGGAGGAAGG + Intergenic
1078195595 11:9134349-9134371 GGGAGAGGACAGAGGGAGGAAGG - Intronic
1078365974 11:10706732-10706754 GTGTGTGAGCACAGGGTGCAGGG - Intergenic
1078604306 11:12761638-12761660 GAGGGTGGGCAGAGGGATGATGG + Intronic
1078623759 11:12934390-12934412 GGGTGGGAGTAGAGGGGGAAGGG + Intronic
1078626681 11:12964320-12964342 GGGTGAGAGGGGTGGGAGGAGGG + Intergenic
1078655875 11:13238575-13238597 GAGGGTGGGCAGCGGGAGGATGG + Intergenic
1079117005 11:17646279-17646301 GGGTGAGAGCTGTGGGAAGATGG + Intronic
1079898611 11:26152429-26152451 GGGGGGGAGGGGAGGGAGGAAGG + Intergenic
1080683355 11:34496060-34496082 GGGTGGAAGCAGAGAGGGGAGGG - Intronic
1080725045 11:34889617-34889639 GGGTGGGAGGAAAGTGAGGATGG - Intronic
1080883546 11:36345091-36345113 GGGTGAGAGCAGCGGCAGGAAGG + Intronic
1081626439 11:44658804-44658826 AGGGCTGAGCAGAGGGAGGGAGG + Intergenic
1081674186 11:44958753-44958775 GGGGCTGAGCAGGGGGAGGCAGG + Intergenic
1081720548 11:45285681-45285703 GGGTAAGAGGAGAGGGAGGCTGG - Intronic
1081771406 11:45652361-45652383 TGGTGTGAGCAGAGGGACTGCGG - Intronic
1082118389 11:48351978-48352000 GGGGGTGGGGGGAGGGAGGAGGG + Intergenic
1083159324 11:60845079-60845101 AGGTCTGAGCAGAGGGAGCCGGG + Intronic
1083253914 11:61485040-61485062 GGCCGTGAGCAGGAGGAGGAAGG - Intronic
1083259269 11:61514419-61514441 TGCTGGGAGCAGAGGGCGGATGG + Intergenic
1083275055 11:61592188-61592210 GGGCTGGAGCAGAGGGAGGATGG + Intergenic
1083332865 11:61907101-61907123 GGCTGGGAGGAGAGGGAAGAAGG + Intronic
1083397662 11:62402446-62402468 CGCTGTGGGCAGAGGGAAGAGGG - Intergenic
1083488017 11:62995677-62995699 GGGTGTGGGCAGGGAGAGGGGGG + Intronic
1083619233 11:64040774-64040796 GGGTGCAGGCAGAGGGAGAAGGG + Intronic
1083667072 11:64281431-64281453 GGATTTGAGCAGAGGCAGCATGG - Intronic
1083681519 11:64353959-64353981 GGGGGTCAGGACAGGGAGGAGGG - Intronic
1083706439 11:64519568-64519590 AGGTGTGAGCTGAGAGAGGCAGG + Intergenic
1083721033 11:64603626-64603648 GGGTGTCGGCAAAGGGAGAAGGG + Intergenic
1083749738 11:64754455-64754477 GGCTGTGGGCAGAGGCAGGCCGG + Intronic
1084115711 11:67041857-67041879 GGGCCAGAGCAGAGGGGGGAAGG + Intronic
1084563371 11:69916226-69916248 GGGTCTGGGCAGAGTGAGGCTGG + Intergenic
1084581881 11:70029268-70029290 GCCTGTGTGCAGAGGGAAGAGGG - Intergenic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1084599910 11:70138914-70138936 GGGTGGGAGGAGGGTGAGGATGG - Intronic
1084600319 11:70141640-70141662 AGGTGTGAGCGGAGAGGGGAGGG + Intronic
1084636737 11:70398200-70398222 GGGCGCGCGCGGAGGGAGGATGG + Intergenic
1084932924 11:72571251-72571273 GGGGGTGTGCTGAGGAAGGATGG - Intergenic
1084941476 11:72615519-72615541 GAGTGTGGGGAGGGGGAGGATGG + Intronic
1085082795 11:73647894-73647916 AGGTGTGAGCAGGTGGGGGAGGG + Intronic
1085296359 11:75433932-75433954 GGGTGTGACCTGAGGGAAAAGGG - Intergenic
1085308472 11:75501664-75501686 GGCTGTGATCAGAGTGGGGAGGG + Intronic
1085315853 11:75544532-75544554 GGGTGGGAACACCGGGAGGAGGG + Intergenic
1085333005 11:75668509-75668531 GGGTGCTCGCTGAGGGAGGAGGG - Exonic
1085392672 11:76190404-76190426 GGGGGTCGGCAGAGGGAAGATGG - Intronic
1085471728 11:76762898-76762920 GAGTGTTAGCAGGGGGTGGATGG - Intergenic
1085697134 11:78714677-78714699 GGATGGGAGGGGAGGGAGGATGG - Intronic
1085745629 11:79112008-79112030 AGGTGGGGGCAGAGAGAGGAAGG + Intronic
1086643215 11:89186171-89186193 GGATGTGAGCACATGGAGAATGG + Intronic
1086910107 11:92462304-92462326 GGGTGGGAGGAGAGTGAGGATGG - Intronic
1087237227 11:95733483-95733505 GGGTCTGAGGAAATGGAGGAGGG - Intergenic
1087527154 11:99330164-99330186 GGGAGGGAGGGGAGGGAGGAGGG + Intronic
1087538135 11:99478532-99478554 GGGTGTGAGTATCAGGAGGAGGG + Intronic
1088238433 11:107749828-107749850 GGGTGGGAGGAGGGTGAGGATGG - Intergenic
1088365789 11:109038592-109038614 AGTTGTGAGCAGTGGGAGGCAGG + Intergenic
1088732258 11:112693901-112693923 GGGTGTGAGCAGAAGGCGGTAGG - Intergenic
1088779768 11:113123056-113123078 GGGTGTGTGTAGGTGGAGGAAGG + Intronic
1088896431 11:114082173-114082195 GGGTGGCTGAAGAGGGAGGATGG + Intronic
1088984332 11:114892263-114892285 GGGTCAGTACAGAGGGAGGAAGG + Intergenic
1089035864 11:115390380-115390402 GGCAGGGAGGAGAGGGAGGAAGG + Intronic
1089169021 11:116499749-116499771 GTGTGTGCGCACAGGGAGGGAGG - Intergenic
1089342968 11:117772123-117772145 GGGTGTCAACAGAGAGAGGAGGG + Intronic
1089399707 11:118157353-118157375 GGAGGAGGGCAGAGGGAGGAGGG + Intergenic
1089554692 11:119309967-119309989 AGGTGTGAGCACCGAGAGGAAGG + Intronic
1089660563 11:119982665-119982687 GGGTGGGAGCCGTGGGTGGATGG + Intergenic
1089768148 11:120783472-120783494 GAGAGGGAGCAGAGGGAGAAAGG - Intronic
1089884893 11:121810756-121810778 GGGTGGGAGGAGGGTGAGGATGG - Intergenic
1090353283 11:126121550-126121572 GGGAGTGTGCAGAGGGAGGAGGG + Intergenic
1090353634 11:126124240-126124262 AGGTATGAGCAGAGGGAGAGAGG - Intergenic
1090356907 11:126146560-126146582 AGGTCTGTGCAGAGGGATGAGGG - Intergenic
1090589009 11:128245373-128245395 GCGTGTGAGCAGAGGAAGTATGG - Intergenic
1090593643 11:128297230-128297252 GGCTTTCTGCAGAGGGAGGAGGG + Intergenic
1090662407 11:128891374-128891396 GGGAGAGAGGAGAGGGAGGAGGG + Exonic
1090673182 11:128965159-128965181 GGGTGGCAGGGGAGGGAGGAAGG - Exonic
1090717051 11:129440109-129440131 GGGTGAGAGCTGTGGGAGGAGGG - Intronic
1090737628 11:129624156-129624178 GGCTGTGGGCATAGGGAGCATGG - Intergenic
1090892770 11:130941446-130941468 TGGTGTGAGGGGAGGGGGGAGGG - Intergenic
1090898894 11:131007560-131007582 GGGAGGTAGCAGAGAGAGGAAGG - Intergenic
1090986898 11:131775551-131775573 TGGTGTCAACAGAGGGAAGAGGG - Intronic
1090987632 11:131785213-131785235 GGGTGTGGGCAGTGGCAGGTGGG + Intronic
1091446382 12:546196-546218 GGGTGTGAGAGGAGGGAGGGGGG + Intronic
1091672433 12:2462051-2462073 GGGGGTGAGCTTAGGGAGGAAGG - Intronic
1091873061 12:3911294-3911316 GGGAGTCAGCACAGGGTGGAGGG + Intergenic
1091966147 12:4743542-4743564 GGGAGAGAGGAGAGGGAGGGAGG + Intronic
1091968336 12:4764347-4764369 TGGCGGGAGCAGTGGGAGGAGGG - Intronic
1092030641 12:5280941-5280963 TGGGGTGGGGAGAGGGAGGAGGG - Intergenic
1092118623 12:6027517-6027539 GGGTCTGATCAGAGGGAGGCAGG + Intronic
1092232209 12:6782522-6782544 GGGTGTGAACTGAGGGAGACAGG + Intergenic
1092339518 12:7663448-7663470 GGATTTGAGCATTGGGAGGAAGG + Intronic
1092395539 12:8122367-8122389 GAGTGCAAGCAGAGTGAGGAGGG + Intergenic
1092505455 12:9093941-9093963 AGGAGTGAGCTGGGGGAGGAGGG + Intronic
1092890323 12:12963787-12963809 GGGTGAGTGTAGTGGGAGGATGG + Intergenic
1092905288 12:13095706-13095728 GGGTAGGAGGAGAGGGAGGAGGG - Intronic
1093958826 12:25251052-25251074 CGGTGTGGGAAGAGGGAAGAGGG + Intergenic
1094069416 12:26396491-26396513 TGGTGTGAGGAGAAGCAGGAAGG - Intronic
1094106544 12:26817851-26817873 GGGTAGGGGCAGAGGGAGGGTGG + Intronic
1094292180 12:28863807-28863829 GGGAGGGAGGGGAGGGAGGAAGG - Intergenic
1095218140 12:39574538-39574560 GGGTGAGATGAGAGGGAGAAAGG - Intronic
1095279075 12:40328135-40328157 GGGTATGTGTAGAGGGAAGACGG + Intronic
1095380183 12:41581632-41581654 GGGAGAGAGCAGATGGAGGAAGG + Intergenic
1095812301 12:46383653-46383675 GGGTTCGGGGAGAGGGAGGAGGG + Intergenic
1095879329 12:47115544-47115566 GGGAAGGAGAAGAGGGAGGAGGG - Intronic
1095990337 12:48029946-48029968 GGATGTGTGGGGAGGGAGGAGGG + Intergenic
1096148164 12:49293416-49293438 GGGAGTGGGAAGCGGGAGGAAGG - Intronic
1096403877 12:51328708-51328730 GGGTGTGGGGACAGGGAGGCAGG + Intronic
1096418013 12:51430483-51430505 ATGTGTGAGGAGAGGGTGGAGGG - Intronic
1096481306 12:51942922-51942944 GTGTGTGAGAAGGGGGTGGATGG + Intergenic
1096502125 12:52070414-52070436 GGGCGTGAGGAGGAGGAGGAAGG + Exonic
1096523179 12:52195442-52195464 GGGTGGGGGCAGAGGGAACAGGG + Intergenic
1096596856 12:52701380-52701402 GTGTGTGAGCGGGCGGAGGAGGG - Intronic
1096863814 12:54549533-54549555 GAGGGAGAGCAGAGGGAGGGGGG + Exonic
1096880645 12:54666247-54666269 TGGAGTGAGCAAATGGAGGAAGG + Intergenic
1096983671 12:55743242-55743264 GGGAGGGGGCGGAGGGAGGAGGG - Intergenic
1097046143 12:56189167-56189189 GGGTGCGGGGAGAGGGAGGCTGG + Intronic
1097588102 12:61539687-61539709 GGGTGTGGGGGGAGGGGGGAGGG - Intergenic
1098006579 12:66003716-66003738 GGGGGGAAGCAGAGGGAGGTGGG - Intergenic
1098706810 12:73702165-73702187 GAGTGTGAGCAGAAGCAGGGTGG + Intergenic
1098720500 12:73891794-73891816 GGGTGTAAGCAGATGTAGGAGGG - Intergenic
1098834388 12:75403745-75403767 TGGTGTGAACAGAAGGATGAAGG - Intronic
1098836088 12:75425707-75425729 GTGTCTAAGCAGAGTGAGGAGGG + Intronic
1099941327 12:89192746-89192768 GTGGCTCAGCAGAGGGAGGAAGG + Intergenic
1100093737 12:91005989-91006011 AGATGGGAGCAGAGGCAGGAAGG - Intergenic
1100263054 12:92950649-92950671 GAGGGAGAGAAGAGGGAGGAAGG + Intergenic
1100370646 12:93966135-93966157 GGGTGTGATCAGAATGACGAAGG - Intergenic
1100744782 12:97633755-97633777 TGGTGAGGGCAGAGGGAGTAAGG + Intergenic
1101001013 12:100357183-100357205 GGTGGGGAGCAGAGAGAGGAGGG + Exonic
1101092182 12:101298519-101298541 GGGTGAGAGGAGATGGAGGTGGG + Intronic
1101238396 12:102813326-102813348 GGGAGTGATCAGTGGGCGGAAGG - Intergenic
1101584433 12:106072665-106072687 GGGAGGGAGAAGAGGGAGGAAGG - Intronic
1101737391 12:107473284-107473306 GGTAGTGACCAGAGGGAGGATGG - Intronic
1101831728 12:108263133-108263155 GGACGGGAGCAGAGGGAGGTAGG + Intergenic
1102177453 12:110886635-110886657 GGGTGGGAGGAGAGGGAGGTTGG - Intronic
1102438802 12:112946112-112946134 GGGGGTGAGCGGAGGGAGTGTGG + Intronic
1102465338 12:113127780-113127802 GGACATGGGCAGAGGGAGGAGGG - Intronic
1102492375 12:113297070-113297092 TGGTGTGAGCAGAGCCAGGGAGG - Exonic
1102598773 12:114012992-114013014 AGGAGGGAGGAGAGGGAGGAGGG + Intergenic
1102620613 12:114191684-114191706 GGGCGGGAGGAGAGAGAGGATGG + Intergenic
1102720231 12:115009526-115009548 GGGTTTGAGCAGATGGATGGTGG + Intergenic
1102992026 12:117322416-117322438 AGGAGTGAGGAAAGGGAGGAGGG - Intronic
1102999793 12:117376506-117376528 GGGTGGGAGGAGAGTGAGGTTGG + Intronic
1103512351 12:121484105-121484127 AGGTGGGAGGAGAGGGAGGCGGG - Intronic
1103723436 12:122986594-122986616 GGGTGGGGGCAGAGGGACCATGG - Intronic
1103900467 12:124301164-124301186 GGCTGTGAGGAGGGAGAGGAGGG + Intronic
1104178116 12:126352059-126352081 GGGTCAGGGAAGAGGGAGGATGG + Intergenic
1104433072 12:128732524-128732546 CGGGGTGAGAAGAGGAAGGAGGG + Intergenic
1104572288 12:129935645-129935667 GGGTTTGAGGAGAGGGAGACAGG - Intergenic
1105284227 13:18991698-18991720 GGGTTTGAGCAGAGGGAGGTGGG - Intergenic
1105368566 13:19782898-19782920 GGGCGTGAGTTGGGGGAGGACGG - Exonic
1106370744 13:29130336-29130358 TGGCTTGAGCAGAGTGAGGAGGG - Intronic
1106384962 13:29275496-29275518 GGGTGGGAGCAGAGGGAGTAGGG - Intronic
1106440614 13:29763965-29763987 GGGTGTGAGCAGTGGTAGTTGGG - Intergenic
1106606717 13:31235264-31235286 GGGTGTGAGTAGCTGGAGGCTGG + Intronic
1107015476 13:35705310-35705332 GGGCATGAGTAGAGGGAGGAAGG + Intergenic
1107068440 13:36243137-36243159 AGGTTTGGGCAGAGGGAGTAGGG - Intronic
1107232584 13:38128262-38128284 GTGTGGGAGGAGAGTGAGGATGG - Intergenic
1107277984 13:38698634-38698656 GTGAGAGAGCAGAGAGAGGAAGG + Intronic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1107584911 13:41835081-41835103 GAGGGTGAGAGGAGGGAGGAGGG + Intronic
1107660116 13:42630562-42630584 GGGTGAGTGGAGAGGAAGGAGGG - Intergenic
1107999562 13:45893898-45893920 GGGTGTGAGCAGTGGGAGCTTGG - Intergenic
1108103395 13:46982686-46982708 GGGTTTGGGGATAGGGAGGAAGG - Intergenic
1108169808 13:47729560-47729582 TGGGGTGGGCAGAGGGGGGAGGG - Intergenic
1108212492 13:48152328-48152350 GGGTGTGAGGGGATGCAGGAGGG + Intergenic
1108426482 13:50306927-50306949 GGGGATTAGCAGAGGGAGGAAGG - Intronic
1108462191 13:50677896-50677918 GGGAGTCGGCAGAGAGAGGAGGG - Intronic
1108606006 13:52039255-52039277 GGGAGTGAGCTGAGGGATGAGGG + Intronic
1109239558 13:59868722-59868744 GGTTCTGAGGAGAGGGAAGAAGG - Intronic
1109649707 13:65310047-65310069 GGGTGTCATCAGGGGGAGCATGG - Intergenic
1109783766 13:67147874-67147896 GGGTGGGAAGAGAGGAAGGATGG - Intronic
1109998821 13:70167510-70167532 TGGTGTGGGGGGAGGGAGGAAGG + Intergenic
1110033349 13:70646850-70646872 GGGGGTGGGGGGAGGGAGGAGGG - Intergenic
1110134105 13:72044060-72044082 GAGTGAGAGAAGAGGGAGTATGG - Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1111233070 13:85370336-85370358 GGGTGAGAGTTGAGGGAGGTGGG - Intergenic
1111629579 13:90832783-90832805 GGGGGTGATCACAGGGTGGAAGG + Intergenic
1113222699 13:108123238-108123260 GAGGGAGAGCAGATGGAGGAAGG + Intergenic
1113237825 13:108300891-108300913 GGGAGAGTGCAGAGGAAGGATGG - Intronic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1113371448 13:109728907-109728929 GTCTGTGAGGAGAGGGAGGCAGG + Intergenic
1113489422 13:110679641-110679663 GGGCGTGACCGGAGGGAGGGAGG + Intronic
1113543214 13:111124696-111124718 GGCAGGGAGCAGACGGAGGATGG - Intronic
1113577696 13:111405594-111405616 GGGTGTGAGCAGAGGTTGGGGGG + Intergenic
1114397756 14:22382480-22382502 GGATGTGAATAGAGGAAGGAAGG - Intergenic
1114493304 14:23116757-23116779 GGGTGGGAGCAGCGTGGGGAGGG + Intergenic
1114623738 14:24115023-24115045 GGGCGTGAGGCGAGGAAGGAGGG + Exonic
1114814243 14:25937751-25937773 GGGTGTGGGAAGTGGAAGGAGGG + Intergenic
1114963046 14:27919239-27919261 GGGAGTCAGCAGAGGGTGGTGGG + Intergenic
1115106114 14:29763468-29763490 GGAGGGGAGGAGAGGGAGGAAGG + Intronic
1115445613 14:33485984-33486006 GGATGTGAGCAGGGGGAGTGGGG + Intronic
1115653406 14:35420142-35420164 GGGTGTGGGTTGGGGGAGGATGG - Intergenic
1115755901 14:36525557-36525579 GGGTGTGAGGGAAGGGTGGAGGG + Intergenic
1116029181 14:39550342-39550364 CGGGGTGAGGGGAGGGAGGATGG - Intergenic
1116367474 14:44085713-44085735 GGGAGGGATGAGAGGGAGGAAGG - Intergenic
1117079101 14:52133083-52133105 GAGGCTGAGCTGAGGGAGGAGGG + Intergenic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117320331 14:54616175-54616197 GTGCATGAGCAGAGGGAGCAAGG - Intronic
1117330547 14:54707702-54707724 GGGTGTGAGCAGAGAGTTGAAGG + Intronic
1117489136 14:56228775-56228797 GAGTGTGAGCTGAGGCAGGGTGG + Intronic
1118153058 14:63210469-63210491 GGGTAGGAGCAGTGGGATGAAGG + Intronic
1118163144 14:63310977-63310999 GGATGGGAGGAGAGTGAGGATGG + Intergenic
1118333528 14:64832754-64832776 TGGTGTGATGAGAGGGAAGAAGG - Intronic
1118693763 14:68364213-68364235 GAGTGGGCGCAGAGGGAGGGAGG - Intronic
1118818696 14:69330684-69330706 GGGTGAAAGCAGAGTGGGGAAGG + Intronic
1118906807 14:70029253-70029275 GGGTGTCAGCAGAATGAGGCTGG + Intronic
1118979104 14:70701716-70701738 GGGGGTGAGAAGAAAGAGGAAGG + Intergenic
1119172901 14:72547997-72548019 GGAGGTGAGCAGGGGGAGGGAGG - Intronic
1119188677 14:72663738-72663760 GGGAGGGAGAAGAGGGAGAATGG + Intronic
1119199038 14:72739590-72739612 GGGCATGAGCCCAGGGAGGATGG + Intronic
1119557789 14:75566908-75566930 GGGGCTGAGCAGAGGGAAGGAGG + Intergenic
1119609233 14:76047704-76047726 GGGAAGGAACAGAGGGAGGAAGG - Intronic
1119734188 14:76970988-76971010 GGGCGTGAGCTGAGGGAACAGGG - Intergenic
1119757333 14:77128381-77128403 GGGTGGGAGTGGAGGTAGGAGGG - Intronic
1119879714 14:78090657-78090679 GGGTCTAAGCAGTGGGAGGTTGG + Intergenic
1119895970 14:78220336-78220358 AGGTGTGCAGAGAGGGAGGAGGG + Intergenic
1119906582 14:78309430-78309452 GGGTGGGAGGAGAAAGAGGATGG - Intronic
1120033846 14:79673143-79673165 GGGGGTCAGAAGAGGAAGGAGGG + Intronic
1120513037 14:85438482-85438504 GTGTCTGAGAAGAAGGAGGAGGG + Intergenic
1121069316 14:91002801-91002823 GGCTGAGAGAAGAGGGAAGAGGG - Intronic
1121092412 14:91191773-91191795 GGGTGTGAGGAGAAGGATCAGGG + Intronic
1121103940 14:91268693-91268715 GGGTGGGAGGGGAGTGAGGATGG + Intergenic
1121258945 14:92552533-92552555 AGGTGAGAGCAGAGGGGGTAGGG - Intronic
1121539170 14:94712212-94712234 GGGTGAGTGCAGAGAGAGGAAGG - Intergenic
1121729165 14:96174334-96174356 GGTTGTAGACAGAGGGAGGAAGG + Intergenic
1121780117 14:96616872-96616894 GGGCGCGAGCAGAAAGAGGATGG + Intergenic
1122144775 14:99683073-99683095 GGGTGTGGGCTGAGGGGCGACGG - Intergenic
1122290633 14:100678605-100678627 GGGGGTGGGTAGAGGGAGCATGG + Intergenic
1122420705 14:101575159-101575181 GGGTGGGGGCAGAGAGAGAAGGG + Intergenic
1122440196 14:101726613-101726635 GGGTGTGAGTTGGGGGAGGGAGG - Intergenic
1122647944 14:103207410-103207432 GGAGGGGAGGAGAGGGAGGAAGG - Intergenic
1122723873 14:103737723-103737745 AAGTGTGAGGAGATGGAGGAAGG - Exonic
1122736591 14:103847217-103847239 GGCTGGGAGCCGCGGGAGGAAGG + Intronic
1122741591 14:103874738-103874760 GGGTGTCTGCAGAAGGAGGCTGG + Intergenic
1122757978 14:103997638-103997660 GGGAGTGCACAGAGGGAGGGTGG + Intronic
1122809565 14:104281340-104281362 GGCTGTGAGCAGGGGGAGGGCGG - Intergenic
1122874198 14:104655872-104655894 GGGCGTGATCAGGAGGAGGATGG + Intergenic
1122920879 14:104879644-104879666 GGGGGTGGCCAGAGGCAGGAAGG + Intronic
1123021371 14:105399275-105399297 GGGTAGGAGCAGGGGGAGGTGGG - Intronic
1123148947 14:106163145-106163167 GTGTGAGAGAGGAGGGAGGAAGG + Intergenic
1123434921 15:20247843-20247865 GGAGGGGAGGAGAGGGAGGAGGG + Intergenic
1123434929 15:20247865-20247887 GGAGGAGAGGAGAGGGAGGAGGG + Intergenic
1123434958 15:20247949-20247971 AGGAGAGAGGAGAGGGAGGACGG + Intergenic
1124023706 15:25945663-25945685 CTGTGTGAGCAGTGGGCGGAGGG + Intergenic
1124059537 15:26276823-26276845 AGGTGTGAGTAGACGCAGGAAGG + Intergenic
1124439183 15:29674755-29674777 GGGAGGGAGGAGAGGGAGGAGGG + Intergenic
1124794749 15:32766729-32766751 GGGTGTGAGAGGATGGAGGAGGG + Exonic
1125330382 15:38575998-38576020 GGGTTTGCGCAGAGGAGGGATGG + Intergenic
1125833158 15:42730240-42730262 GGGTTTGAGCAGAAAGGGGAAGG + Intronic
1126158478 15:45587153-45587175 TGGTGGGAGCTGGGGGAGGACGG - Exonic
1126437254 15:48648047-48648069 GGATCTGAGCAGAGGGACCATGG + Intergenic
1126598595 15:50406164-50406186 GGGTGGGTGCAGGGGGAGGCTGG + Intergenic
1127674380 15:61226871-61226893 GGGTGGGGGCAGAGGGTGGGGGG + Intronic
1127679259 15:61276783-61276805 GGAAGTGAACTGAGGGAGGAGGG - Intergenic
1127907581 15:63387663-63387685 GGAAGGGAGAAGAGGGAGGAAGG + Intergenic
1128043979 15:64600672-64600694 GGGCGGGAGAAGAGGGAGGGAGG + Intronic
1128065618 15:64762818-64762840 AGCTCTGAGCAGATGGAGGATGG - Intronic
1128257906 15:66212069-66212091 GGGCGGGAGGAGAGGGAGGTTGG - Intronic
1128453652 15:67821305-67821327 GGGTGGGAGGAAAGAGAGGATGG - Intronic
1128454546 15:67825348-67825370 GGGGGTGAGGAGAAGGAGGAGGG - Intronic
1128495442 15:68195888-68195910 TGGAGTCAGCAGAGGGAGCAGGG - Intronic
1128705936 15:69837532-69837554 GGGTGTGGGGGGAGGGAGGGAGG + Intergenic
1128765375 15:70248104-70248126 GGGGGTGGGCAGTGGGAGGTGGG - Intergenic
1129325682 15:74799093-74799115 GGCTGGGGGCAGAGGCAGGAGGG + Intronic
1129351566 15:74958560-74958582 GGGCGAGAACAGCGGGAGGAGGG - Intronic
1129450320 15:75647837-75647859 AGGGGTGGGGAGAGGGAGGAGGG - Intronic
1129598521 15:76983287-76983309 GGGTGTGGACAGAGGGAGCGTGG + Intergenic
1129604284 15:77017257-77017279 GGGTGTGAGAAGTTGGGGGAGGG - Intronic
1129677916 15:77642379-77642401 TGGTGTGGGGAGAGGGAGAAAGG + Intronic
1129695273 15:77737432-77737454 GGGAGGAAGGAGAGGGAGGAAGG + Intronic
1129739794 15:77984688-77984710 GGGGGGGAGCAGAGGGAGCTGGG + Intronic
1129839185 15:78733177-78733199 GGGTGGGAGCACAGATAGGAAGG - Intergenic
1130091789 15:80827277-80827299 GGGAGTGAGTAGTGGGAGAAGGG + Intronic
1130225951 15:82058670-82058692 GGATGGGAGAAGAGGTAGGAGGG - Intergenic
1130517734 15:84639126-84639148 GGGTGGGAGCAGGGGGGTGAGGG - Intergenic
1130556265 15:84924511-84924533 GAGTGTGGGGAAAGGGAGGAGGG - Intronic
1130788161 15:87123252-87123274 GGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1131214063 15:90522341-90522363 GGGTGTGAGCAGAAGTAATATGG - Intergenic
1131317385 15:91351929-91351951 GAGTGTGAGCAAGGGGAGGCTGG + Intergenic
1131642532 15:94307770-94307792 GGCTGTGGGCAGAGGGAAAATGG + Intronic
1131947063 15:97635204-97635226 GGGTGGAAGGAGAAGGAGGAGGG - Intergenic
1132105298 15:99058963-99058985 GGGTGGGGGCGGAGGGAGGGCGG - Intergenic
1132325355 15:100964245-100964267 GGGGGTGTGCAGAGGAGGGAGGG - Intronic
1132344037 15:101096841-101096863 GGGTAGGAGGAGAGGGAGGATGG + Intergenic
1132456150 16:24207-24229 GGGTGTGAGGACTGTGAGGACGG + Intergenic
1132481546 16:168781-168803 AGGTGTGAGCAGGGAGAGGAGGG - Intergenic
1132567933 16:631691-631713 GGGTGGGAGGAGAGGGTGGGAGG - Intronic
1132567953 16:631753-631775 GGGTGGGAGGAGAGGATGGAAGG - Intronic
1132568047 16:632122-632144 GGGTGGGAGGAGAGGATGGAAGG - Intronic
1132568055 16:632148-632170 GGGTGGGAGGAGAGGATGGAAGG - Intronic
1132716468 16:1292605-1292627 GGGAGAGGGGAGAGGGAGGAGGG - Intergenic
1132724971 16:1334471-1334493 GTCGGTGAGCAGAGGGAGGAGGG + Intronic
1132801953 16:1758916-1758938 GGGCGGGAGGAGAGGGAGAAAGG - Intronic
1132833478 16:1941171-1941193 TGGGGCAAGCAGAGGGAGGAAGG + Intronic
1133203262 16:4217621-4217643 AGTTGTGTGCAGAGGGAGTAAGG - Intronic
1133285491 16:4688769-4688791 AGGTGGGAGCAGAGGGAGGAGGG - Intronic
1133392816 16:5422976-5422998 AGGAGTGGGGAGAGGGAGGAGGG + Intergenic
1133643537 16:7741032-7741054 GGGATGGGGCAGAGGGAGGAGGG - Intergenic
1133720364 16:8488966-8488988 GGGGGGAGGCAGAGGGAGGAAGG + Intergenic
1133809827 16:9152826-9152848 AGGGGTGAGCAGAGGGAGGTGGG - Intergenic
1133994746 16:10739933-10739955 GGGCCTGAGCTGAGGCAGGAGGG + Intergenic
1134016946 16:10895434-10895456 GGAAGAGACCAGAGGGAGGAGGG - Intronic
1134178870 16:12031456-12031478 GGGTGAGAGCTGGGGAAGGAAGG - Intronic
1134449355 16:14354095-14354117 GGGGAGGGGCAGAGGGAGGAGGG + Intergenic
1134619103 16:15674211-15674233 GGGAGGGAGAAGATGGAGGAAGG - Intronic
1134803560 16:17106729-17106751 GGGGGTGAGTAGGGGGAGGATGG + Exonic
1135305612 16:21365211-21365233 GGGTGAGAGCTGGGGAAGGAAGG - Intergenic
1135479110 16:22806441-22806463 GGGTGTGTGTGGAGCGAGGAAGG + Intergenic
1135623702 16:23977381-23977403 GGCTGTGAGGAGAGGGTGGTGGG - Intronic
1135694746 16:24575885-24575907 GAGAGGGAGGAGAGGGAGGAGGG + Intergenic
1136140376 16:28284400-28284422 GGGTGTGTGCTGGGGGAGCAGGG - Intergenic
1136302354 16:29344365-29344387 GGGTGAGAGCTGGGGAAGGAAGG - Intergenic
1136366284 16:29810682-29810704 GGGAGGGAGGAGAGGAAGGAGGG + Exonic
1136417568 16:30113150-30113172 AGGTGAGGCCAGAGGGAGGATGG - Intronic
1136681277 16:31964437-31964459 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1136781589 16:32905949-32905971 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1136849678 16:33603083-33603105 AGGAGAGAGGAGAGGGAGGACGG - Intergenic
1136849692 16:33603123-33603145 GGAAGAGAGGAGAGGGAGGAGGG - Intergenic
1136849699 16:33603145-33603167 GGAGGGGAGGAGAGGGAGGAGGG - Intergenic
1136888204 16:33947891-33947913 GTGTGAGAGAGGAGGGAGGAAGG + Intergenic
1137236560 16:46623215-46623237 GGGGGGAAGCAGAGGGAGGTGGG - Intergenic
1137682535 16:50362773-50362795 AGGTCTGAGGAGAGGGAGAAAGG + Intronic
1138084277 16:54119531-54119553 GGTTGGGAGCAGAGGAGGGAAGG - Exonic
1138114769 16:54351623-54351645 AGGAGAGAGGAGAGGGAGGAAGG - Intergenic
1138116289 16:54363041-54363063 GGGTGAGAGCAAGGGGAAGAGGG - Intergenic
1138341106 16:56289605-56289627 CGGTGTGGGGAGAGGAAGGATGG + Intronic
1138389669 16:56661303-56661325 GATGGTGCGCAGAGGGAGGAAGG - Intronic
1138534630 16:57653353-57653375 GGCTGTGAGGGGAGGCAGGAAGG + Intronic
1138613713 16:58147744-58147766 GGGTGTGAGGAGAAGGATGTAGG - Intergenic
1139130437 16:64136253-64136275 GGGTTTGAACAGAGGAAGTAGGG + Intergenic
1139466591 16:67157235-67157257 TGGATTGAGAAGAGGGAGGAGGG - Intronic
1139492376 16:67293259-67293281 GGGAGTCAGCAGGGGAAGGAAGG - Intronic
1139504568 16:67392532-67392554 GGGTGTGGCCAGAGGGCTGAGGG - Intronic
1140028246 16:71311576-71311598 GCGGCTGAGCAGAGGGAGCAAGG + Intergenic
1140458238 16:75116739-75116761 GGGTGTGAGCACTGGGTGGCAGG + Exonic
1140887696 16:79259200-79259222 GGGACTGAGCAGAGCCAGGAAGG - Intergenic
1141141661 16:81500409-81500431 GGGAGGGAGGGGAGGGAGGAGGG - Intronic
1141152720 16:81575343-81575365 TGGTGTGGGGAGAGAGAGGAAGG - Intronic
1141178172 16:81734372-81734394 GAGTGTGAGGAGCAGGAGGAGGG + Intergenic
1141380858 16:83575496-83575518 TGGTGTGAGCAGGGGCTGGATGG - Intronic
1141428918 16:83960877-83960899 GGGGCTGGGTAGAGGGAGGAGGG - Intronic
1141451813 16:84108692-84108714 GAGTCTGAGCGGAGTGAGGAAGG + Intronic
1141550843 16:84805725-84805747 GGGGGAGAGGAGAGGAAGGAGGG + Intergenic
1141667773 16:85474704-85474726 GGGAGTGGGGAGAGGGAGGAGGG - Intergenic
1141685125 16:85565790-85565812 AGGTGTGAGAAGAAGCAGGAGGG + Intergenic
1141840940 16:86573664-86573686 GGGTGTGTGAAGAGGGAAGGGGG + Intergenic
1141902636 16:87002684-87002706 TGGGGAGAACAGAGGGAGGAAGG - Intergenic
1142020777 16:87780876-87780898 ACTTGTGGGCAGAGGGAGGAAGG - Intergenic
1142251449 16:88993779-88993801 GGGGGAGGGAAGAGGGAGGAGGG - Intergenic
1142252589 16:88999586-88999608 GGGGGGGGGCGGAGGGAGGAGGG + Intergenic
1142252643 16:88999706-88999728 GGGGCGGGGCAGAGGGAGGAGGG + Intergenic
1142252656 16:88999730-88999752 GGGGCGGGGCAGAGGGAGGAGGG + Intergenic
1142252674 16:88999769-88999791 GGGGCGGGGCAGAGGGAGGAGGG + Intergenic
1142252700 16:88999824-88999846 GGGGCGGGGCAGAGGGAGGAGGG + Intergenic
1142269157 16:89080134-89080156 TGGAGAAAGCAGAGGGAGGAAGG + Intergenic
1142323717 16:89400894-89400916 GGGTGTCTGCAGAGGGTGGAGGG - Intronic
1142359516 16:89619622-89619644 GGAGGGGAGCAGAGGGAGCAGGG - Intronic
1203084244 16_KI270728v1_random:1169931-1169953 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1142482054 17:225163-225185 GCCTCTGAGCAGATGGAGGAAGG - Intronic
1143021203 17:3917995-3918017 GGGAGGGAACGGAGGGAGGAAGG + Intergenic
1143109336 17:4544678-4544700 GGGTGGGCGCACAGGGAGGCGGG + Intronic
1143109345 17:4544700-4544722 GGGTGGGCGCACAGGGAGGCGGG + Intronic
1143125449 17:4638829-4638851 GGGTGAGAGCAAGGGGAGGCTGG - Exonic
1143141740 17:4745088-4745110 GGAGGGGAGCAGGGGGAGGACGG - Intronic
1143183937 17:4999544-4999566 GGGTGGGAAGAGAGAGAGGAGGG - Intronic
1143195845 17:5075853-5075875 AGTTTTGAGCAGAGTGAGGAAGG + Intergenic
1143332878 17:6150344-6150366 GGGTGTGGAGAGAGGGAGGGAGG + Intergenic
1143403019 17:6657983-6658005 GGGTGAGAGCAAGGGGAGGCTGG + Intergenic
1143538881 17:7558032-7558054 AGGTGGGAGCAGAGGTAGGAAGG + Intronic
1143784036 17:9243696-9243718 AGGAGGGGGCAGAGGGAGGAGGG - Exonic
1143786338 17:9258572-9258594 GGGTGTGATCAGAGGCAGGTAGG - Intronic
1143855417 17:9844453-9844475 GGGTGGAAGAAGAGGGAGGGTGG + Intronic
1143963387 17:10738892-10738914 GGGAGGGAGGAGAGGGAGGGAGG - Intergenic
1144573904 17:16417109-16417131 AGGGGTGAGGAGAGGGAGGGAGG - Intronic
1144583748 17:16475314-16475336 GTGTGTGTGGAGAGAGAGGAAGG + Intronic
1144622807 17:16829244-16829266 GGGTGTGAGGAGAAGCAGGCTGG + Intergenic
1144825060 17:18101116-18101138 GTGTGCAAGCAGAGGCAGGATGG + Intronic
1144834672 17:18150634-18150656 GGCTGAGAGGACAGGGAGGAGGG + Intronic
1144883624 17:18443472-18443494 GGGTGTGAGGAGAAGCAGGCTGG - Intergenic
1144932899 17:18874586-18874608 GGGTGTGCTCTGAAGGAGGAAGG + Intronic
1144959308 17:19035917-19035939 GGGTGTGTGCAGAGGAGGGTGGG - Intronic
1144975851 17:19138607-19138629 GGGTGTGTGCAGAGGAGGGTGGG + Intronic
1145148604 17:20500914-20500936 GGGTGTGAGGAGAAGCAGGCTGG + Intergenic
1145253177 17:21307536-21307558 GGGTCAGAGGAGAGGGAGGGAGG + Intronic
1145323393 17:21780382-21780404 GGGTCAGAGGAGAGGGAGGGAGG - Intergenic
1146057095 17:29586963-29586985 GCCCGGGAGCAGAGGGAGGATGG + Intronic
1146109544 17:30075714-30075736 GAGCCTGAGCAGAGCGAGGAGGG - Intronic
1146268396 17:31468249-31468271 GGGTCTGAGCAGAGGAAGCGAGG - Intronic
1146281833 17:31549844-31549866 GGGCGAGAGAGGAGGGAGGAGGG + Intergenic
1146689729 17:34865135-34865157 GAGTGATCGCAGAGGGAGGATGG - Intergenic
1146691863 17:34882399-34882421 GGGTGAGGGCAGAGGGAAGGGGG - Intergenic
1146750467 17:35373836-35373858 GGGAGCGAGGAGACGGAGGAAGG - Intergenic
1146756728 17:35439135-35439157 GTTTGTGTGCACAGGGAGGAAGG + Exonic
1146908607 17:36633514-36633536 GGGAGAGAGGAGAGGGAGGAGGG + Intergenic
1147007312 17:37413942-37413964 GAGGGTGAACAGTGGGAGGAGGG - Intronic
1147041100 17:37719674-37719696 GGGTCTGGGCAAAGGGAGAAAGG + Intronic
1147129761 17:38400245-38400267 GGTTGAGAGCAGAGGAAGAACGG - Exonic
1147167621 17:38601868-38601890 AGGGGTGGTCAGAGGGAGGAAGG + Intronic
1147540329 17:41351927-41351949 GGGTGTGGGTAGAGTGATGAAGG + Intergenic
1147577134 17:41609179-41609201 GGGTGTGAGGAGAAGCAGGCTGG + Intergenic
1147840668 17:43369118-43369140 GGGGGCGCGCAGAGGGAGGGCGG + Intergenic
1147976247 17:44249758-44249780 GGCTGGGAGCAGAGTGGGGAAGG + Exonic
1148019220 17:44542415-44542437 GGTTGGAAGCAGAGGGAAGATGG - Intergenic
1148049184 17:44760763-44760785 TGGGCTGGGCAGAGGGAGGAAGG + Intronic
1148086160 17:44995039-44995061 GGCTGGGAGCAAGGGGAGGAGGG + Intergenic
1148135133 17:45287125-45287147 GGGTCTGGGCAGTGGGTGGAGGG + Intronic
1148559608 17:48598252-48598274 GGGTTTTAGCTGAGGGGGGATGG + Exonic
1148582282 17:48752348-48752370 AGGTGACAGGAGAGGGAGGAAGG + Intergenic
1148686173 17:49502396-49502418 GGAAGTGTGCAGAGGGAGGAGGG + Intronic
1148804443 17:50257250-50257272 TGGTGTGGGCAGATGGAGAAGGG + Intergenic
1148860536 17:50602214-50602236 GGGTGTGAGCACAGAGAGGAGGG - Intronic
1149194048 17:54098461-54098483 GGATGTGAGCTGTGGGAGAAAGG + Intergenic
1149195640 17:54116848-54116870 GGGTCAGAGCAGAGGCAGCAAGG - Intergenic
1149261392 17:54884099-54884121 GGGCGGGAGCAAAAGGAGGATGG - Intergenic
1149274978 17:55023706-55023728 GGGTGAGAGGAGAGGAGGGATGG + Intronic
1149304630 17:55335827-55335849 GGGAGGGAGCAGAGGGAAGAGGG - Intergenic
1149427599 17:56570123-56570145 GACTATGAGAAGAGGGAGGAAGG + Intergenic
1149649810 17:58269635-58269657 GGGTGGAAGGTGAGGGAGGAGGG + Intergenic
1149665531 17:58362652-58362674 GGGAGTGAGCAGAGAGGGAAAGG + Intronic
1149671595 17:58417667-58417689 GTGTGTGAGCACCAGGAGGAGGG - Intergenic
1150027391 17:61691086-61691108 GGGTGGGGGGAGAGGGGGGAGGG + Intronic
1150200394 17:63350296-63350318 GGGGGAAAGCAGAGGGAAGAGGG - Intronic
1150697735 17:67420371-67420393 GGGAGGGAGGGGAGGGAGGAAGG - Intronic
1151345812 17:73500562-73500584 GGAGGAGAACAGAGGGAGGATGG - Intronic
1151398003 17:73837355-73837377 TGGAGTGGGAAGAGGGAGGAGGG + Intergenic
1151704007 17:75757352-75757374 GGGAGCTAGCAGAGGGAGAAGGG + Intronic
1151889309 17:76942837-76942859 GGAGGAGAGCAGAGGGAGGTGGG - Intronic
1152077076 17:78166463-78166485 GGGTGTAGGGAGAGGGAGGGGGG + Intergenic
1152097064 17:78278499-78278521 GGGTGGGGGCAGTGGGAGGGAGG + Intergenic
1152319589 17:79601036-79601058 GGGCGGGAGCAGCGGGAGCATGG - Intergenic
1152400831 17:80065217-80065239 GGAAGGGAGGAGAGGGAGGAAGG - Intronic
1152573111 17:81129056-81129078 GGGTGAGGTCAGCGGGAGGAAGG + Intronic
1152610070 17:81311070-81311092 GGGTCTCAGCAGGGGGAGGCCGG - Intergenic
1152623967 17:81379974-81379996 GGGGGGGAGCAGGGGGTGGAGGG - Intergenic
1152643789 17:81459771-81459793 GGGTGTGTGGGGAGGGAGGGTGG + Intronic
1152655248 17:81516438-81516460 GTGTGGGAGAAGAGGGAGGTGGG - Intronic
1152829598 17:82489143-82489165 GGCTGTGAGGAATGGGAGGAGGG - Exonic
1152829620 17:82489224-82489246 GGCTGTGAGGAATGGGAGGAGGG - Exonic
1152939533 17:83160969-83160991 GGGGCTGAGCAGAGACAGGAGGG + Intergenic
1153051761 18:907495-907517 GGGTGGGAGCAGAGGTAAGGAGG - Intronic
1153402340 18:4694879-4694901 GAGTGTGAGCTGAGGCAGGGCGG + Intergenic
1153463974 18:5368215-5368237 GTGTGAAAGGAGAGGGAGGAAGG - Intergenic
1153513006 18:5875926-5875948 AGGTGTGAACAGAAGGATGAAGG + Intergenic
1153530266 18:6039022-6039044 GGGTTGGGGAAGAGGGAGGAAGG - Intronic
1153787038 18:8544281-8544303 GGGTGTTTGCAGAGAGAGGTGGG + Intergenic
1153986205 18:10352864-10352886 GGGAGACAGCAGAGGGAGCAGGG + Intergenic
1154078191 18:11225810-11225832 GAGTGTGAGCAGGTGGGGGAAGG - Intergenic
1154079674 18:11243567-11243589 GGCTGTGAGCAGAGGGGTGACGG + Intergenic
1154332239 18:13439716-13439738 GGGTGCAGGAAGAGGGAGGAAGG + Intronic
1154356441 18:13625747-13625769 GGGTGGTGGCAGGGGGAGGAGGG - Intronic
1154397863 18:14008271-14008293 GGGTGGGAAGAGAGGCAGGAGGG - Intergenic
1155385837 18:25276214-25276236 GGGTGGGTGGAGGGGGAGGAAGG - Intronic
1155539124 18:26848727-26848749 TGGGGTGGGGAGAGGGAGGAGGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156134929 18:34026273-34026295 GGGTGTGTGCATGGGGAGGGAGG - Intronic
1156451244 18:37267524-37267546 GGGACTGCCCAGAGGGAGGATGG + Intronic
1156463576 18:37335005-37335027 AGGGGGGAGCAGAGGGAGGGAGG - Intronic
1156469660 18:37369250-37369272 GGGGGTGGGCAGCGGGAGGCTGG + Intronic
1156774184 18:40767070-40767092 TGGTTTGTGCAGAGTGAGGAAGG + Intergenic
1156914811 18:42453492-42453514 GGGTGAGGGCAGTGGGTGGATGG + Intergenic
1156969268 18:43135089-43135111 GGGTGTGATTAGAAGGAGGAGGG + Intergenic
1157221586 18:45832071-45832093 GAGTGTGAACAGAGGGTGGTGGG - Intronic
1157429793 18:47615300-47615322 GGGTGAGAGGAGAGAGAGGTTGG - Intergenic
1157437878 18:47686590-47686612 GGGTGTGAGCTGGGGTGGGAGGG - Intergenic
1157449372 18:47773748-47773770 GGGAGGGAGCAGGGGGAGGCAGG + Intergenic
1157454035 18:47810333-47810355 GTGAGTGTGCAGTGGGAGGAGGG - Exonic
1157520350 18:48341256-48341278 AGATGTGGGCAGAGGAAGGAAGG + Intronic
1157680726 18:49603363-49603385 GAGTGTGGCCAGAGGGCGGATGG - Intergenic
1157686367 18:49645882-49645904 GGGCGTGAGGAGGCGGAGGATGG + Intergenic
1157811876 18:50703168-50703190 GGGAGTGAGCATGGGGAGGAGGG - Intronic
1158215451 18:55096324-55096346 TGGGGTGATCAGAGGGAGAAAGG + Intergenic
1158575029 18:58629498-58629520 GGGGGTAAGCAGGGTGAGGAGGG - Intergenic
1158882238 18:61791608-61791630 GGGTCTGGGAAGAGGGAGGGAGG - Intergenic
1159002793 18:62988371-62988393 GGGGGTGTCCAGAAGGAGGACGG - Intergenic
1159060357 18:63508147-63508169 AGGGGTGAGCTGGGGGAGGAGGG + Intergenic
1159800583 18:72894629-72894651 TGGGGTGGGCAGAGGGGGGAGGG + Intergenic
1159877366 18:73827543-73827565 GGGTGGGAGCAAGAGGAGGAGGG + Intergenic
1159913895 18:74172060-74172082 GGGGGACAGCAGAGAGAGGAGGG - Intergenic
1159918260 18:74204691-74204713 GGGTGGGAGAAGAAGGGGGATGG + Intergenic
1159918303 18:74204799-74204821 GGGTGGGAGAAGAAGGGGGATGG + Intergenic
1160149223 18:76386444-76386466 GGATGGGAGGTGAGGGAGGAGGG + Intronic
1160358499 18:78248851-78248873 GGGAGTGAGCAGGTGAAGGAGGG + Intergenic
1160514750 18:79472139-79472161 GGGTGTGAGCCGTGGGGGGGCGG + Intronic
1160556721 18:79730311-79730333 GGGTGGGAGGAGAGGAGGGAGGG + Intronic
1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG + Intergenic
1161207064 19:3046902-3046924 GGGGAGGAGGAGAGGGAGGAGGG - Intronic
1161241263 19:3225078-3225100 GGAGGTGAGCAGAGGAGGGATGG - Intronic
1161277438 19:3426567-3426589 GGCTGTGCGCAGAGGAGGGACGG - Intronic
1161284819 19:3463656-3463678 GGGTGTGAGCCGGGCGAGGTGGG - Intronic
1161289438 19:3485131-3485153 GGCTGTGGGCAGAGGAGGGATGG + Intergenic
1161347488 19:3775531-3775553 GGGTGTGAGCAGTGAAGGGAGGG - Intergenic
1161352774 19:3803226-3803248 GGGTGTGAGGTGGAGGAGGACGG + Intergenic
1161523417 19:4738573-4738595 AGGTGGGAGAAGAGGGGGGAGGG + Intergenic
1161596690 19:5154281-5154303 GGGTGTGGGCAGGGGAGGGATGG + Intergenic
1161604760 19:5208451-5208473 GGGGGTGAAGATAGGGAGGATGG - Intronic
1161619216 19:5289594-5289616 CGGCTGGAGCAGAGGGAGGAGGG - Intronic
1161621388 19:5299152-5299174 GGCTGTGGGCAGAGGAGGGACGG - Intronic
1161664178 19:5565026-5565048 GGCTGTGGGCAGAGGAGGGACGG - Intergenic
1161682821 19:5688436-5688458 GGGTCTGAGCGGGAGGAGGAGGG + Exonic
1161705812 19:5820920-5820942 GTGTCTGAGCAGAGTGAGGAGGG - Intergenic
1161814325 19:6490307-6490329 GAGGGAGAGAAGAGGGAGGAAGG - Intergenic
1161913892 19:7214798-7214820 GGGAGGGAGGGGAGGGAGGAGGG - Intronic
1161926426 19:7303597-7303619 GGAGGGGAGGAGAGGGAGGAAGG + Intergenic
1161964674 19:7541449-7541471 GGGAGCGAGCACAGGGGGGATGG + Intronic
1162038169 19:7953541-7953563 GGGAAGGAGGAGAGGGAGGAGGG - Intergenic
1162080482 19:8214939-8214961 GAGGGGGAGGAGAGGGAGGAGGG + Intronic
1162175029 19:8824022-8824044 GGGTGTGAGCACCGGGAGGCTGG - Intronic
1162186337 19:8907726-8907748 GGGGCTGGGCAGAGTGAGGAGGG + Intronic
1162326411 19:10002284-10002306 GGGTGTGGGAAGAGGGTGGTGGG + Intronic
1162392214 19:10396385-10396407 GGTTCTGAGCAGAGGACGGAGGG - Intronic
1162405129 19:10468658-10468680 GGCTGTGATCAGAGTGTGGAAGG - Exonic
1162430866 19:10627643-10627665 GGGTGTTTGCAGAGGGCAGATGG + Intronic
1162782041 19:13011525-13011547 GGGTGGGAGCAGAGGCAGGGGGG + Intronic
1162806228 19:13139268-13139290 GGGTGTGGGGAGATGGAGGGAGG - Exonic
1162818109 19:13208152-13208174 GGCCGGGAGGAGAGGGAGGAGGG + Intronic
1162854789 19:13460050-13460072 GCGGGTGAGCAGAGGGAGGGGGG - Intronic
1162954995 19:14092507-14092529 GGGTGGGAGTAGAGGAAGGAGGG + Exonic
1163359517 19:16837038-16837060 GGGAGAGGGCAGAGAGAGGATGG + Intronic
1163462303 19:17446486-17446508 TGGTGGGAGCTGAGTGAGGATGG - Intronic
1163518318 19:17778257-17778279 GGGTGTGGCCGGAGGGAGGTTGG + Intronic
1163596503 19:18224101-18224123 GGTAGTGTGGAGAGGGAGGAGGG - Intronic
1164472357 19:28546821-28546843 GGGTGTGTGCCGTGAGAGGAAGG - Intergenic
1165051142 19:33142349-33142371 GGGAGGGAGCACAGGGATGAGGG + Intronic
1165064494 19:33221078-33221100 GGCTTTGAGCAGAGGGATGATGG - Intronic
1165079790 19:33300719-33300741 GGGTGTGTGCGGAGGGAGGTGGG + Exonic
1165124428 19:33583636-33583658 GGCTGTGAGCACAGGGGGCACGG + Intergenic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1165433250 19:35784147-35784169 GGGTGGGAGGAGCGGGAGGGAGG - Intronic
1165792827 19:38502345-38502367 GGGTGTGGGCATAGGGTGGGAGG + Intronic
1166253423 19:41586310-41586332 GGTGGTGAGCAGAGGAGGGAGGG + Intronic
1166257951 19:41619531-41619553 GGTGGTGAGCAGAGGAGGGAGGG - Intronic
1166301746 19:41915119-41915141 GGGTGGGGGCGGGGGGAGGAAGG - Intronic
1166318539 19:42002575-42002597 GGATGTGAGGAGGGGGAGGAAGG + Intronic
1166340765 19:42135314-42135336 GGGACTGGGCAGAGGGAGGTGGG - Intronic
1166364815 19:42273018-42273040 GGGTGGGGGCAGTGGGAGCAGGG - Intronic
1166781293 19:45344982-45345004 GGGTGGGAGGAGAGGGCCGAGGG - Intronic
1166859022 19:45798927-45798949 GGGTGGGGGCAGAGGATGGATGG + Intronic
1166950769 19:46426627-46426649 GGGTGACAGCCGAAGGAGGATGG + Intergenic
1167037121 19:47001133-47001155 GGGTGTGTGCAGATGGAAGGTGG - Exonic
1167284775 19:48592850-48592872 GGGTGTGAGCAGAGGGTATGGGG - Intronic
1167361749 19:49033897-49033919 GGGTGGGAGGGGGGGGAGGAGGG - Intronic
1167537734 19:50065751-50065773 GGGTGTGAGCAGGGGAGGGAGGG + Intergenic
1167574856 19:50313036-50313058 CCGTGGGAGCAGAGGGAGGGAGG + Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167619602 19:50553410-50553432 GCGAGTGAGCAGGGGGAGGAGGG - Intronic
1167688585 19:50971354-50971376 GGGTGTGGGTACAGAGAGGAAGG - Intergenic
1167744574 19:51342964-51342986 GGCTGTGAGCAGGGGGAGGCAGG - Intergenic
1167773828 19:51541901-51541923 GTGTGTGAGCAAAGGCATGAAGG - Intergenic
1167785201 19:51630276-51630298 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1167787300 19:51646700-51646722 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1167822032 19:51937048-51937070 TGGTGTGTGCAGAGAGAGCATGG + Intronic
1168137432 19:54360760-54360782 AGGTGTGTGCAGAGGAAGAAGGG + Intronic
1168160645 19:54508322-54508344 AGGTGTGTGCAGAGGAAGAAGGG - Intronic
1168179358 19:54650376-54650398 GGGTGAGAGGAGAGAGAGGCCGG + Intronic
1168179881 19:54654718-54654740 GGGTGAGAGGAGAGAGAGGCCGG + Intronic
1168241571 19:55091613-55091635 GGCTGTGGGCAGAGGGCCGAGGG - Intronic
1168310278 19:55456492-55456514 GGGGGTGGGCAGAGGGACGGTGG + Intronic
1168311982 19:55465068-55465090 TGGGCTGAGCAGAGGGAGGGAGG - Intergenic
1168431310 19:56283198-56283220 GTGTGTGTGCAGTGGGAGCAGGG - Intronic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
925053476 2:835559-835581 GGTTATGGGCAGAGGGAGGAAGG + Intergenic
925128696 2:1479220-1479242 GGGGTTGAGCAGAGGGGAGAAGG - Intronic
925135210 2:1522043-1522065 TGGGGTCAGGAGAGGGAGGAAGG - Intronic
925173721 2:1767940-1767962 GGGTGGGGGTAGAGGGAGGTGGG + Intergenic
925363238 2:3294372-3294394 GGGTGTGTGTGGAGAGAGGATGG - Intronic
925363290 2:3294605-3294627 GGGTGTGTGTGGAGAGAGGATGG - Intronic
925363421 2:3295255-3295277 GGGTGTGTGTGGAGAGAGGACGG - Intronic
925363429 2:3295288-3295310 GGGTGTGTGTGGAGAGAGGACGG - Intronic
925363491 2:3295588-3295610 GAGGGTGTGCAGAGAGAGGAGGG - Intronic
925363510 2:3295688-3295710 GAGGGTGTGCAGAGAGAGGAGGG - Intronic
925363524 2:3295754-3295776 GTGTGTGTGCAGAGAGAGGACGG - Intronic
925363538 2:3295822-3295844 GTGTGTGTGCAGGGAGAGGATGG - Intronic
925363547 2:3295859-3295881 GGGTGTGTGCAGAGAGAGGATGG - Intronic
925363568 2:3295960-3295982 GTGTGTGTGCAGAGAGAGGATGG - Intronic
925363587 2:3296060-3296082 GTGTGTGTGCAGAGAGAGGAGGG - Intronic
925363655 2:3296375-3296397 GTGTGTGTGCAGAGAGAGGATGG - Intronic
925510869 2:4623465-4623487 GGAAGTGAGAAGAGGGATGATGG + Intergenic
925606638 2:5666945-5666967 AGGGCTGAGCAGGGGGAGGAGGG - Intergenic
925609330 2:5691373-5691395 GGCGGGGAGCAGAGGGAGAAGGG + Intergenic
925663552 2:6228542-6228564 GGAGGGGAGGAGAGGGAGGAAGG - Intergenic
925902055 2:8515836-8515858 GGGAGGAAGGAGAGGGAGGAGGG - Intergenic
925994627 2:9281993-9282015 GAGCATGAGCAGAGGGAAGAAGG - Intronic
926135038 2:10330571-10330593 GTGTGAGAACAGAGGGAGAAAGG - Intronic
926162078 2:10496151-10496173 GGGTGGGATCAGATGGAGGTGGG - Intergenic
926211958 2:10877977-10877999 GGCTGTGAACAGGAGGAGGAAGG + Intergenic
926732970 2:16051087-16051109 GGGTGGGGGCGGAGGGAGGCAGG - Intergenic
926781487 2:16476426-16476448 GTGTGTAAGCAGAGTGAGAAGGG - Intergenic
926878906 2:17518606-17518628 GGGTGGGGGCAGGGAGAGGAGGG - Intergenic
927151355 2:20198302-20198324 CGGTGTTGGGAGAGGGAGGAAGG + Intergenic
927489528 2:23511556-23511578 GTGTGTGAGGACAGGGAGGCTGG + Intronic
927798988 2:26079637-26079659 GGGAGGGAGAAAAGGGAGGAGGG - Intronic
927877188 2:26665736-26665758 AGGTAGGAGGAGAGGGAGGAAGG - Intergenic
927889852 2:26741503-26741525 GAGTGTGAGCACAGGGCTGATGG + Intergenic
928022597 2:27715967-27715989 GGGCGTGGGCAGGGGGAGGGAGG - Intergenic
928087515 2:28355290-28355312 GGGTGTGGGCAGAGGGAATGGGG - Intergenic
928105834 2:28470076-28470098 GGGGAGGAGGAGAGGGAGGAGGG + Intronic
928121144 2:28584339-28584361 TGCTGTGAGCAGAGACAGGATGG + Intronic
928254021 2:29706418-29706440 GGTTGTGGGCAGAGGGGGTAGGG - Intronic
928384213 2:30850851-30850873 TGGGGTGAGGGGAGGGAGGAGGG + Intergenic
928512447 2:32014040-32014062 GGGAGGGAGGGGAGGGAGGAAGG + Intronic
929109663 2:38396125-38396147 GTTTGTGGGGAGAGGGAGGAGGG - Intergenic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929444458 2:41991835-41991857 GGGGGTGAGGAGGGGAAGGAGGG + Intergenic
929591536 2:43150671-43150693 AGGGGTGCACAGAGGGAGGAAGG - Intergenic
929760690 2:44803510-44803532 GGGGGTGGGCAGACGGAGGGAGG - Intergenic
929822059 2:45281752-45281774 GGGTGTGAGCAGATGGAGGTGGG - Intergenic
929868314 2:45736958-45736980 GGGAATGAGCAGATGGAAGAGGG + Intronic
929952102 2:46419962-46419984 GGGTGGGAGTTGAGGGGGGAAGG + Intergenic
929989945 2:46778438-46778460 GGGGGGCAGCAGAGGGAGGTGGG + Intergenic
929994395 2:46816365-46816387 GGATGTTGGGAGAGGGAGGAAGG + Intergenic
931193023 2:60023875-60023897 GGAGGTGAGGAGAGGCAGGAGGG - Intergenic
931223141 2:60306306-60306328 GGGTGGGAGTGGAGGGAGGAAGG - Intergenic
931423754 2:62152109-62152131 GGAGGTGAGCAGAGGGAAGATGG - Intergenic
931851687 2:66257956-66257978 GGATGGGAGGAGAGGGAGGCAGG - Intergenic
932029769 2:68171810-68171832 GATTGTGAGCAGAGGAAGGGAGG + Intronic
932418352 2:71586944-71586966 GGGTGGGAGCAGTGGGAGTAGGG - Intronic
932659523 2:73640308-73640330 GGGTCTCTGCAGAGGGAAGAAGG - Intergenic
932666087 2:73699979-73700001 GGGTCTCTGCAGAGGGAAGAAGG - Intergenic
932771930 2:74505306-74505328 GGGTGTGATCCCAGGGAGGGTGG + Intronic
933076606 2:77935810-77935832 GTGTTTCAGAAGAGGGAGGATGG + Intergenic
933286627 2:80391239-80391261 TGGTGTGAACAGAGTGAAGAGGG - Intronic
933478754 2:82826238-82826260 GGGTGTATTCAGAGGGAGAAGGG + Intergenic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
933638184 2:84730065-84730087 GGATGGGAGGAGAGAGAGGAAGG + Intronic
933691018 2:85179624-85179646 AGGTGTGAGCAGAGCAAGGGAGG - Intronic
933934545 2:87191469-87191491 GGGAGGCAGCAGAGGGAGAAAGG - Intergenic
934520575 2:95017842-95017864 TGATGTGATCAGAGGGAGGATGG + Intergenic
934560893 2:95312792-95312814 TGGTGGGAGCTGAGGGACGAGGG + Intronic
934699054 2:96423908-96423930 GGGGGTGGACAGAGGCAGGAGGG - Intergenic
934718815 2:96558719-96558741 GGGTGTGTGCAGGGTGGGGAGGG - Intergenic
934736051 2:96690410-96690432 AGGTGTGGGAAGAGGGAGGGAGG + Intergenic
934886565 2:98030529-98030551 AGGTGAGAGCAGAGGATGGAGGG - Intergenic
935075949 2:99744040-99744062 GGGTGGGGGCAGAGGGCAGAAGG - Intronic
935494667 2:103765419-103765441 GTGTGTGGGCAGAAGGATGAGGG - Intergenic
935650042 2:105374265-105374287 GGCCGTGAGCTGGGGGAGGAAGG + Intronic
935661607 2:105471536-105471558 GGGTATGAACACAGGAAGGAAGG - Intergenic
935673685 2:105576288-105576310 CTCTGTGAGCAGGGGGAGGAGGG + Intergenic
935713491 2:105919432-105919454 AGCTGTAAGTAGAGGGAGGATGG + Intergenic
935755738 2:106275123-106275145 GGGTGGGGGCAGAGTGAGGGTGG + Intergenic
936239657 2:110776651-110776673 TGGTGTGAGCAGAGTGAGAGAGG + Intronic
936240018 2:110779394-110779416 GGGGGAGAGAGGAGGGAGGAAGG + Intronic
936358598 2:111774427-111774449 GGGAGGCAGCAGAGGGAGAAAGG + Intronic
936789601 2:116135388-116135410 GTGTGTGGGCAGAGGGAGCGAGG + Intergenic
938757281 2:134392541-134392563 TGGTGGGAGCAGGGGAAGGAAGG + Intronic
939839847 2:147173676-147173698 GGGTGTCAGAAGAGAGAGGAAGG - Intergenic
940154699 2:150643201-150643223 GTGTGTGTGCTGGGGGAGGATGG - Intergenic
940400633 2:153244499-153244521 GAGTGTGAGCAGAAGCAGGGTGG + Intergenic
940581383 2:155584656-155584678 GGGTGTGAGCAAAGTGATCAGGG - Intergenic
940907661 2:159183612-159183634 GGTTGAGAGGAGAGAGAGGAGGG + Intronic
941473693 2:165921962-165921984 GGGTGGGAGGAGAGTGAGGGAGG - Intronic
941577829 2:167257147-167257169 TGGTGATAGCAGAGGGAGCAAGG - Intronic
941708023 2:168680473-168680495 GTCAGTGAGCAGATGGAGGAAGG - Intronic
941918620 2:170828383-170828405 TGGGGACAGCAGAGGGAGGAGGG - Intronic
942136587 2:172931944-172931966 GGGTGTGAGGAGTGGCGGGAAGG - Intronic
942227313 2:173828765-173828787 GGGAGAGAGCACAGAGAGGAAGG - Intergenic
942646306 2:178113998-178114020 GGGTTGGAGAAGTGGGAGGAAGG - Intronic
943113396 2:183636419-183636441 GGGGGTGGGGGGAGGGAGGAGGG - Intergenic
943148944 2:184084883-184084905 GGGTGGGAGGAGGGTGAGGATGG + Intergenic
943370588 2:187010996-187011018 GGGTGTGTGCAGAGAGGGGAAGG - Intergenic
944010423 2:194967926-194967948 GGCTTTGAGAACAGGGAGGAGGG - Intergenic
944272719 2:197802050-197802072 GGGGGTGAGCAGGGGTAGGAAGG - Intergenic
944732642 2:202533186-202533208 AGGTGAGAGAAGAGGAAGGAAGG - Intronic
946018035 2:216619894-216619916 GGGAGTGAGGAGACGGGGGAAGG + Intergenic
946152733 2:217787344-217787366 CGGTGGGAGCGCAGGGAGGACGG + Intergenic
946181304 2:217950754-217950776 GGGTGACAGCAGAGGAGGGAGGG - Intronic
946202190 2:218076807-218076829 GGGAGGCAGCAGAGGGAGGCAGG - Intronic
946281384 2:218668202-218668224 GTGTGGCAGCAAAGGGAGGAAGG - Intronic
946394033 2:219434548-219434570 GGGTCTGAGATGAGGGAGGAAGG + Intergenic
946410134 2:219511621-219511643 GGGTGTGAGCAAAGGGGGCAGGG - Intergenic
946427880 2:219609036-219609058 GGCGGTGATCAGAGGGATGAGGG - Intronic
946431447 2:219628947-219628969 GAGTGGGAGGAGAGGGTGGATGG - Intronic
946676215 2:222162548-222162570 TGGTGGGAGCAGAAGGAGTACGG + Intergenic
946884780 2:224211988-224212010 GGGTGGGAGTGGAGGGAGGAGGG - Intergenic
946996469 2:225397914-225397936 GGGAGGGAGGAGAGGGAGGAAGG + Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947331674 2:229035455-229035477 GTGTGTGAGTAGAGGGAAGGAGG - Intronic
947342694 2:229156720-229156742 GGGTTTGAGCAGAGGTGGCATGG - Intronic
947520978 2:230845808-230845830 GGATGTGAGGGGAGGTAGGAAGG - Intergenic
947811163 2:233004725-233004747 GGGTGAGGGGAGAGGGAGCAGGG - Intronic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
947935780 2:234002218-234002240 AGGAGTGGGCAGAGGGAGGAGGG + Intronic
948027604 2:234790360-234790382 GAAGGTGAGGAGAGGGAGGAAGG + Intergenic
948056189 2:235010800-235010822 GGGTTCTAGAAGAGGGAGGAAGG - Intronic
948056207 2:235010869-235010891 GGGTTCTAGAAGAGGGAGGAAGG - Intronic
948056237 2:235011004-235011026 GGGTTTCAGGAGAGGGAGGAAGG - Intronic
948056255 2:235011073-235011095 GGGTTCTAGAAGAGGGAGGAAGG - Intronic
948056286 2:235011190-235011212 GGGTTCTAGGAGAGGGAGGAAGG - Intronic
948223827 2:236293501-236293523 AGGTGTGAGCAGAGGCTGGGAGG - Intergenic
948282738 2:236760350-236760372 GGGAGGGAGAGGAGGGAGGAAGG + Intergenic
948534317 2:238634837-238634859 GGATGTGACTAGAGGGAGGAGGG + Intergenic
948564645 2:238876131-238876153 GGGTGTGGGTGGAGGGCGGATGG + Intronic
948568239 2:238899872-238899894 GGGTGGGAGCAGAGGGTATATGG + Intronic
948671935 2:239574447-239574469 GGCTGAGAGCAGAAGGTGGAGGG + Intergenic
948836824 2:240629895-240629917 GAGAGTGAGCAGGGGGAGCAAGG - Intronic
948859820 2:240747372-240747394 GGGTGTGGGCAGAGCCAGGCTGG + Intronic
948915792 2:241034536-241034558 GGGTGGGGGCAGAGTGAGGGAGG - Intronic
949063888 2:241977595-241977617 GGGTGTGCTCAGTGGGACGAGGG + Intergenic
1168908174 20:1423423-1423445 GGGTGGGAGGTGAGGGAGAAGGG + Intergenic
1169112262 20:3041853-3041875 GGGTGTGGGCAGTGGGAGGCAGG - Intergenic
1169325280 20:4670725-4670747 GGCGGTGAGCACAGGGAGAATGG + Intergenic
1169524027 20:6403402-6403424 GTATGTGAACAGAGGGAGGAAGG + Intergenic
1169715328 20:8610058-8610080 GGGTCTGGGAAGAGGAAGGAGGG - Intronic
1169754573 20:9030127-9030149 GGATGTGAGCAGAGTGATGTAGG + Intergenic
1169820909 20:9708925-9708947 GGATGTGAGCAGAGGAAGGAAGG - Intronic
1170095560 20:12642321-12642343 GGGTGTGGGAAGAGGAAGAAGGG + Intergenic
1170251426 20:14288064-14288086 AGGTGTGACCACAGGGAGGTAGG + Intronic
1170315025 20:15032134-15032156 GGGAGTGAGGAGAGGCCGGAGGG + Intronic
1170566858 20:17612468-17612490 GTGTGTGAGGTGAGGGAGGCTGG - Intergenic
1170590220 20:17765861-17765883 GGCTGTGACCAGATGGAGCATGG + Intergenic
1170594324 20:17793848-17793870 GAGGCTGAGCAGAGGCAGGATGG - Intergenic
1171031729 20:21682654-21682676 GGGTGGGGGCTGAGGGAGGAGGG - Intergenic
1171340034 20:24420383-24420405 GGGTGTGAGGGGAGGGAGTGTGG - Intergenic
1171470868 20:25370252-25370274 GGGTGCCAGCTGAGGGAGTAGGG - Intronic
1171868152 20:30505616-30505638 AGGGGGGAGCAGGGGGAGGAAGG - Intergenic
1172011040 20:31845698-31845720 GGGAGTGGGGCGAGGGAGGAGGG - Intergenic
1172083128 20:32358316-32358338 GTGTGTGTGAAGAGTGAGGAGGG - Intergenic
1172178670 20:32987553-32987575 GGGTGGGAGCAAAGGGAGTGGGG - Intronic
1172300542 20:33846658-33846680 GGGTGTGAGTAGAAGGAGCATGG + Intronic
1172656999 20:36543453-36543475 GGGTTTGGGCAGAGGGAAGAGGG + Intronic
1172693048 20:36803642-36803664 GACTGTGAGCAGTGGGAAGAAGG + Intronic
1173209535 20:41021436-41021458 GGGCTTGTGGAGAGGGAGGATGG + Intergenic
1173427833 20:42958267-42958289 GGGTGAGAGGAGAGGAGGGAAGG + Intronic
1173545491 20:43894685-43894707 GGGAGTGAGCTGAGGGAGGCTGG - Intergenic
1173980152 20:47217855-47217877 GGGGGCGAGCAGGGGGAGGAAGG - Intronic
1174393893 20:50234195-50234217 GGGTGGGAGCAGAGGAAGCTTGG + Intergenic
1174531999 20:51221722-51221744 TGGCGGGAGCAGAGGGAGCAAGG + Intergenic
1174674445 20:52340081-52340103 GGTTGTAAGCAAAGTGAGGATGG + Intergenic
1174845698 20:53941120-53941142 GTGTGTGTGAAGTGGGAGGAGGG + Intronic
1174885098 20:54325140-54325162 GAGAGTGGGCAGAGGGAGGTAGG + Intergenic
1175173768 20:57097422-57097444 CCATGTGACCAGAGGGAGGACGG - Intergenic
1175286457 20:57840036-57840058 GCTTGTGAGCTGAGGGAGGTGGG + Intergenic
1175320519 20:58084669-58084691 GGGTGGGAGGGGAAGGAGGAAGG - Intergenic
1175366867 20:58461674-58461696 GGGAGTGAGGAGAGAGAGGAGGG - Intronic
1175517800 20:59579838-59579860 GGGTCTGAGCACTGGGTGGATGG + Intronic
1175871833 20:62212893-62212915 GGGGGTAAGGAGAGGGGGGATGG + Intergenic
1175871854 20:62212940-62212962 GGGGGTAAGGAGAGGGGGGATGG + Intergenic
1175921635 20:62453043-62453065 GGGTGTGAGCACAGCCAGGCGGG - Intergenic
1175985613 20:62762922-62762944 GGCTGTGAGCAGAGGGATCCCGG - Intergenic
1176186980 20:63785782-63785804 GGCTGTGAGCTGTGTGAGGATGG - Intronic
1176239056 20:64067571-64067593 GGGTGTGGACAGAGCTAGGAGGG - Intronic
1176365068 21:6027794-6027816 GGGTTGGGGCTGAGGGAGGAAGG + Intergenic
1176598236 21:8767587-8767609 TGGGGTGGGCAGGGGGAGGAGGG - Intergenic
1177019033 21:15829293-15829315 GGGTGGGAGCAGGGTGAGGATGG - Intronic
1177164670 21:17586879-17586901 TGGGGTGAGGGGAGGGAGGAGGG - Intronic
1177833566 21:26167248-26167270 GGGAGTAAGGGGAGGGAGGAGGG + Intronic
1178334426 21:31731446-31731468 GGGGGTGGGCAGTGGGGGGAGGG + Intronic
1178379117 21:32093508-32093530 GGGAGGGAGCAGAGGAAGGGAGG - Intergenic
1179086588 21:38223825-38223847 GGTGGGAAGCAGAGGGAGGATGG - Intronic
1179107045 21:38410571-38410593 GGGTATAAGCAGTGGGAGGGAGG + Intronic
1179210420 21:39320164-39320186 GGGTGGGAGGAGAGTGAGGTTGG + Intronic
1179303733 21:40136032-40136054 GGGAGGGAGCAGGGCGAGGATGG + Intronic
1179364963 21:40750515-40750537 GGGTGAGATCAAAGGGAGAAAGG - Intronic
1179404100 21:41111200-41111222 GGGTTTAAGCAGAGGGAGGCAGG + Intergenic
1179501198 21:41810057-41810079 GGGGGTCTGCAGAGGGAGGTGGG + Intronic
1179585368 21:42370942-42370964 GTGTGTGAGCAGTGGCTGGAGGG - Intergenic
1179585388 21:42371042-42371064 GGGTGTGGGCAGTGGCTGGAGGG - Intergenic
1179585527 21:42371652-42371674 GGGAGTGAGCAGTGGCCGGAGGG - Intergenic
1179585532 21:42371672-42371694 GGGTGTGAGCGGTGGCCGGAGGG - Intergenic
1179645310 21:42771738-42771760 GGGTGTGGGCATGGGGAGCACGG - Intronic
1179758450 21:43510751-43510773 GGGTTGGGGCTGAGGGAGGAAGG - Intergenic
1179919140 21:44498004-44498026 TGGAGGGGGCAGAGGGAGGAGGG + Exonic
1180070859 21:45435265-45435287 GGGGGTGGGGGGAGGGAGGAAGG + Intronic
1180259192 21:46656176-46656198 GGGTGGGAGCAGAGGCAAGTGGG - Intronic
1180673980 22:17574432-17574454 TGGTGTGAGCAGAGGGTTCAGGG - Intronic
1180681912 22:17633952-17633974 GGTGGTGTGCAAAGGGAGGAGGG - Intronic
1180945258 22:19689024-19689046 GCCTGTGAGCAGAGGGTGGCAGG - Intergenic
1181052987 22:20246456-20246478 AGGTGGGAGGAGAGCGAGGAGGG + Intronic
1181063201 22:20291832-20291854 GTGTGTGTGAAGAGGGAGGCAGG - Intergenic
1181438996 22:22926281-22926303 GGGGGTCAGCAGGGGGAGAAGGG - Intergenic
1181469540 22:23129242-23129264 GACAATGAGCAGAGGGAGGAAGG - Intronic
1181886878 22:26028548-26028570 GAGTGCTAGGAGAGGGAGGAAGG - Intronic
1181903552 22:26174699-26174721 GGCTGTGACAAGAGGGAGCAGGG + Intronic
1182060690 22:27395040-27395062 GTGAGTGAGCAGATGGATGAGGG + Intergenic
1182103750 22:27674534-27674556 AGGAGTGGGGAGAGGGAGGAAGG - Intergenic
1182196781 22:28527257-28527279 GGGAGTGAGTAGAGGGAGTTGGG - Intronic
1182445367 22:30386773-30386795 GGCCATGAGCAGAGGGAGGTAGG + Intronic
1182585591 22:31342739-31342761 GGAGGAGAGCAGAGGGAGGGTGG + Intronic
1183083344 22:35471397-35471419 GGGTTTGAGCTGAGGCTGGATGG - Intergenic
1183084985 22:35481163-35481185 AGGTGAGGGCAGAGGGAGGCAGG + Intergenic
1183319430 22:37156059-37156081 TCCAGTGAGCAGAGGGAGGACGG - Intronic
1183320866 22:37164312-37164334 GGAGGGGAGCAGAGTGAGGAGGG + Intronic
1183346670 22:37311975-37311997 GGGTGGGAAGAGAGGGAGGCTGG - Intronic
1183933199 22:41247826-41247848 GGCTGGGAGCTGAGGGAAGAGGG + Intronic
1183950072 22:41347832-41347854 TGGTGGGATCAGAGGGAGGGAGG + Intronic
1184067663 22:42129566-42129588 AGGTGTGAGCATGGGGACGAGGG - Intronic
1184093472 22:42304338-42304360 GGTGGTGAGCACAGGGAGGTGGG + Intronic
1184156542 22:42671227-42671249 GGGTGGGAGCAGGGTGAGGATGG + Intergenic
1184255631 22:43285338-43285360 GGGCGTGGGCAGAGCCAGGATGG - Intronic
1184293370 22:43509597-43509619 GGGGGTGAATAGAGGGATGATGG - Intergenic
1184731087 22:46371555-46371577 GGGTGGGTGCAGTGGGTGGATGG - Intronic
1184835652 22:47019557-47019579 GGGTGTGCAGGGAGGGAGGATGG + Intronic
1184920211 22:47600635-47600657 GGGGGTGAGCAGAGGCTGGGAGG - Intergenic
1184929982 22:47673808-47673830 GGATGTGAGCAGAGCTTGGAAGG + Intergenic
1184944590 22:47794114-47794136 AGGTGTGAAGGGAGGGAGGAAGG - Intergenic
1184955981 22:47886207-47886229 AGATGGGAGCAGAGAGAGGAGGG + Intergenic
1185096402 22:48808400-48808422 GGGAGTGGGGAGAGGGAGGGTGG + Intronic
1185110135 22:48896206-48896228 GGGTGAGGGAGGAGGGAGGATGG + Intergenic
1185164402 22:49251912-49251934 GAGTGTGAGCTGAGGGAAGGAGG + Intergenic
1185179391 22:49350339-49350361 GTGTGAGAGCCCAGGGAGGAGGG + Intergenic
1185399964 22:50610599-50610621 GGATGGCTGCAGAGGGAGGAAGG + Intronic
949125259 3:439456-439478 TGGAGGGTGCAGAGGGAGGAGGG + Intergenic
949195591 3:1302490-1302512 GAGAGAGAGAAGAGGGAGGAAGG + Intronic
949817367 3:8072628-8072650 GGGTGTCATCAGAGAAAGGAAGG - Intergenic
950030077 3:9846414-9846436 GGGGGTCAGCAGAGGCAGGATGG + Intronic
950119395 3:10471559-10471581 GAGTGGGAGGAGAGGGAGGGAGG + Intronic
950193236 3:10992401-10992423 GGGGGTGGGGAGAGGGAGGGAGG + Intergenic
950217440 3:11169441-11169463 GGGTGTGAGCAATGGAATGATGG - Intronic
950251445 3:11468932-11468954 GTGTGTGGGCAGATTGAGGATGG + Intronic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950472301 3:13193786-13193808 GGGTGTGAGCAGGTGCAGGCAGG - Intergenic
950498534 3:13349195-13349217 GGGTGGGAGGTCAGGGAGGATGG - Intronic
950549710 3:13658857-13658879 GGGTGTGGGCGGGGGGAGGTTGG - Intergenic
950640128 3:14343433-14343455 GGGTGGGAGCAGGGTGAGGCTGG - Intergenic
950666947 3:14503489-14503511 GTGTGTGTGCAATGGGAGGAAGG - Intronic
950737986 3:15026494-15026516 GGGTTTGAGAAGAGGGGGAAAGG - Intronic
950857001 3:16115151-16115173 TGGCGTGAGCTGAGGCAGGAGGG + Intergenic
951525975 3:23653162-23653184 TGGGGTGGGGAGAGGGAGGAGGG + Intergenic
952255104 3:31688205-31688227 GTGTGAGACCAGAGGGAGGTGGG - Intronic
952887119 3:38018691-38018713 GGGTGGGAGCACAGTGAGAATGG - Intronic
952970009 3:38644848-38644870 GGGTTGGAGCAGAGGGAATAGGG - Intronic
953203757 3:40801586-40801608 GGGTATGGGCAGAGGAAGGAAGG + Intergenic
953230564 3:41061530-41061552 GGGTGGGAGGAGGGAGAGGATGG - Intergenic
953375484 3:42424647-42424669 AGGTGGGGGCAGAGGGAGAAGGG + Intergenic
953666621 3:44930306-44930328 GGGGGTGAGCAGGGAGGGGAAGG + Intronic
953737483 3:45508844-45508866 GGGAGGGAGGAGAGGGAGGAAGG - Intronic
953813716 3:46135684-46135706 TGGGGTGAGCAGAGAGAGGGAGG - Intergenic
953868978 3:46609755-46609777 CGGGGTGGGCAGAGGGAGCAGGG + Intronic
954361564 3:50125265-50125287 GGGGGTGTGCAGAGGGGGGGAGG + Intergenic
954400408 3:50316744-50316766 TGCTGTGGGCAGAGGCAGGAGGG - Intergenic
954449361 3:50563363-50563385 GGGTCTCAGGGGAGGGAGGAGGG - Intronic
954575170 3:51671772-51671794 CGGTGCTAGCAGAGGGCGGAAGG - Exonic
954697437 3:52435282-52435304 GGGTGTGCCCAGAGGCAAGAGGG - Exonic
955365587 3:58307151-58307173 GGGATTGAGCGGAGGGAGAATGG + Intronic
955665902 3:61348905-61348927 GGGAGGGAGGAGAGTGAGGATGG - Intergenic
955775827 3:62432032-62432054 GGGTGGGGGCAGAGAGAGGGAGG - Intronic
955911416 3:63863408-63863430 GGGTGGGACCAGAGGGAGTCCGG - Intronic
956189305 3:66593377-66593399 GGGTGTGAAAAAAGGGTGGAGGG + Intergenic
956718404 3:72098264-72098286 GGGTGGGAGAAGAGGTAGGTGGG - Intergenic
957403914 3:79752549-79752571 AGGTGTGTGCAGAGGGTGAAAGG + Intronic
958089976 3:88865060-88865082 GGATGTGAGAGGTGGGAGGAAGG - Intergenic
958265080 3:91429060-91429082 GGGTATGAAAAGAGGTAGGAAGG + Intergenic
958503197 3:94941051-94941073 GGGGGTGAGGAGAGAGGGGAGGG - Intergenic
958552770 3:95637714-95637736 TTATGTGGGCAGAGGGAGGATGG + Intergenic
959398193 3:105868384-105868406 GGGTCTGAGCTGCAGGAGGAAGG + Intronic
959468609 3:106721013-106721035 GGGTGCCAGCAGAGGGCAGAGGG + Intergenic
959682481 3:109111619-109111641 GGGTGTGAGAGAAAGGAGGAAGG + Intronic
959993854 3:112659288-112659310 TGGGGTGGGCAGAGGGGGGAGGG - Intergenic
960312401 3:116132420-116132442 GGGGTGGAGCAGTGGGAGGAAGG - Intronic
960403895 3:117236432-117236454 GGGTGTTGGGAGAGGGTGGAAGG - Intergenic
960619327 3:119623660-119623682 GGGTGTGTGGAGAGGGAGCAGGG + Intronic
960713048 3:120550151-120550173 GGGTGTAATCAGAGGAAGGCAGG + Intergenic
960733445 3:120751226-120751248 TGGGGTGGGCAGAGGCAGGAGGG - Intronic
960995333 3:123336614-123336636 GGAGGTGAGAAGAGGGAGGGTGG + Intronic
961034788 3:123634779-123634801 GGGAGACAGCAGGGGGAGGAGGG + Intronic
961514554 3:127424603-127424625 GTGTGTGAACAGAGAGAGGGAGG - Intergenic
961530129 3:127535635-127535657 GGCTGTGACCAGAGCGAGGGGGG - Intergenic
961537256 3:127577715-127577737 GGGGGTGAGAAGGGAGAGGAAGG - Intronic
961640309 3:128360728-128360750 GGGTGGGAGTGGAGGGAGGAGGG + Intronic
961662241 3:128475543-128475565 GGGTGCAAACAGAGGGAAGAAGG + Intergenic
961737402 3:129010692-129010714 GGGGGCGAGCAGAGGGGGCATGG + Intronic
961739288 3:129022658-129022680 GGGTGTGAGGGGAGGGTGGGTGG + Intronic
961749680 3:129087913-129087935 GGGGGGAAGCAGAGGGAGGTGGG - Exonic
961760436 3:129163264-129163286 CAGTGTGAGCAGAGAAAGGAAGG - Intergenic
962202817 3:133414844-133414866 AGGTGTGAGTAGATGGAAGAGGG - Intronic
962203070 3:133415826-133415848 AGGGGTGAGTAGAGGGAAGAGGG - Intronic
962203128 3:133416072-133416094 AGGGGTGAGTAGAGGGAAGATGG - Intronic
962270629 3:133975533-133975555 GGGTTTGAGCTGAGGGAACATGG - Intronic
962273953 3:133998397-133998419 GGGTGGGAGCAGGGGGAGGCAGG - Intronic
962275712 3:134011871-134011893 GTGTGAGAACAGAGGGAGGCGGG + Intronic
962338417 3:134559809-134559831 GGGAGTGTGGAGGGGGAGGAAGG + Intronic
962756391 3:138468250-138468272 AGGTGTGTGCAGGTGGAGGAAGG + Intronic
963247273 3:143074854-143074876 GGCTTGGAGCAGAGGGAGGATGG + Intergenic
963275566 3:143326440-143326462 GAGGGAGAGAAGAGGGAGGAAGG - Intronic
963327340 3:143877116-143877138 AGGTGTGGGGAGGGGGAGGAGGG - Intergenic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
966205842 3:177405531-177405553 GGGAGGGAGCAAAGTGAGGATGG + Intergenic
966266723 3:178054960-178054982 GGTTCTTAGCAGAGGTAGGAAGG - Intergenic
966599046 3:181756870-181756892 GGGGGTGAACAGCTGGAGGAGGG + Intergenic
966982888 3:185153699-185153721 GGGTGGGAGGAGAAGGGGGAGGG - Intergenic
967195520 3:187022305-187022327 GTGTGAGAGCAGAGGAAAGATGG + Intronic
967350764 3:188511304-188511326 GGGAGAGAGGGGAGGGAGGAAGG - Intronic
967429225 3:189362180-189362202 GTGAGTGAGCAGAGAGAGAAGGG - Intergenic
967478364 3:189946561-189946583 GGGTGTGAGAAGGGTAAGGAAGG + Intergenic
968439987 4:618438-618460 GGGTGGGAGAAGAGGGGGGTGGG + Intergenic
968460674 4:723355-723377 GGGTGTGATCATTGAGAGGAGGG + Intronic
968504364 4:965116-965138 GGGGGTGGCCAGAGGGAGGTCGG - Intronic
968581450 4:1397193-1397215 GGAGGTGAGCACAGGGAGGAAGG - Intergenic
968663700 4:1809655-1809677 GGAGGAGAGCAGAGGGAGGACGG - Intergenic
968887300 4:3341532-3341554 GGGTGTGGGGGGAGGGAGGGTGG + Intronic
968889196 4:3358969-3358991 GTGTAGGAGGAGAGGGAGGAGGG - Intronic
968889332 4:3359280-3359302 GAGGGAGAGGAGAGGGAGGAGGG - Intronic
968960781 4:3742467-3742489 GGGGGTGTGAAGGGGGAGGAAGG - Intergenic
969197846 4:5577366-5577388 GGTTGTGGGCGGAGGCAGGAGGG + Intronic
969200396 4:5599571-5599593 TGGGGTGGGCAGAGGGGGGAGGG + Intronic
969203644 4:5625213-5625235 TGGAGTGTGCAGAGGGACGAGGG - Intronic
969436560 4:7192505-7192527 GGGAGGGAGCGGCGGGAGGAGGG - Intergenic
969452675 4:7283799-7283821 GGGAGAGAGGAGATGGAGGAGGG + Intronic
969480589 4:7445007-7445029 GGCGGGGAGCAGAGGGAGGGCGG + Intronic
969495266 4:7522881-7522903 GGAGGAGAGAAGAGGGAGGAGGG - Intronic
969495272 4:7522902-7522924 GGAGGAGAGAAGAGGGAGGAGGG - Intronic
969495330 4:7523089-7523111 GGGAGGAGGCAGAGGGAGGAGGG - Intronic
969497611 4:7535027-7535049 GTGTGTCAGCAGGAGGAGGAGGG - Intronic
969622539 4:8285897-8285919 GGGTGAGGGTAGAGGGAGGTGGG + Intronic
969690456 4:8701439-8701461 GGGTGAGGAGAGAGGGAGGAGGG - Intergenic
970121186 4:12754132-12754154 TGGGGTGGGCAGAGGGGGGAGGG + Intergenic
970139412 4:12965358-12965380 GGGTCAAAGCAGAGGGAGAAAGG + Intergenic
970323512 4:14899031-14899053 GGGAGGGAGGAGAGGGAGGGAGG + Intergenic
970572047 4:17392892-17392914 GGGTGGAAGGAGAGGGTGGAAGG + Intergenic
970607648 4:17695514-17695536 GGGTGAGAGCAGTGGCAGGCAGG + Intronic
970873715 4:20845491-20845513 GGGAGTCAGCAGAGGGTGGTGGG - Intronic
971177253 4:24292948-24292970 GGGTGTGAGGTGAGGGGGTAGGG - Intergenic
971400859 4:26274175-26274197 GGGTGTGAGCATGGGGCAGATGG - Intronic
971523289 4:27582640-27582662 TGGTGTGAGGGGATGGAGGAGGG + Intergenic
971898649 4:32628866-32628888 TGGGGTGGGGAGAGGGAGGAGGG + Intergenic
972043131 4:34629293-34629315 GGCAGTGAGCAGAGGCTGGAAGG - Intergenic
972075337 4:35079764-35079786 TGGTGCCAGCAGAGGCAGGAGGG - Intergenic
972247275 4:37258662-37258684 GAGTGTCAGCAGGTGGAGGAAGG + Intronic
972321509 4:37977245-37977267 GGGGGTGGGCGGGGGGAGGAGGG - Intronic
972387057 4:38577389-38577411 GGCTGTGAGTGGAGAGAGGAGGG + Intergenic
972418306 4:38863973-38863995 TGGCTGGAGCAGAGGGAGGATGG - Intergenic
972639391 4:40911886-40911908 GTGTAGGGGCAGAGGGAGGAGGG - Intronic
973229315 4:47823857-47823879 GGGTCTGAGTAGGAGGAGGAAGG - Intronic
973566040 4:52188637-52188659 GGGTGGGAGGAGGGTGAGGATGG - Intergenic
973588250 4:52413721-52413743 GTGTGTGACGAAAGGGAGGATGG - Intergenic
973760386 4:54109671-54109693 GGGTGGACGCAGAGGGAGGAAGG + Intronic
973761036 4:54116065-54116087 GGGTGGGAGGAGGGTGAGGATGG - Intronic
973789000 4:54361546-54361568 GCCTGTGAGCTGAAGGAGGATGG + Intergenic
974536197 4:63178975-63178997 TGGGGTGGGGAGAGGGAGGAGGG - Intergenic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
975473349 4:74794554-74794576 GGGTGTGTGCAGGAGGAGGGGGG - Exonic
975510841 4:75192761-75192783 TGGAGGGAGCAGAAGGAGGAAGG - Intergenic
976304050 4:83541879-83541901 GGATGTGAGCACAGAGAGAAAGG - Intronic
976417342 4:84793013-84793035 GGAAGTGGGCACAGGGAGGAAGG + Intronic
976753375 4:88473312-88473334 GGGTGAGGCTAGAGGGAGGAAGG - Intronic
976775168 4:88698918-88698940 GGGGGTGAGGAGGGTGAGGAAGG - Intronic
976795367 4:88926035-88926057 GGGTGATAAGAGAGGGAGGAAGG + Intronic
978808500 4:112825188-112825210 TGGGGTGGGGAGAGGGAGGAGGG + Intronic
978912836 4:114084707-114084729 GGGTGTGGGCAGCTGGAGAAAGG + Intergenic
979273567 4:118791528-118791550 GGGAGAGAGAGGAGGGAGGAGGG - Intronic
979818033 4:125134390-125134412 TGGGGTGGGCAGAGGGGGGAGGG + Intergenic
980395334 4:132206989-132207011 TGGGGTGGGGAGAGGGAGGAGGG - Intergenic
980430421 4:132686739-132686761 TGGGGTGGGGAGAGGGAGGAGGG - Intergenic
980826728 4:138082150-138082172 TGGTCTGAGCATGGGGAGGAGGG - Intergenic
981110806 4:140931072-140931094 GGGTGTGGGGAGAGAGAGAAGGG + Intronic
982111939 4:152064940-152064962 GGTTGTGGGGATAGGGAGGAAGG - Intergenic
982636190 4:157899714-157899736 ATGTGTGGGCTGAGGGAGGAGGG + Intergenic
983308210 4:166021368-166021390 GGAGGGAAGCAGAGGGAGGAAGG - Intronic
983418727 4:167490655-167490677 TGGGGTGAGGAGAGGGGGGAGGG + Intergenic
984998937 4:185465890-185465912 TGGTGAGAGCAGATGGATGAGGG + Intronic
985054621 4:186025590-186025612 GAGTGTGAGAGGAGGGTGGATGG + Intergenic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985487117 5:158158-158180 AGGATAGAGCAGAGGGAGGAGGG - Intronic
985487236 5:158510-158532 TGGGATGGGCAGAGGGAGGAGGG - Intronic
985549528 5:525907-525929 GGGTGGGTGCAGATGGAGGATGG + Intergenic
985565165 5:611961-611983 GGGTGGGAGCGGAGTGTGGATGG + Intergenic
985732176 5:1555524-1555546 TGGTGTTTGCAGAGGGAGGCAGG - Intergenic
985800779 5:2004360-2004382 GGGTGTGAGCACAGCATGGAGGG + Intergenic
985909738 5:2869498-2869520 GGATGTGTGCTGAGGGAAGATGG + Intergenic
985922090 5:2985440-2985462 GGGTCTGGGCAGTGGAAGGAAGG - Intergenic
986439174 5:7763574-7763596 GGGGCTGGGGAGAGGGAGGATGG - Intronic
986490724 5:8286905-8286927 GAGAGGGAGGAGAGGGAGGAAGG - Intergenic
986581459 5:9270701-9270723 GGGTGGGGGCAGGGGGAGGAGGG + Intronic
986670571 5:10139530-10139552 GGTGGAGAGCAGAGGGAGGAAGG + Intergenic
986929573 5:12801508-12801530 GGGTGTGTGTAAAGGGAGGGGGG - Intergenic
987831540 5:23102103-23102125 GGGTGTGAGAAAATGGTGGAAGG - Intergenic
988092351 5:26560289-26560311 TGGGGTGAGGAGAGGGGGGAGGG + Intergenic
988095637 5:26605845-26605867 GGGTTGGAGGAGAGGGGGGATGG - Intergenic
988514893 5:31895764-31895786 GGGTGGGAGCAGACAGAGGGAGG - Intronic
989209623 5:38846146-38846168 GGGCGCGAGCAGAGCGGGGACGG - Exonic
989284392 5:39682656-39682678 TGGGGTGAGGGGAGGGAGGAGGG - Intergenic
989475581 5:41869910-41869932 GGGTCTGAACGGGGGGAGGAGGG - Intronic
989630038 5:43472806-43472828 GGGGGTCAGCAGGGGGAGGTGGG + Intronic
990257410 5:53985219-53985241 GAGTGTGAGCAGAGGGAGTGAGG - Intronic
990943871 5:61230152-61230174 GGGTGAGAGGAGAGGGGAGAGGG - Intergenic
991050211 5:62264826-62264848 GGGAGAGAACAGATGGAGGATGG + Intergenic
991385026 5:66077747-66077769 GTGTGTGTGTAGAGGGAGGGAGG - Intronic
991445578 5:66696468-66696490 GGGTGAAAGGTGAGGGAGGAAGG - Intronic
992129026 5:73672925-73672947 GGTTGTGGGGATAGGGAGGAAGG - Intronic
992605087 5:78447894-78447916 AGGAGGGAGAAGAGGGAGGAGGG - Intronic
993322559 5:86490658-86490680 GTGAGGGAGCAGAGGAAGGATGG - Intergenic
993364591 5:87020160-87020182 GGTTCTGAGGAGAGGGAGGGAGG - Intergenic
993742209 5:91555534-91555556 GAGTGTGAGCTGAAGGAGGGCGG + Intergenic
994171019 5:96660197-96660219 AGGTGTGAACAGAAGGAGAAGGG - Intronic
994855191 5:105111331-105111353 GGGTGGGAGGAGAGACAGGAAGG + Intergenic
994988135 5:106964214-106964236 GTGTGTAAGCAGAGGTAGCAGGG + Intergenic
995059283 5:107796146-107796168 GGGCATGAGCAGAGTGAGCAGGG + Intergenic
995106199 5:108380893-108380915 AGGTGGGAGAAGAGGGCGGAGGG + Exonic
995644007 5:114291330-114291352 TGGGGTGAGGAGAGGGGGGAGGG - Intergenic
996082566 5:119271799-119271821 GGATGTGGGCAGTGTGAGGAGGG - Intronic
996365797 5:122699792-122699814 GGATGGAAGCAGAGGGAGAAAGG - Intergenic
996924803 5:128811883-128811905 GGGAGGGAGGGGAGGGAGGAAGG - Intronic
997262389 5:132475067-132475089 GGGGGTGTGGAGATGGAGGAGGG + Intronic
997681090 5:135751212-135751234 GGGCCTGAGCTGAGGCAGGAGGG - Intergenic
998093128 5:139382449-139382471 GGGAGTGTGCAGAGTGAGGGCGG + Intronic
998140894 5:139698822-139698844 AGCTGGGAGCAGAGGGAGCAGGG - Intergenic
998170340 5:139868860-139868882 GGGTAGGGGCAGAGGGATGAGGG + Intronic
998230966 5:140361174-140361196 GTGTCTGGGCAGAGGGAGAAGGG + Intronic
998352281 5:141509289-141509311 GGGTGGAGGCAGAGGGAGGCTGG + Intronic
998392673 5:141797425-141797447 GGGTGTGAGAAGAAGCAGGAGGG - Intergenic
998443165 5:142178941-142178963 GGGAGAGAGCAGAGTGAGGTTGG - Intergenic
998467336 5:142356753-142356775 GGGGGTGGGCAGGGGGCGGAGGG - Intergenic
998631408 5:143902924-143902946 GGGTGTGAGAAGAGAAAGGTTGG + Intergenic
998807516 5:145933385-145933407 GGGTGGGAACAGCGGGAGAAGGG + Intergenic
998819709 5:146047597-146047619 GGCTGTGGGCACAGGGAGGTGGG - Intronic
998885708 5:146691740-146691762 GTGAGTGAGCAGGGAGAGGATGG - Intronic
999283499 5:150380179-150380201 GGATGACAGCAGACGGAGGAGGG - Intronic
999313269 5:150567169-150567191 GGCTGAGGGGAGAGGGAGGATGG + Intergenic
999673379 5:153976454-153976476 AAGAGTGAGGAGAGGGAGGATGG - Intergenic
999721519 5:154402241-154402263 GGGCAGGAGCAGAGGGAGAAAGG - Intronic
999742963 5:154570713-154570735 GGGTGAGCTCAGAGGGAGCAGGG - Intergenic
1000041250 5:157486682-157486704 GAGTGCCAGCAGAGGGAGGAGGG - Intronic
1000052024 5:157571682-157571704 GAGTGAGAGCAGAAGCAGGAAGG + Intronic
1000523537 5:162327736-162327758 TGGTGTGATCACAGAGAGGAAGG + Intergenic
1000664589 5:163979549-163979571 TGGGGTGGGCAGAGGGGGGAGGG - Intergenic
1000721870 5:164718388-164718410 GAGGGTGAGGAGTGGGAGGAGGG - Intergenic
1000937193 5:167316951-167316973 GGGGGTGTGCAGAGGAAGGCTGG - Intronic
1001003777 5:168031698-168031720 GGGAGGGAGGGGAGGGAGGAAGG + Intronic
1001080067 5:168661026-168661048 GGGTGTCATCCGAGGGAGGCAGG - Intergenic
1001314558 5:170633079-170633101 GGGGGAGAGCAGAGGGAAGGGGG + Intronic
1001429139 5:171645832-171645854 GGGCCTGGGCTGAGGGAGGAAGG + Intergenic
1002096315 5:176833286-176833308 GGGTGGGAGGAGGGTGAGGACGG - Intronic
1002280114 5:178124860-178124882 GGCTGTGGGCGCAGGGAGGAGGG - Exonic
1002335872 5:178478012-178478034 GGGTGTGGGAGGAGGGAGCATGG + Intronic
1002517120 5:179766830-179766852 AGTTGTGGGAAGAGGGAGGAGGG + Intronic
1002761512 6:206022-206044 GGATGTGAGGAAGGGGAGGAAGG - Intergenic
1003064864 6:2895257-2895279 GTGGGTGAGGAGAGGGAGGAGGG + Intronic
1003521637 6:6863227-6863249 GGGTGAGAGCTGAGGGTGAAGGG - Intergenic
1003567675 6:7234367-7234389 GGGTGACAGCAGGGGGAGGTGGG - Intronic
1003838417 6:10095171-10095193 TGGTGGGCCCAGAGGGAGGAAGG + Intronic
1004097369 6:12570809-12570831 GTGTGAGAGCAGGAGGAGGAAGG + Intergenic
1004323078 6:14648190-14648212 GGGTTTGGGTAGCGGGAGGATGG - Intergenic
1004902140 6:20204675-20204697 GTGTGTGTGCAGAGGCTGGAGGG + Intronic
1005069688 6:21851760-21851782 GGAAGTGAGGAGAGGGAGGTGGG - Intergenic
1005091506 6:22061692-22061714 GGGCAGGAGCAGATGGAGGAAGG - Intergenic
1005402652 6:25450763-25450785 GGGAGGGAGGGGAGGGAGGAAGG - Intronic
1005565933 6:27094453-27094475 GGGAGGGAGGAGAGGGAGGGAGG + Intergenic
1005959204 6:30684255-30684277 GTGTATGTGCAGAGCGAGGAAGG + Intronic
1006082637 6:31576228-31576250 GGGTGTGAGAAGAGAGATGGGGG + Intronic
1006162452 6:32046453-32046475 GGAGCTGTGCAGAGGGAGGAGGG + Intronic
1006295324 6:33167577-33167599 GGGTGTGGGCAGGGGGCAGAGGG + Intronic
1006361173 6:33588236-33588258 GGGGATGAGAAGAAGGAGGAGGG - Intergenic
1006397699 6:33797837-33797859 GGTTTTGAGCAGAGGAGGGATGG - Intronic
1006404709 6:33838196-33838218 GTTTGCGGGCAGAGGGAGGAGGG + Intergenic
1006449841 6:34099525-34099547 GGGAGGCAGCAGAGGGAGCAGGG + Intronic
1006829556 6:36960646-36960668 GGGTGGGGGTAGAGGGAGGGGGG - Intronic
1007120659 6:39377908-39377930 GGCAGTGAGAAGAGGGAGGAGGG + Intronic
1007209467 6:40180630-40180652 GGGTGGGAGCAAAAGGAGAAGGG + Intergenic
1007235659 6:40389999-40390021 GGGAGGGAGGAGAGTGAGGAAGG + Intergenic
1007285416 6:40744120-40744142 GGCCGTGAGCACAGGGAGCATGG + Intergenic
1007363773 6:41375835-41375857 GGGTGTGAGATGAGGGAAGTTGG + Intergenic
1007502835 6:42311803-42311825 GGTTGTGAGCAGAGGAGAGATGG + Intronic
1007750648 6:44068689-44068711 GGGTCTCAGCAGAGGCAGCAGGG + Intergenic
1007962204 6:45970069-45970091 GGGGGTGAGGAGAGGGAGGAAGG - Intronic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1008927562 6:56902913-56902935 GTGTGTGTGTAGAGGGTGGAGGG - Intronic
1008990304 6:57593592-57593614 GGGTATGAAAAGAGGTAGGAAGG - Intronic
1009178878 6:60492143-60492165 GGGTATGAAAAGAGGTAGGAAGG - Intergenic
1009696342 6:67108873-67108895 GGGTGTGTGGAGAGGAAGTAGGG + Intergenic
1009727253 6:67551379-67551401 TGGGGTGAGGAGAGGGGGGAGGG + Intergenic
1010363211 6:75018868-75018890 GGGAGTGAGGAGAGGGAGGCAGG - Intergenic
1010398829 6:75425496-75425518 GGGTGTGTGCTGAGGTAGGGTGG - Intronic
1010680399 6:78792470-78792492 GAGTGTGGACAGTGGGAGGAGGG + Intergenic
1010717352 6:79244963-79244985 GGGTGGGAGGGTAGGGAGGATGG + Intergenic
1011075074 6:83430711-83430733 TGGTGTGGGCAGAAGGAAGAAGG - Intronic
1011203986 6:84871943-84871965 GTGTGTGTGCGGAGGGTGGAGGG + Intergenic
1011547686 6:88499222-88499244 GGGTCTGGGCAGAGGGAGCAGGG + Intergenic
1011798608 6:90983817-90983839 GGCTGTGTGAAGAGGGAGGCAGG - Intergenic
1011842368 6:91517409-91517431 GGCCATGAGCAGAGTGAGGAGGG + Intergenic
1012860510 6:104553730-104553752 GGTTGTTACCAGAGGCAGGAGGG + Intergenic
1012898461 6:104978783-104978805 GGTTTTGATCAGAAGGAGGAAGG - Intronic
1013386415 6:109636165-109636187 GGGTTTGTGCAGTAGGAGGAAGG - Intronic
1013939351 6:115643395-115643417 GGGTGTGTGACCAGGGAGGAAGG + Intergenic
1014243056 6:119039610-119039632 GGGGTTGAGGAGAGGGAGGAAGG + Intronic
1014517601 6:122399417-122399439 GGGTGGGAGCAGAAGGGGGTGGG - Intergenic
1014999171 6:128192871-128192893 GGAGGGGAGGAGAGGGAGGAAGG + Intronic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015465342 6:133542806-133542828 GTGTGTGTGCAGAGGAAGGAGGG + Intergenic
1015554594 6:134448404-134448426 GGCTGAGAGGAGAGGGAGAACGG + Intergenic
1015619696 6:135118302-135118324 TGGTGAGAGCAGAGGGTGGAGGG - Intergenic
1015631566 6:135236900-135236922 AGGTGTTAGGAGAGGCAGGAAGG - Intergenic
1016335324 6:142998763-142998785 TGGTGTGGGGGGAGGGAGGATGG - Intergenic
1016440932 6:144082625-144082647 GGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1016546732 6:145232473-145232495 GGGTGGGAGGAGGGAGAGGATGG - Intergenic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1016923391 6:149317637-149317659 GGGTGGGGGCAGAGGGAGGTGGG + Intronic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017256578 6:152340282-152340304 AGGTGTGAGCAGAGGTCGGAGGG + Intronic
1017540235 6:155394229-155394251 GGGAGTGGGGAGGGGGAGGAAGG - Intergenic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018007085 6:159632291-159632313 TGATGTGATCAGAGGGAGGACGG - Intergenic
1018081055 6:160259646-160259668 GGGTGAGAGAAGAGACAGGAGGG - Intronic
1018652492 6:166003730-166003752 GGCTGTGAGCAGAGGAATGCAGG + Intergenic
1018706305 6:166465779-166465801 GTCTGTGAGCAGCTGGAGGACGG + Intronic
1018762644 6:166905134-166905156 GGCTGTGAGCAAAAGGAGGGAGG - Intronic
1018906801 6:168080277-168080299 GGATCTGAGCGGAGGGAGGGAGG - Intronic
1018943168 6:168324093-168324115 GGGTGGGAGAAGGGTGAGGAAGG - Intergenic
1019260824 7:81026-81048 GGGGCTGATCAGAGGGAGGCCGG - Intergenic
1019275219 7:172593-172615 GGGAGTGAGGAGAGGGATGCGGG + Intergenic
1019332956 7:469960-469982 GGGTGGGTGAAGAGGGAGGTGGG - Intergenic
1019411925 7:910491-910513 TGGTGGGAGGAGAGGCAGGAGGG - Intronic
1019474657 7:1238247-1238269 GGGTGGGGGGAGATGGAGGACGG - Intergenic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1019480692 7:1265349-1265371 GGCTGGGAGCAGAGGGAGGGGGG + Intergenic
1019542937 7:1559643-1559665 GGGTGTGAGCAGGGGGTGACAGG + Intronic
1019587979 7:1815129-1815151 GGGCGGGGGCAGGGGGAGGAAGG - Intergenic
1019964848 7:4490500-4490522 AGCTGGGAGCAGAGGGAGGCTGG - Intergenic
1020011490 7:4808002-4808024 GAGGGAGAGGAGAGGGAGGAGGG - Intronic
1020139981 7:5606758-5606780 GGGAGTGTGCAGTGGGAGGGAGG + Intergenic
1020404640 7:7818142-7818164 GGGTCTTATCAGAGGGTGGAAGG - Intronic
1022010521 7:26304527-26304549 GGGTGTGGGCAGATGGGAGAGGG + Intronic
1022383849 7:29884279-29884301 AGGTGGGAGCAGAGGGAGCGGGG - Exonic
1022625269 7:32029571-32029593 GGGTGGGAGGAGAGGAAAGAAGG + Intronic
1022808125 7:33843460-33843482 GTGTGTGAGCTGAGTGAGGCTGG + Intergenic
1023537811 7:41231928-41231950 GTGTGGGAGCAGAGTGAGGCCGG - Intergenic
1023667154 7:42535793-42535815 GGGCTTGAGGAGAGGGAGGGAGG - Intergenic
1023872018 7:44268461-44268483 GGCTGTGGGGTGAGGGAGGAGGG - Intronic
1023878683 7:44306727-44306749 GGGTGTGGGCAGGAGGAGGAGGG + Intronic
1023878714 7:44306825-44306847 GAGTGTGAGTAGAATGAGGAGGG + Intronic
1023878719 7:44306845-44306867 GGGTGTGAGCAGGGGAAGGAAGG + Intronic
1023878724 7:44306865-44306887 AGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1023878735 7:44306922-44306944 GGGTGTGAGCAGGAAGAGAAGGG + Intronic
1023878749 7:44306962-44306984 GGATGTGAGAAAGGGGAGGAGGG + Intronic
1023878754 7:44306982-44307004 GGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878757 7:44307002-44307024 GGGTGTGAGCAGGAAGAAGAGGG + Intronic
1023878769 7:44307042-44307064 GGCGGTGAGCAGGGGGAGGAGGG + Intronic
1023878776 7:44307062-44307084 GGGTCTGAGCAGGGGGAGGAGGG + Intronic
1023878782 7:44307082-44307104 GGGTCTGAGCAGGGGATGGAGGG + Intronic
1023878793 7:44307119-44307141 GGGTGTGAGCAGGGGGAGGAGGG + Intronic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878806 7:44307179-44307201 GGGTGTGAGCAGAGAGAGGAGGG + Intronic
1023878816 7:44307216-44307238 GGGTATGAGCAAGGGGAGGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878826 7:44307256-44307278 GGGTGTGAGCAAGGGGAGGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878835 7:44307296-44307318 GGGTGTGAGCAGGCGGAGGAGGG + Intronic
1023878852 7:44307356-44307378 AGTTGTCAGCAGGGGGAGGAGGG + Intronic
1023878856 7:44307376-44307398 GGGTGTGAGCAGGGAGAAGAGGG + Intronic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1023878869 7:44307416-44307438 GGGTGTGATCAGGGGGAGGAGGG + Intronic
1023981012 7:45069986-45070008 GGGTGGGAGCAGGGACAGGAGGG + Intronic
1024054903 7:45653726-45653748 GGGTATGAGCAGAAGAAGGTGGG - Intronic
1024242785 7:47448236-47448258 GAGGGGGAGCACAGGGAGGAGGG + Intronic
1024311613 7:47974671-47974693 AGGAGGGAGCAGGGGGAGGAGGG + Intronic
1025049588 7:55723128-55723150 GAATGTGTGCAGAGGGAGGTGGG - Intergenic
1026060077 7:67018081-67018103 GGCTCAGAGGAGAGGGAGGAAGG + Exonic
1026103106 7:67398854-67398876 GGGAGTGAGATGAGGGAGGTAGG + Intergenic
1026223194 7:68418225-68418247 GTATATGAGGAGAGGGAGGATGG - Intergenic
1026545200 7:71316283-71316305 GGATCTGATCAGAGGGAGAATGG + Intronic
1026718041 7:72807106-72807128 GGCTCAGAGGAGAGGGAGGAAGG - Exonic
1026968533 7:74454545-74454567 GGGTGGGAGCAGAGGGGGCTGGG + Intronic
1026984442 7:74546100-74546122 GGGTGAGGGCGGAGGGATGAGGG - Intronic
1027238777 7:76314046-76314068 GGGTGGGAGCTCAGGGAAGACGG - Intergenic
1027524681 7:79252456-79252478 GGGTGAGAGGAGTGGTAGGAAGG + Intronic
1027814092 7:82946657-82946679 TGGTCGGAGCAGAGTGAGGAGGG + Intronic
1028191513 7:87858356-87858378 GGGTGTAAGAACAGGGAGTAAGG - Intronic
1028243784 7:88451930-88451952 GGGTATGAGGGGAGGGAGGGAGG - Intergenic
1028244384 7:88459409-88459431 TGGTGTGAGATGAGGGAGGCAGG - Intergenic
1028892881 7:96008307-96008329 GGGAGAGAGCAGAGGGAAGGGGG + Intronic
1029129221 7:98317584-98317606 CGGTGTGAACTGAGGGATGAGGG - Intronic
1029238392 7:99142669-99142691 GGGAGTGAGAAGAGGGTGGGTGG + Intronic
1029412953 7:100427137-100427159 GGGAGGGAGGAAAGGGAGGAGGG - Intronic
1029469942 7:100748023-100748045 GGGTCTGGGCACAGGGAGTAGGG + Intronic
1029504067 7:100951512-100951534 GGGTGTGACCAGAGGAGGGAAGG + Intronic
1029601094 7:101563889-101563911 GGGGCTGTGGAGAGGGAGGAGGG - Intergenic
1029619763 7:101682838-101682860 ATGTGTGAGCATAGGGATGATGG - Intergenic
1030014619 7:105206205-105206227 GTGTGTGTGCTGGGGGAGGAGGG + Intronic
1030555679 7:111021250-111021272 AGGAGTGAGAAGAGGGAGAAAGG - Intronic
1030844591 7:114393467-114393489 GAGTCTGACCAGAGAGAGGAGGG + Intronic
1031323676 7:120365164-120365186 GGGAGGGAGCAAAGAGAGGAAGG + Intronic
1031982438 7:128136400-128136422 GGATGTGTGCTGCGGGAGGAGGG - Intergenic
1032195398 7:129785742-129785764 CGCTGTGAGCCGAGGGTGGAGGG - Intergenic
1033225614 7:139559920-139559942 GGCTGTGAGCTGAGGGTGTAGGG + Intergenic
1033792620 7:144809533-144809555 GTGTATGAGCAGAGAGATGATGG - Intronic
1034044965 7:147918023-147918045 GGGTGTGGGCAAAGGCAGGGAGG - Intronic
1034113280 7:148559178-148559200 GGGTGTGAGTGGTGGAAGGAGGG - Intergenic
1034306483 7:150048434-150048456 GGGTGCGTGAAGAGGGTGGAGGG + Intergenic
1034348532 7:150401939-150401961 GGTGGTGAGCAGAGGGGAGAAGG - Intronic
1034422116 7:150995768-150995790 GGGTCGGGGCAGAGGGAGGAGGG - Intronic
1034422144 7:150995834-150995856 GGGACGGGGCAGAGGGAGGAGGG - Intronic
1034422210 7:150995997-150996019 GGATGGGAGCAGAGGGAGGAGGG - Intronic
1034422223 7:150996031-150996053 GGGTAGGGGCAGAGGGAGGAGGG - Intronic
1034422249 7:150996097-150996119 GGGTAGGGGCAGAGGGAGGAGGG - Intronic
1034422275 7:150996163-150996185 GGGAGAGGGGAGAGGGAGGAGGG - Intronic
1034458175 7:151182978-151183000 GGGTGTGATCTCAGGGAGGCTGG + Intronic
1034800363 7:154052209-154052231 GGGTGCGTGAAGAGGGTGGAGGG - Intronic
1035163637 7:156969899-156969921 GGGTGAGAGGAGAAGGAGGGAGG + Exonic
1035171036 7:157017713-157017735 GGGTGGGAGCAGAGGGCTGGAGG - Intergenic
1035627080 8:1078562-1078584 GGGTTAGAGGAGAGGGAGGGAGG - Intergenic
1035770813 8:2145488-2145510 GGGGGTGAGCAGGGGCAGGTAGG - Intronic
1036426485 8:8649635-8649657 GGGTGTGAGAAAGGGGAAGAGGG - Intergenic
1036481893 8:9147385-9147407 GGGTGTGAACTGAGGGAGGAAGG + Intronic
1037009325 8:13821001-13821023 GGGTGTGTGCAGAGAAAGAAAGG + Intergenic
1037157915 8:15728443-15728465 GGATGTGTGGAGAGGGAGGGAGG + Intronic
1037415538 8:18645931-18645953 GAGTGTGTGCAGAGAGAGGTAGG - Intronic
1037429341 8:18793172-18793194 TGGGGTGGGGAGAGGGAGGAGGG + Intronic
1037454627 8:19051189-19051211 GATTGGGACCAGAGGGAGGAGGG - Intronic
1037520380 8:19675162-19675184 AGTTGTGAGCAGAGGAAGAATGG - Intronic
1037743493 8:21625644-21625666 TGGTGTGAAGAGGGGGAGGACGG + Intergenic
1037815905 8:22111752-22111774 GGGAGGCAGCTGAGGGAGGACGG + Intergenic
1037861460 8:22408454-22408476 GAGAATGAGCAGACGGAGGAGGG + Exonic
1038229337 8:25685836-25685858 GGGGGTGAGAAGTGGGAAGAGGG + Intergenic
1038337904 8:26660220-26660242 GGGTGTGAGCAAAGGGGACAGGG + Intergenic
1038906630 8:31911573-31911595 GGGTCTTACCAGATGGAGGAGGG + Intronic
1039043478 8:33429578-33429600 GGGGGAGGGCAGATGGAGGAAGG + Intronic
1039133076 8:34289945-34289967 GGGTGAGTGCAGAGGGAGGGAGG + Intergenic
1039187264 8:34931153-34931175 GGGAGGGAACAGAGGGAGGGAGG + Intergenic
1039254968 8:35709106-35709128 GGGTTTGAGCAGAGTGGAGATGG - Intronic
1039382943 8:37102856-37102878 GGGGTTGGGGAGAGGGAGGATGG - Intergenic
1039468076 8:37797601-37797623 GGGTGGGAGCAGGGGGAAGGGGG + Intronic
1039647788 8:39306089-39306111 GTGTGTGAGCTGTGGGAGCATGG - Intergenic
1039727736 8:40238129-40238151 GGAAGAGAGAAGAGGGAGGAGGG - Intergenic
1039813955 8:41075655-41075677 GGGTTTGAGAAGACAGAGGAGGG + Intergenic
1039826705 8:41180476-41180498 GTGTTTGGGCAGAGTGAGGATGG - Intergenic
1040454578 8:47583795-47583817 GGGTGTGTGAAGGGAGAGGAAGG - Intronic
1040469420 8:47724912-47724934 GGTGGTGAGCAGAGTGAGGGAGG - Intronic
1041006652 8:53502703-53502725 GGGTTGGAGCAGTGGGAGGTGGG - Intergenic
1041170494 8:55137231-55137253 GGATGTGAGTAGAGAGAGGAGGG + Intronic
1041172288 8:55156419-55156441 GGGGGTGGGGAGAGGGAGGAAGG + Intronic
1041230738 8:55748556-55748578 GGGAGGGAGGGGAGGGAGGAAGG + Intronic
1041340982 8:56845107-56845129 GGGAGTGAGCAGATGGGAGAGGG + Intergenic
1041639747 8:60184467-60184489 GGCTGGGAGCTGAGGGAAGAGGG - Intergenic
1041846154 8:62331126-62331148 GGGTGGAAGAGGAGGGAGGAAGG - Intronic
1042146264 8:65733276-65733298 GGGTGTGCCCAGAGGGAGATGGG + Intronic
1042176529 8:66042707-66042729 GGGTGCGAGGAGGGGGAGGGGGG - Intronic
1042435893 8:68764170-68764192 GGGTGTGAGGAGAGGGGACAGGG + Intronic
1043149386 8:76694673-76694695 GGGCGGGAGCAGGGGGCGGAGGG - Intronic
1043705402 8:83342441-83342463 TGGGGTGGGCAGAGGGGGGAAGG + Intergenic
1044284273 8:90393525-90393547 GGGGGTGGGGGGAGGGAGGAGGG - Intergenic
1044372814 8:91433259-91433281 GGGTGGCAAAAGAGGGAGGAGGG + Intergenic
1044619111 8:94171991-94172013 GGGAGGGAGGAGGGGGAGGAGGG - Intronic
1044971849 8:97627653-97627675 GGGTGTGAGCTGAGGAGGGCAGG - Intergenic
1045105236 8:98886047-98886069 GGGAGTGAGAAGAGGGCGAAAGG + Intronic
1045252483 8:100493459-100493481 GTGGGTGTGAAGAGGGAGGAGGG + Intergenic
1045259198 8:100557552-100557574 GGTTTTGAGCAGAGGAATGAGGG - Intronic
1045264224 8:100605280-100605302 GGTTGGGAGAAGTGGGAGGAAGG + Intronic
1045327546 8:101127799-101127821 GTGTGGGAGCAGAGGGATGGGGG + Intergenic
1045426262 8:102068579-102068601 GGGTGTGGGCAGGGGTAGGCAGG - Intronic
1045430950 8:102114674-102114696 GGGTGGGAGGAGAGTGAGGTAGG - Intronic
1045516486 8:102864428-102864450 GGGTGTGGGCCGAGAGAGGGAGG + Exonic
1045755191 8:105533959-105533981 GGGAGGGAGGAGAGGGAGGGAGG - Intronic
1046013224 8:108575251-108575273 GGTGGTGAGCAGAGGCAAGAAGG + Intergenic
1046072922 8:109280522-109280544 GATTGTGAGGAGTGGGAGGATGG + Intronic
1046131781 8:109975062-109975084 GGGTGTGAGCAGGTGGGGGAGGG + Exonic
1046223428 8:111245090-111245112 GCGTGGTAGCAGAGGGTGGATGG + Intergenic
1046380543 8:113444283-113444305 GGGTGGGAGCAGAGGAGGGGAGG - Intergenic
1046744571 8:117862988-117863010 AGGTGTTGGCAGAGGAAGGAAGG + Intronic
1047127241 8:121976076-121976098 GGGTGTGAGCCAAGGTAGGGAGG + Intergenic
1047998521 8:130358405-130358427 CGGCATGAGCAGAGGGAGGCGGG - Intronic
1048048702 8:130796939-130796961 GGGTGTTTGCAGAGGGAAGTTGG - Intronic
1048148183 8:131866004-131866026 GGGTGTGAGGAAAGAGAAGATGG - Intergenic
1048679919 8:136829881-136829903 GGGTTTTAGCAGGAGGAGGAGGG + Intergenic
1048861410 8:138726938-138726960 TGGGGTGACCAGAGGGAGGAAGG + Intronic
1048871938 8:138806392-138806414 GGGTGTGAGATGAGGGAGGGAGG + Intronic
1049212938 8:141395043-141395065 GAGCCTGAGCAGAGGGTGGAGGG + Intronic
1049215590 8:141406412-141406434 GGGTGGCAGCAGAAAGAGGACGG - Intronic
1049351653 8:142167847-142167869 GGGCAGGTGCAGAGGGAGGAAGG - Intergenic
1049609878 8:143549978-143550000 GGAGGAGAGCAGAGGGAGGTGGG - Intergenic
1051139703 9:13965129-13965151 GGGTGTGAGCATTGGGGGGGGGG - Intergenic
1051317669 9:15859606-15859628 GGGTGGGGGCAGAGGGGGAAAGG - Intronic
1051350152 9:16191414-16191436 ACTTGGGAGCAGAGGGAGGAAGG + Intergenic
1051459321 9:17294773-17294795 GGGAGTGAGGGGAGGGAGGGGGG + Intronic
1051483651 9:17585621-17585643 AGGTGGGAGCAGAGAGAGCAAGG + Intronic
1051733716 9:20175960-20175982 GGGTGTGAGCTGAGCTAGGAAGG + Intergenic
1051963290 9:22794502-22794524 GGGAGAGAGAAGAGAGAGGAAGG - Intergenic
1052463502 9:28798561-28798583 TGGTTTGAGAAGAGGGAGGAAGG + Intergenic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1053001505 9:34579294-34579316 GGGAGGGAGGAGGGGGAGGAGGG - Intronic
1053120092 9:35539813-35539835 GGGTAGGATCAAAGGGAGGAGGG - Intronic
1053291516 9:36882523-36882545 GGCTGTGTGCAGTTGGAGGAAGG - Intronic
1053476372 9:38384881-38384903 GGGTGTGATCAGTCAGAGGAAGG - Intergenic
1055398607 9:75899530-75899552 CGGGGTGAGGAGAGGGAGGAGGG - Intronic
1055408997 9:76007557-76007579 GGGTGTGAGAGGAGGGTAGATGG + Intronic
1055494252 9:76838791-76838813 GGGAGTGAGCAGTGGTGGGAAGG + Intronic
1055505453 9:76943709-76943731 AGCTGTGAGCAGAGGTAGGCAGG - Intergenic
1055707116 9:79017778-79017800 GGGTATGAGCAGTGTAAGGAGGG - Intergenic
1056239987 9:84635407-84635429 GGGTGTGCACAGAGGTAGGGTGG + Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1056544249 9:87600830-87600852 GGGTGTGAGGAGGGGGCAGAAGG + Intronic
1057067800 9:92072010-92072032 GGGAGTCAGCAGAGGGTGGTGGG - Intronic
1057193532 9:93100718-93100740 AGGTGTGGGCAGAAGGAGAAAGG - Intronic
1057369441 9:94456935-94456957 GGGTGGGAAAAGAGGGAAGAAGG - Intronic
1057528123 9:95820328-95820350 TGACGTGAGGAGAGGGAGGACGG + Intergenic
1057911556 9:99023786-99023808 GGGTGAGAGGAGGGGGAGGGAGG - Intronic
1058202478 9:102061691-102061713 GGGTGGGGGCTGGGGGAGGAGGG - Intergenic
1058804526 9:108578032-108578054 GCGTGTGAGCAGAGAGAGAAGGG - Intergenic
1058994378 9:110285372-110285394 GTGTGTGGGCAATGGGAGGAGGG + Intergenic
1059050469 9:110919231-110919253 GGGGGTGGGCAGAGGGAGAGAGG - Intronic
1059691145 9:116687313-116687335 GCGCGTGCGCAGAGGGAGGCAGG + Exonic
1059750678 9:117244597-117244619 GGGAGGGAGGAGAGGGAGGGAGG + Intronic
1060172639 9:121474457-121474479 GGGTGAGGGTAGAGTGAGGAAGG - Intergenic
1060197207 9:121631478-121631500 GGGAGAGAGCAGAGGGAGGTGGG + Intronic
1060206040 9:121683376-121683398 GGGTGGGGGCAGAGGAAGGAGGG - Intronic
1060206690 9:121686543-121686565 GGGTGTGAAGAGAGGAAGAAAGG - Intronic
1060246354 9:121949975-121949997 GAGTGTGAGTAGAGGCTGGATGG - Intronic
1060896049 9:127218309-127218331 AGGTGTGTGCAGAGGGTGGGTGG - Intronic
1060942154 9:127548984-127549006 GTGTGTAAGCAGAGGCTGGAGGG + Intronic
1061007464 9:127936306-127936328 AGGTGTGAGCAGAGTGATGATGG + Intronic
1061020272 9:128009811-128009833 GGCTGAGAGCAGAGGATGGAGGG - Intergenic
1061359378 9:130131502-130131524 GGGAGTGCGAAGAGGGAGAACGG - Intronic
1061390605 9:130315315-130315337 GGGGGAGGGCAGAGGGAGGAGGG - Intronic
1061486830 9:130924409-130924431 GGGGGTGAGCCGAGGGGGCAGGG + Intronic
1061677051 9:132223360-132223382 GGGACAGAGCCGAGGGAGGAGGG + Intronic
1061803546 9:133126165-133126187 GGGCGTGAGCTGGGGCAGGAGGG - Intronic
1062095176 9:134699433-134699455 GGGAGGAAGCAGAGAGAGGAAGG - Intronic
1062252573 9:135605677-135605699 GGCTCTGAGCAGAGGGAGCCAGG - Intergenic
1062713441 9:137989300-137989322 GGGTGTGATCAGAGAGAGTATGG + Intronic
1203358693 Un_KI270442v1:191237-191259 TGGGGTGAGGGGAGGGAGGAGGG + Intergenic
1185485846 X:481525-481547 GGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485914 X:481752-481774 GGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485956 X:481894-481916 GGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185566595 X:1099686-1099708 GGGTGTGGGCAGAGGGCAGGAGG + Intergenic
1185758892 X:2674109-2674131 ATGTGTGAGCAAAGGCAGGAAGG - Intergenic
1185775407 X:2799224-2799246 GGGTGGGAGTAGAGTGAGGATGG - Intronic
1186051759 X:5604087-5604109 GGGGGTGGGCAGAGGGAGACAGG + Intergenic
1186356854 X:8799713-8799735 GGGTGGTGGCAGAGGGGGGAGGG - Intronic
1186357180 X:8800828-8800850 GGGTGGTGGCAGAGGGTGGAGGG - Intronic
1186529699 X:10282639-10282661 GGGTCAGAGCAGAGCAAGGAAGG - Intergenic
1186544442 X:10434288-10434310 GGGTGTAGGCAGAGAAAGGAGGG - Intergenic
1186546682 X:10457277-10457299 GGGTGTGAGCCAAGGCAGGCAGG - Intronic
1186641779 X:11463243-11463265 GGGCGTGTGGAGAGGGAGGATGG + Intronic
1186659193 X:11651280-11651302 GAGGGTGAGCAGTGGGAGGAGGG - Intronic
1186688623 X:11951591-11951613 GAGGGTGAGCAGTGGGAGGAGGG + Intergenic
1186873852 X:13797982-13798004 GAGTGGGAGCATAGGAAGGATGG + Intronic
1187094002 X:16127442-16127464 GCATGGGAGGAGAGGGAGGATGG - Intronic
1187501300 X:19841206-19841228 GACAGTGAGCAGAGGGAGGTAGG - Intronic
1187834979 X:23423439-23423461 TGGTGTGGGGGGAGGGAGGAGGG - Intergenic
1188013687 X:25084702-25084724 GGGTGTTAACAGATGGAGGCAGG - Intergenic
1188344902 X:29052290-29052312 GGGTGTGAGGTGTGAGAGGAAGG - Intronic
1188553514 X:31386226-31386248 TGGGGTGAGGGGAGGGAGGAGGG + Intronic
1188615586 X:32155231-32155253 GCGTGTGAGCAGTGGGTGGGAGG - Intronic
1188875771 X:35428325-35428347 GGGTGGGAGGGTAGGGAGGATGG + Intergenic
1188915539 X:35905161-35905183 GAGAGTGAGCAGAAGCAGGATGG - Intergenic
1188955537 X:36431596-36431618 GTGTGTGGGTAGAGGGAGGGAGG + Intergenic
1189158980 X:38791134-38791156 GAATGTGAGCAGAGAGAAGATGG - Intergenic
1189178708 X:38982955-38982977 GAGAGTGAGCAAAGGAAGGAGGG + Intergenic
1189231560 X:39456018-39456040 GGGGCTGAGCAGTGGCAGGAGGG + Intergenic
1190107414 X:47570214-47570236 GGATGTGAGAAGAGGGAAGTTGG - Intronic
1190133668 X:47774269-47774291 GGGTATGGACACAGGGAGGAGGG - Intergenic
1190285768 X:48960417-48960439 GGCTGTGAGGAGAGGAAGGATGG - Intergenic
1190732364 X:53234344-53234366 GGGTGTGAGGGGAGGGTGGGGGG + Exonic
1191119660 X:56890468-56890490 GAGTGTAAGCAGAAGCAGGATGG + Intergenic
1191654150 X:63577515-63577537 TGGTGACAGCATAGGGAGGAGGG - Intergenic
1191675230 X:63785687-63785709 GGGAGTATGCAGAGGGAGGGTGG - Intergenic
1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG + Intergenic
1192133140 X:68571696-68571718 GTGTGTGAGCAGGGAGGGGATGG + Intergenic
1192172360 X:68864999-68865021 GGGGAAGAGCAGAGGGAGAAGGG + Intergenic
1192178018 X:68897896-68897918 GGATGGGAGGACAGGGAGGAAGG + Intergenic
1192213595 X:69142933-69142955 GGTTGGGAGAAGTGGGAGGAGGG - Intergenic
1192240242 X:69322754-69322776 TGGTGTGAGAATAGGCAGGAAGG + Intergenic
1192256829 X:69468544-69468566 GAGTGTGAGCAGTGGGGCGAGGG + Intergenic
1192428537 X:71097357-71097379 GGGTGGGAGGTGGGGGAGGAGGG - Intronic
1192442105 X:71182308-71182330 GGGAGCGAGGAGAGAGAGGACGG - Intergenic
1192555218 X:72083915-72083937 GTGTGTGGGCAGGGGGAGTAAGG - Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1194975922 X:100396031-100396053 GTGTGTGAGAGGTGGGAGGATGG - Intronic
1195036554 X:100975379-100975401 GAGTGGGAGCTGAGGAAGGAGGG - Intronic
1195334004 X:103831967-103831989 GCCTGTGAGAAGAGGGAGAAAGG - Intronic
1195534768 X:105998773-105998795 GGGTGGGAGGAGGCGGAGGATGG + Intergenic
1195599253 X:106727097-106727119 GTGTGGGAGCTGAGCGAGGAGGG + Exonic
1195679288 X:107531719-107531741 GTGTGGTAGCAGAGGGTGGAGGG - Intronic
1195688159 X:107603618-107603640 TGCTGTGAGCAGAGTGAAGAGGG - Exonic
1196015149 X:110931332-110931354 GGGTGGGAGAAGGGTGAGGATGG + Intergenic
1196834451 X:119801727-119801749 GGGAGAGAGAAGAGGGAGGGAGG - Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197278578 X:124508830-124508852 GGGTCTGCCCAGAGAGAGGAGGG - Intronic
1197456165 X:126678086-126678108 GGGTGGGAGTAGTGGGAGGGAGG + Intergenic
1197567731 X:128108931-128108953 GGGTGTGTGGAGTGGGAGGTGGG - Intergenic
1198068430 X:133123348-133123370 GGGTGGGAGGAAAGTGAGGATGG - Intergenic
1198084455 X:133269111-133269133 GGCTGGGAGCAGGAGGAGGAGGG - Intergenic
1198321368 X:135521435-135521457 GGGGGTGCGCAGAGGGCGGGCGG + Intronic
1198662237 X:138982149-138982171 AGGTGTGACCAGAGAGAGGTTGG + Intronic
1198801010 X:140447762-140447784 GGGTGTGAGGTGGGGGATGAGGG - Intergenic
1199547679 X:149023933-149023955 GGGTGGGAGGACAGTGAGGATGG + Intergenic
1199765881 X:150941484-150941506 AGGTGGGAGCAGACAGAGGAGGG + Intergenic
1199783310 X:151082624-151082646 GGGCGTCAGGAGAGGGAGGTGGG + Intergenic
1200155003 X:153970553-153970575 GGGAGGGAGCAGATGGAGGGAGG + Intronic
1200400214 X:156015517-156015539 GGGTGTGAGGACTGTGAGGACGG - Intergenic
1201254590 Y:12094210-12094232 TGGTGTGGGGAGAGGGGGGAGGG + Intergenic
1201294509 Y:12452175-12452197 GGGTGGGAGGAGAGTGGGGATGG + Intergenic
1201394150 Y:13529893-13529915 TGGTGTGGGCGGAGGGGGGAGGG + Intergenic
1201461738 Y:14233022-14233044 GGGGGAGGGGAGAGGGAGGAGGG - Intergenic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic