ID: 1023878820

View in Genome Browser
Species Human (GRCh38)
Location 7:44307236-44307258
Sequence GGGTGTGAGCAGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1143
Summary {0: 2, 1: 2, 2: 10, 3: 120, 4: 1009}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023878820 Original CRISPR GGGTGTGAGCAGAGGGAAGA GGG Intronic
900132407 1:1092640-1092662 GGCTGTGAGCAGCAGGGAGACGG + Intronic
900337092 1:2169685-2169707 GGGTGCGCACAGAGGGATGACGG + Intronic
900337111 1:2169738-2169760 GGGTGTGCGCAGAGGGGAGGTGG + Intronic
900354476 1:2253676-2253698 CGGTGCGAGCAGATGGAGGATGG + Intronic
900471688 1:2858138-2858160 GGGTGTGAGCAAAGGGAGCCTGG - Intergenic
900505526 1:3028342-3028364 GGGTGTGAGCACAGGGCTGGGGG - Intergenic
900546257 1:3230896-3230918 AGGTGTGAGCAAAGGGAGCAGGG + Intronic
900579440 1:3401290-3401312 GGATGGGGGCAGATGGAAGAGGG - Intronic
900623508 1:3597957-3597979 GCATGTGAGCAGCGGGAGGATGG + Intronic
900641783 1:3691065-3691087 TGGGGTGAGCAGAGGTAGGAAGG + Intronic
900769324 1:4528318-4528340 GGGGGTGAACAGTGGGAAGCGGG + Intergenic
900836075 1:5005158-5005180 GTGAGTGAGGAGTGGGAAGAAGG - Intergenic
901010978 1:6201957-6201979 GGGTGTGGGGTGAGGGATGAGGG - Intronic
901216197 1:7556707-7556729 GGGTGTGAGCAGAGGAGGGGAGG - Intronic
901226189 1:7614067-7614089 GGGTGGGAGGAGAGGGATGGTGG + Intronic
901241301 1:7695297-7695319 AGCTCTGAGCAGAGAGAAGAGGG + Intronic
901725466 1:11238508-11238530 GGGTGTGAGCAGGCGGGAGCAGG + Exonic
902092620 1:13915610-13915632 GGGTGGGAGCAGAGGGCAACTGG - Intergenic
902112046 1:14089073-14089095 GTGTGGGTGCAGAGGGAATATGG - Intergenic
902450125 1:16491419-16491441 GGGAGGGAGGAGAGAGAAGAGGG + Intergenic
902482163 1:16717744-16717766 GGGTGAGTGCTGAGGGAGGAAGG - Intergenic
902667028 1:17946680-17946702 TGGTTGGAGCAGAGGGAAGGAGG + Intergenic
903330042 1:22592659-22592681 CGGGGTGAGCAGAGGGGAGGAGG + Intronic
903406336 1:23099927-23099949 GTGAGGGACCAGAGGGAAGAGGG - Intronic
903834598 1:26195179-26195201 TGGTGGGAGAAGAGGGATGAGGG - Intronic
904277418 1:29393506-29393528 GGGTGGGAGGAGAAGGAGGAAGG + Intergenic
904306559 1:29593905-29593927 GTGTGTGGGAAGGGGGAAGAGGG + Intergenic
904429087 1:30450407-30450429 GGGTTTGAGCAGGGGAATGATGG + Intergenic
904450065 1:30605331-30605353 TGGGGTGAGCGGAGGGCAGAGGG + Intergenic
904601087 1:31672945-31672967 GAGTGTGGGAGGAGGGAAGACGG - Intronic
904621402 1:31777460-31777482 GGGTGGATGCAGAGGTAAGAAGG - Intergenic
905240213 1:36576376-36576398 GGGGGTGGGGTGAGGGAAGAAGG + Intergenic
905607030 1:39310427-39310449 TGGTGTGTGCACTGGGAAGAGGG + Exonic
905650154 1:39650900-39650922 GGATGTGAGATGAAGGAAGAAGG - Intergenic
905673290 1:39807606-39807628 GGGAGAGGGCAGAGGGGAGAGGG - Intergenic
905961918 1:42050143-42050165 GGATGGGAGTAGAGGGAAGCTGG + Intergenic
906095030 1:43217104-43217126 GAGTGTGTGCAGAGGGATGAGGG + Intronic
906689684 1:47784414-47784436 GGGGCTGGGCAGAGGGAGGAGGG + Intronic
906868263 1:49447078-49447100 GGGTGTGTGCAGTGGGAAGAGGG + Intronic
907186377 1:52612511-52612533 GGGTGTCAGCAGGGTGTAGATGG - Intergenic
907303704 1:53502727-53502749 GGGAGAGAGGAGAGGGAAGGGGG + Intergenic
907303712 1:53502752-53502774 GGGAGAGAGGAGAGGGGAGAGGG + Intergenic
907471942 1:54679804-54679826 AGGTGGGAGGAGAGGGAAGGGGG - Intronic
907485491 1:54775054-54775076 GGGTGAGGGCAGAGGGAATGTGG + Intergenic
907866269 1:58402309-58402331 GGGTGTTGGGAGAGGGGAGAAGG - Intronic
908474068 1:64471076-64471098 GGGTCTGTGCAGAGGACAGAGGG - Intronic
909790244 1:79668253-79668275 GTGGGTGTGCATAGGGAAGAAGG - Intergenic
910356720 1:86365875-86365897 GTGTGTGAGCAGGGGGTGGAGGG - Intronic
910563399 1:88617328-88617350 GGGGCTGAGGAGAGGGGAGATGG + Intergenic
911154361 1:94624051-94624073 AGGAGAGAGCAGAGGGAAGAAGG + Intergenic
911301784 1:96183488-96183510 GGGGGAGGGCAGGGGGAAGAAGG + Intergenic
912078857 1:105911275-105911297 GGGTGTGAGGAGAAAGAAAATGG - Intergenic
912438596 1:109680575-109680597 GTGGGTGAGCAGTGGGAAGGGGG + Intronic
912441117 1:109699020-109699042 GTGGGTGAGCAGTGGGAAGGGGG + Intronic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
912566754 1:110592903-110592925 GAGTATGAGCACAGGGAAGTCGG - Intergenic
912647838 1:111411736-111411758 GGGTGGGAGAAGTGGGAGGAGGG + Intergenic
912747837 1:112260317-112260339 GGGTGTGAGAAGAGAGAAACTGG + Intergenic
912952020 1:114126804-114126826 GGCTGCGAGCAGAGGGAGGGAGG + Intronic
912967834 1:114251713-114251735 GGGTAGGAGCAGAGTGATGAGGG - Intergenic
913057465 1:115175614-115175636 GGGTGAGATGAAAGGGAAGAAGG + Intergenic
913106065 1:115615152-115615174 TGGAGTGAGCAGAGAGAGGATGG - Intergenic
913130505 1:115834348-115834370 GGCTGTGGGCAAAGAGAAGAAGG + Intergenic
913387697 1:118277772-118277794 GGGTTAGAGCAGAGGGAAGAAGG + Intergenic
914226334 1:145721941-145721963 GGCTGTGAGGAGAGGGACAAAGG + Intronic
914684677 1:149967859-149967881 TGGTGGGAGGAGAGGGAATAAGG + Intronic
915040683 1:152965946-152965968 GGGAGGGAGCTGAGGGAGGAGGG - Intergenic
915091376 1:153428659-153428681 ATGTGTGGGCAGAGGGAGGAGGG + Intergenic
915103149 1:153515128-153515150 AGGTGGGTGCAGAGGGAAGGAGG - Intergenic
915300857 1:154950901-154950923 GGGCCTGGGCAGAGGGAAGATGG - Intronic
915657654 1:157375067-157375089 GGGAATGTGCAGAGGGAAGGAGG - Intergenic
915816942 1:158977499-158977521 GAATGTGAGAAGAGGGAATATGG - Intergenic
915837346 1:159188311-159188333 GGGCGAGAGGAGAGGGGAGAGGG - Intronic
916011236 1:160707798-160707820 GGGAGGGAGCAAAGGAAAGAAGG - Intronic
916452401 1:164933668-164933690 GGGGGTGAGCAGAGCCAAAACGG - Intergenic
916715133 1:167441481-167441503 GGGTGTGTGTAGTGGGAGGAGGG - Intronic
916720441 1:167481461-167481483 AGTTGGGAGCAGAGGGAGGATGG + Intronic
916881405 1:169022767-169022789 TGGTGTGAGCAAAGCAAAGAGGG - Intergenic
917017003 1:170543424-170543446 GGGCAGGAGAAGAGGGAAGAAGG + Intronic
917530592 1:175831490-175831512 GAGAGTGGGCTGAGGGAAGATGG + Intergenic
917688942 1:177447865-177447887 GGGAGTTTTCAGAGGGAAGAAGG - Intergenic
917994125 1:180417281-180417303 GTGTTTGAGCAGAGGGAATGTGG - Intronic
918624730 1:186644356-186644378 GGGTGTGGGCAGTGGGTAGATGG + Intergenic
919630364 1:199954871-199954893 GCTGGAGAGCAGAGGGAAGAGGG - Intergenic
919814922 1:201431250-201431272 GGGCGTGAGAGCAGGGAAGAAGG - Intergenic
919873374 1:201841893-201841915 GTGTGAGAGCAGAGGAAAAATGG - Intronic
920180518 1:204129455-204129477 GTGTCTCAGCAGAGGGAATAAGG - Intergenic
920430727 1:205917236-205917258 GGGTGGGAGCAGGGCGAAGAGGG - Intronic
921218754 1:212958463-212958485 GGGTGGGAGCAGACGGCAGGTGG - Intronic
921334778 1:214075341-214075363 GGGGATGAGCAGAGGAAAGGTGG - Intergenic
921455822 1:215370337-215370359 GGGTGTGAGCAGGGGGGGAAGGG - Intergenic
921813875 1:219544979-219545001 GGGAGAGAGGAGAGGGGAGAGGG - Intergenic
922317543 1:224456196-224456218 TGGTGTGAGGAGAGGGGAGCAGG - Intronic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
923341415 1:233010250-233010272 GGGTGGGAGGAGTGGGTAGATGG + Intronic
923482378 1:234397318-234397340 GAGTGGGAGGAGAGGGAGGAGGG + Intronic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
1062805114 10:413682-413704 GGGGGTGGGCAAAGGGCAGAGGG + Intronic
1062805130 10:413778-413800 GGGCGTGGGCAAAGGGCAGAGGG + Intronic
1062979347 10:1708886-1708908 GTATGTGAGCAGAGGGCTGAGGG + Intronic
1063004167 10:1952603-1952625 GGGTGTCAGCACAGAGCAGAGGG - Intergenic
1063004211 10:1952817-1952839 GGGCGTGTTCAGAGGAAAGAAGG + Intergenic
1063077461 10:2731200-2731222 GGGTGTGTGCATTGGGAAGGAGG + Intergenic
1063298826 10:4833506-4833528 GGGTGTGAGCACGGGGAGGAAGG - Intronic
1064011182 10:11737788-11737810 GTGGGTGAGCAGAGGGAGGGAGG - Intergenic
1064068237 10:12202364-12202386 GTGTGAGAGCAGAGGAAAAACGG - Intronic
1064280682 10:13948587-13948609 GGGTCTGAGCAGAGAGCAGGTGG + Intronic
1064322867 10:14321957-14321979 TGGTGGGAGCAGGAGGAAGAGGG - Intronic
1064469605 10:15622276-15622298 GAGAGTGAGAAGTGGGAAGAAGG - Intronic
1064502481 10:15989251-15989273 AGGTGTGGGAAGAGAGAAGAGGG + Intergenic
1064583300 10:16815479-16815501 GGATGTGACAAGAGAGAAGAAGG - Intronic
1064806572 10:19141370-19141392 GGGTTTGAGGGGAGGGGAGATGG + Intronic
1064961501 10:20970167-20970189 TTGTGTGAGCAGAGCGAGGATGG + Intronic
1064996369 10:21299986-21300008 GGGAGTGAGGAGATGGAAAAGGG + Intergenic
1065125095 10:22566460-22566482 GAGTGTGCGTAGAGGGAAGGGGG - Intronic
1065825728 10:29568870-29568892 GGGAGGGAGCAGAGGAAGGAAGG + Intronic
1066055952 10:31680203-31680225 GTGTATGACCAGAGGGAAGAGGG + Intergenic
1067168719 10:43886166-43886188 GAGTGTGGGCAGAGGGCAGGTGG + Intergenic
1067303662 10:45037701-45037723 GGGGCTTACCAGAGGGAAGAGGG + Intergenic
1067657797 10:48210478-48210500 GGGTCTGGGCAGAGGCCAGAAGG + Intronic
1067717262 10:48699134-48699156 GGAGGTGAGGAGAGGGAAGTGGG + Intronic
1067794083 10:49308131-49308153 GGATGTGAGCAGGGGGTAGCAGG - Intronic
1067911935 10:50355274-50355296 GGGAGAGGGAAGAGGGAAGAGGG - Intronic
1068637135 10:59360351-59360373 GGGTGTGAGTAGAAGGATGTAGG + Intronic
1068753605 10:60624957-60624979 GTGTGTGTGCACAGGGAAGAAGG - Intronic
1068955666 10:62817346-62817368 GGGTGTGTGAAGAGGGCAGCGGG - Intronic
1069292577 10:66799567-66799589 TGTGGTGAGGAGAGGGAAGAAGG + Intronic
1069646352 10:70001342-70001364 GAGTGGGAGCTGAGGGAAGGGGG - Intergenic
1069932133 10:71890029-71890051 GGAGGGGAGCAGAGGGCAGAGGG - Intergenic
1070159652 10:73858531-73858553 GAGGGTGGGCAGAGGGAAGGGGG - Intronic
1070566940 10:77610719-77610741 GACTGGGAGCAGAGGGAATAGGG + Intronic
1070895653 10:79981670-79981692 GGCTGTGGGAAGAGGGAAGGTGG + Intronic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1071531297 10:86391991-86392013 GAGAGGGAGCAGAGGGAAGCAGG + Intergenic
1071567484 10:86679324-86679346 GGGGGTGAGCATAAGGAAGGTGG - Intronic
1072167875 10:92831207-92831229 GGGTGGGAGTAGAGGGAGGGTGG + Intergenic
1072637328 10:97186216-97186238 GGATGGGAGAAGAGGGAAGGGGG + Intronic
1072731712 10:97850653-97850675 GTGTGTGAGGGGAGGGAAGGCGG + Intronic
1073284832 10:102381349-102381371 GTCTGTGAGCCGAGGGAAGAAGG + Intronic
1073309281 10:102528164-102528186 GGTTGGGAGTAGATGGAAGAAGG + Intronic
1073453566 10:103623360-103623382 GGGTCTGAGCAGAGGGTGCAGGG - Intronic
1073563860 10:104519085-104519107 TGGAAGGAGCAGAGGGAAGAGGG - Intergenic
1073605919 10:104895544-104895566 GAGTGTGAGCTGAGGGATGCTGG - Intronic
1073676651 10:105654952-105654974 TGGTGGGAGCAGAAGCAAGAGGG - Intergenic
1074059288 10:109950283-109950305 GGGTGTGAGAAGTAGGAGGAGGG + Intronic
1074763914 10:116686784-116686806 TGGTGTGGGAAGAGGGATGAGGG - Intronic
1074763934 10:116686847-116686869 TGGTGTGGGAAGAGGGATGAGGG - Intronic
1075380939 10:122018107-122018129 GGGGGTGAGAAGCGGGAAGTTGG - Intronic
1075805681 10:125187243-125187265 GGGTGGGGGCAGAGGGAAAGAGG - Intergenic
1075984279 10:126770189-126770211 AGATGTGGGGAGAGGGAAGATGG - Intergenic
1076120941 10:127935938-127935960 AGGTGAGAGCAGAGGGAAGAAGG - Intronic
1076347980 10:129793800-129793822 GGGAGAGGGGAGAGGGAAGAGGG - Intergenic
1076411107 10:130251624-130251646 GGGGGTGAGGAGAGAGAGGAAGG - Intergenic
1076640024 10:131909087-131909109 GGGTATAAGAAGAGGGAGGAAGG + Intronic
1076827838 10:132978733-132978755 GGGAGTGAGCAGAGGCACCAGGG + Intergenic
1076937321 10:133575094-133575116 GTCTGTGAGCACAGGGAAGGAGG + Intergenic
1077371830 11:2185944-2185966 GGGTGGGGGCATAGGGAAGGCGG + Intergenic
1077378005 11:2214678-2214700 GGGTTGGAGCACAGGGGAGAGGG - Intergenic
1077423348 11:2463086-2463108 GGGTGTGGGGAGTGGGAAGTGGG + Intronic
1077809964 11:5627065-5627087 AGATGAGAGCAGAGTGAAGAAGG + Intronic
1078421874 11:11219319-11219341 GGGTGAGAGGAGAGAGGAGACGG - Intergenic
1078604306 11:12761638-12761660 GAGGGTGGGCAGAGGGATGATGG + Intronic
1079117005 11:17646279-17646301 GGGTGAGAGCTGTGGGAAGATGG + Intronic
1079388392 11:20000489-20000511 GGGTGTGAGGAGAGTAAAGCAGG + Intronic
1080384967 11:31805670-31805692 GGGTCTGGGCAGAGGAAAGCAGG + Intronic
1080883546 11:36345091-36345113 GGGTGAGAGCAGCGGCAGGAAGG + Intronic
1081507629 11:43734628-43734650 GGGTGGGGGCAGAAGGAAGGCGG - Intronic
1081589300 11:44409765-44409787 GGGTGTGAGTTGAAGGCAGAGGG + Intergenic
1081771406 11:45652361-45652383 TGGTGTGAGCAGAGGGACTGCGG - Intronic
1081869957 11:46378924-46378946 GCGTGTGAGCTCAGGGAAGGAGG + Intronic
1081975206 11:47229429-47229451 GGGAGTGGAGAGAGGGAAGAGGG + Intronic
1082054379 11:47801072-47801094 TGGAGTGACCAGAGGAAAGAGGG + Intronic
1082806845 11:57457239-57457261 GGGTATGCCCAGAGGGAAGGGGG + Intergenic
1083250543 11:61464008-61464030 AGGAGAGAGGAGAGGGAAGAGGG - Intronic
1083275055 11:61592188-61592210 GGGCTGGAGCAGAGGGAGGATGG + Intergenic
1083332865 11:61907101-61907123 GGCTGGGAGGAGAGGGAAGAAGG + Intronic
1083397662 11:62402446-62402468 CGCTGTGGGCAGAGGGAAGAGGG - Intergenic
1083427755 11:62597582-62597604 GGGTGGGTGGATAGGGAAGATGG - Intronic
1083610687 11:64002837-64002859 TGGGGTGGGAAGAGGGAAGAGGG - Intronic
1083614107 11:64018058-64018080 GGGGGTGAGCTGGGGGCAGAGGG + Intronic
1083627523 11:64079181-64079203 GTGTGTGGGATGAGGGAAGAGGG + Intronic
1083692090 11:64415515-64415537 GGGTCTGAGGAGAGGGGAGGAGG + Intergenic
1084075333 11:66770775-66770797 GGGTGTCAGGAAAGAGAAGAGGG - Intronic
1084175380 11:67419994-67420016 GGGTTGCAGGAGAGGGAAGACGG - Intronic
1084343538 11:68526565-68526587 GTGTGTGAATAGAGGTAAGATGG - Intronic
1084581881 11:70029268-70029290 GCCTGTGTGCAGAGGGAAGAGGG - Intergenic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1085026431 11:73239276-73239298 GGGTGTGGGAGGAGGGAAGCAGG + Intergenic
1085296359 11:75433932-75433954 GGGTGTGACCTGAGGGAAAAGGG - Intergenic
1085392672 11:76190404-76190426 GGGGGTCGGCAGAGGGAAGATGG - Intronic
1085523896 11:77153448-77153470 GGCTGTGGGCAGAGTGGAGAAGG + Intronic
1085758759 11:79223819-79223841 TGGTGGGAGCAGTGGGAAAAAGG - Intronic
1086134078 11:83429563-83429585 GGGTGAGATCAGAGAGGAGAAGG + Intergenic
1086142256 11:83512207-83512229 GGGGGAGAGAAGAGGGCAGAAGG - Intronic
1086203132 11:84227328-84227350 CTGTGTGATCAGAGGGAATAAGG + Intronic
1086485243 11:87293494-87293516 GGGAGTGAGGGGAGGGAAGTTGG - Intronic
1086910107 11:92462304-92462326 GGGTGGGAGGAGAGTGAGGATGG - Intronic
1087272397 11:96124756-96124778 GGGCATGAGAGGAGGGAAGAAGG + Intronic
1087930011 11:103966190-103966212 GGGTGGAGGAAGAGGGAAGAAGG + Intronic
1088732258 11:112693901-112693923 GGGTGTGAGCAGAAGGCGGTAGG - Intergenic
1088822880 11:113471468-113471490 GGAGGTGAGAAGAGGGAAAATGG + Intronic
1089054348 11:115573074-115573096 ACGTGTGAACAGAGGGAAAACGG + Intergenic
1089190143 11:116647833-116647855 TAGTGTGTGCAGAGGGAAAACGG + Intergenic
1089342968 11:117772123-117772145 GGGTGTCAACAGAGAGAGGAGGG + Intronic
1089785565 11:120904630-120904652 GGTTGTGAGCAGGGGCGAGATGG - Intronic
1089982073 11:122780756-122780778 TGGTGTGAGCAGAGGACAGTGGG + Intronic
1090105779 11:123852500-123852522 TGGTGAGAGCAGAAGCAAGATGG - Intergenic
1090353283 11:126121550-126121572 GGGAGTGTGCAGAGGGAGGAGGG + Intergenic
1090356907 11:126146560-126146582 AGGTCTGTGCAGAGGGATGAGGG - Intergenic
1090456673 11:126855998-126856020 GGCTGCAGGCAGAGGGAAGATGG - Intronic
1090589009 11:128245373-128245395 GCGTGTGAGCAGAGGAAGTATGG - Intergenic
1090662407 11:128891374-128891396 GGGAGAGAGGAGAGGGAGGAGGG + Exonic
1090717051 11:129440109-129440131 GGGTGAGAGCTGTGGGAGGAGGG - Intronic
1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG + Intergenic
1090986898 11:131775551-131775573 TGGTGTCAACAGAGGGAAGAGGG - Intronic
1091363751 11:134999953-134999975 GGGGGAGAGCAGAGGAAATAGGG + Intergenic
1091389177 12:115340-115362 GGGTTGGAACAGAAGGAAGATGG + Intronic
1091446382 12:546196-546218 GGGTGTGAGAGGAGGGAGGGGGG + Intronic
1091672433 12:2462051-2462073 GGGGGTGAGCTTAGGGAGGAAGG - Intronic
1092118623 12:6027517-6027539 GGGTCTGATCAGAGGGAGGCAGG + Intronic
1092883225 12:12904028-12904050 GGGAGAGATCAAAGGGAAGAGGG + Intronic
1092905288 12:13095706-13095728 GGGTAGGAGGAGAGGGAGGAGGG - Intronic
1093927162 12:24920539-24920561 GTGTGAGAGCAGAGGAAAAATGG - Intronic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1093958826 12:25251052-25251074 CGGTGTGGGAAGAGGGAAGAGGG + Intergenic
1095279075 12:40328135-40328157 GGGTATGTGTAGAGGGAAGACGG + Intronic
1095380183 12:41581632-41581654 GGGAGAGAGCAGATGGAGGAAGG + Intergenic
1095702003 12:45200354-45200376 AGGAGTGAGCACATGGAAGAAGG - Intergenic
1095726635 12:45460958-45460980 GGATTAGAGAAGAGGGAAGATGG + Intergenic
1095790982 12:46166807-46166829 GGGTTTAAGAAGAGAGAAGAAGG + Intergenic
1096309225 12:50505379-50505401 GGGTGGGAGAGGAGGGAAAACGG - Intronic
1096523179 12:52195442-52195464 GGGTGGGGGCAGAGGGAACAGGG + Intergenic
1096600102 12:52723065-52723087 AGGTCTGAGCAAAGGGGAGAAGG - Intergenic
1096661787 12:53129902-53129924 TGGTAGGAGGAGAGGGAAGAGGG - Intergenic
1096673743 12:53215213-53215235 GGGAGTGGCCAGAGGAAAGAGGG + Intronic
1097053373 12:56236754-56236776 GGGTGGGAACGGAGGGAAGCAGG + Intronic
1097279445 12:57835558-57835580 GGGTGTCCGCAGAGGGTAGCAGG - Intronic
1097324483 12:58260333-58260355 TGGTGTGAGAAGAGGGCAAAGGG - Intergenic
1097751579 12:63360253-63360275 GGAGATTAGCAGAGGGAAGATGG - Intergenic
1098190078 12:67938623-67938645 GGGTGAGAGTAGAGAGAAGGGGG + Intergenic
1098398011 12:70042712-70042734 GGGTTTGAGGAGAGAGGAGAAGG + Intergenic
1098454184 12:70653447-70653469 GGGTGTGGTAAGAGGGAAGCAGG + Intronic
1098720500 12:73891794-73891816 GGGTGTAAGCAGATGTAGGAGGG - Intergenic
1098834388 12:75403745-75403767 TGGTGTGAACAGAAGGATGAAGG - Intronic
1099580240 12:84436773-84436795 GGGTTTGAGCATAGGGCATAGGG - Intergenic
1100172136 12:91986990-91987012 GGGTGGGAGAAGGTGGAAGAGGG - Intronic
1100370646 12:93966135-93966157 GGGTGTGATCAGAATGACGAAGG - Intergenic
1100748133 12:97667916-97667938 TGGTGAGCGCAGAGCGAAGAGGG + Intergenic
1101542388 12:105676878-105676900 GGGTGTTACCAAAGGGAACAGGG + Intergenic
1101556953 12:105819013-105819035 GGGTGTGTGTGGAAGGAAGATGG + Intergenic
1101584433 12:106072665-106072687 GGGAGGGAGAAGAGGGAGGAAGG - Intronic
1101737391 12:107473284-107473306 GGTAGTGACCAGAGGGAGGATGG - Intronic
1101997651 12:109536369-109536391 GACTGTCAGCACAGGGAAGATGG + Exonic
1102177453 12:110886635-110886657 GGGTGGGAGGAGAGGGAGGTTGG - Intronic
1102459106 12:113089323-113089345 GAGTGAGAGCAGAGGACAGATGG + Intronic
1102531733 12:113551666-113551688 GGGTGGGCACAGAAGGAAGAAGG - Intergenic
1102546978 12:113664381-113664403 AGGTCTGAGCAGAAGAAAGAAGG + Intergenic
1102720231 12:115009526-115009548 GGGTTTGAGCAGATGGATGGTGG + Intergenic
1102902249 12:116647443-116647465 GGAGGGGAGGAGAGGGAAGAAGG - Intergenic
1102964842 12:117118144-117118166 GGGTGGGGGGTGAGGGAAGAAGG - Intergenic
1103723436 12:122986594-122986616 GGGTGGGGGCAGAGGGACCATGG - Intronic
1103832405 12:123790301-123790323 GGGTGTGAGGACAAAGAAGATGG - Intronic
1104729849 12:131098679-131098701 AGGTGACTGCAGAGGGAAGAGGG - Intronic
1104850826 12:131872739-131872761 GGACGTGAGGAGGGGGAAGAAGG - Intergenic
1104864481 12:131944732-131944754 GGGTTGGGGCAGAGGGCAGAAGG + Exonic
1105213615 13:18272159-18272181 AGGTGTGACAACAGGGAAGAGGG + Intergenic
1105284227 13:18991698-18991720 GGGTTTGAGCAGAGGGAGGTGGG - Intergenic
1105638125 13:22235919-22235941 TGGTTTGAGACGAGGGAAGAGGG - Intergenic
1106384962 13:29275496-29275518 GGGTGGGAGCAGAGGGAGTAGGG - Intronic
1106628380 13:31443702-31443724 GGGTGTGAGAAGAGTGAAATGGG + Intergenic
1106896393 13:34307333-34307355 GGCTGTGAGGAAAGGGAAGGTGG + Intergenic
1106906866 13:34418782-34418804 GGGGGTGCGCAGTGGGTAGAAGG - Intergenic
1107015476 13:35705310-35705332 GGGCATGAGTAGAGGGAGGAAGG + Intergenic
1107614416 13:42149613-42149635 GGTTGTGAGCAAAGTGCAGAAGG - Intronic
1107999562 13:45893898-45893920 GGGTGTGAGCAGTGGGAGCTTGG - Intergenic
1108426482 13:50306927-50306949 GGGGATTAGCAGAGGGAGGAAGG - Intronic
1108447802 13:50526854-50526876 GGGAGAGGGGAGAGGGAAGAGGG + Intronic
1108606006 13:52039255-52039277 GGGAGTGAGCTGAGGGATGAGGG + Intronic
1109239558 13:59868722-59868744 GGTTCTGAGGAGAGGGAAGAAGG - Intronic
1110267875 13:73558887-73558909 TGGTGTGTGCTGAGGAAAGAGGG - Intergenic
1110504229 13:76266484-76266506 AGGTATTAGCAGAGGCAAGAAGG - Intergenic
1110641517 13:77830182-77830204 GGGAGGGAGGGGAGGGAAGAAGG - Intergenic
1110641536 13:77830223-77830245 GGGAGGGAGGGGAGGGAAGAAGG - Intergenic
1110694493 13:78472323-78472345 AGATGTCAGCAGAGGAAAGAGGG - Intergenic
1112292500 13:98157304-98157326 GGGACTGATCAGGGGGAAGAGGG - Intronic
1113547625 13:111166372-111166394 GTGTTTGGGCAGAGGGGAGAAGG + Intronic
1113577696 13:111405594-111405616 GGGTGTGAGCAGAGGTTGGGGGG + Intergenic
1113794252 13:113047801-113047823 AGGTGTGAGCAGAGGGGACGGGG - Intronic
1113794259 13:113047835-113047857 AGGCGTGAGCAGAGGGGACAGGG - Intronic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1114464370 14:22910526-22910548 GGATGGGAGGAGAGGGCAGAGGG + Intronic
1114558678 14:23576633-23576655 GTGGGAGAGCAGAGTGAAGACGG + Intronic
1115539954 14:34411258-34411280 GGGAGAGGGGAGAGGGAAGAGGG - Intronic
1115697764 14:35919055-35919077 GGGAGAGAGAAGGGGGAAGAAGG + Intronic
1115952090 14:38732808-38732830 GTGGTTGAGCAGAGGGAAAAAGG + Intergenic
1117288526 14:54310305-54310327 GGGCATGAGCACAGAGAAGAGGG - Intergenic
1117330547 14:54707702-54707724 GGGTGTGAGCAGAGAGTTGAAGG + Intronic
1117411109 14:55451975-55451997 GGGGTTGAGCAGGTGGAAGATGG - Intronic
1118153058 14:63210469-63210491 GGGTAGGAGCAGTGGGATGAAGG + Intronic
1118333528 14:64832754-64832776 TGGTGTGATGAGAGGGAAGAAGG - Intronic
1118592072 14:67409584-67409606 GGGAGTGGGGAGAGGGAAGTGGG - Intronic
1118891875 14:69916762-69916784 GGGTGTAAGGAGGGTGAAGATGG - Intronic
1119217035 14:72876926-72876948 GGGAGTGGGGAGAGGGAAGGAGG - Intronic
1119406504 14:74402651-74402673 GGGGGTGGGCAGATGGCAGAGGG - Intergenic
1119507150 14:75182772-75182794 GGGTGGGGGAAGAGGGGAGAAGG - Intergenic
1119557789 14:75566908-75566930 GGGGCTGAGCAGAGGGAAGGAGG + Intergenic
1119734188 14:76970988-76971010 GGGCGTGAGCTGAGGGAACAGGG - Intergenic
1120312626 14:82850235-82850257 TGGGGTGAGTAGAGGAAAGAGGG + Intergenic
1120414274 14:84199621-84199643 GGCTGTGAACATAGAGAAGAGGG - Intergenic
1120540323 14:85742791-85742813 GAGTGTGAGAAGAGAGAAAATGG - Intergenic
1121069316 14:91002801-91002823 GGCTGAGAGAAGAGGGAAGAGGG - Intronic
1121092412 14:91191773-91191795 GGGTGTGAGGAGAAGGATCAGGG + Intronic
1121241892 14:92436877-92436899 GGGTGTGGGTAAAGGGGAGAAGG - Intronic
1121252791 14:92512595-92512617 GGGTGTGAGGAGAGAGCAGCAGG + Intergenic
1121321695 14:92995266-92995288 GTGGGTGAGCAGAGGGCAGGGGG - Intronic
1121489091 14:94345049-94345071 GGGGCTGGGGAGAGGGAAGATGG + Intergenic
1121529084 14:94640119-94640141 TGGTTGGAGCAGAGGGAAGGAGG + Intergenic
1121539170 14:94712212-94712234 GGGTGAGTGCAGAGAGAGGAAGG - Intergenic
1122144775 14:99683073-99683095 GGGTGTGGGCTGAGGGGCGACGG - Intergenic
1122238033 14:100344063-100344085 GGGAGAGGGAAGAGGGAAGAGGG - Intronic
1122519517 14:102333686-102333708 GGGAGTCTGTAGAGGGAAGAAGG - Intronic
1122809565 14:104281340-104281362 GGCTGTGAGCAGGGGGAGGGCGG - Intergenic
1122857160 14:104565471-104565493 GCGTGTGAGCTGCGGGAAGCAGG + Intronic
1122861985 14:104586826-104586848 GGGTGTTGGAGGAGGGAAGAGGG + Intronic
1122941796 14:104984815-104984837 GGGTGAGGGCAGATGGCAGAAGG + Intergenic
1123039130 14:105483246-105483268 AGGTGTGGAAAGAGGGAAGAAGG - Intergenic
1124439183 15:29674755-29674777 GGGAGGGAGGAGAGGGAGGAGGG + Intergenic
1124475457 15:30029398-30029420 GGGAAGGAGGAGAGGGAAGATGG - Intergenic
1124789982 15:32718189-32718211 GTGAGTGGGCGGAGGGAAGAGGG + Intronic
1124794749 15:32766729-32766751 GGGTGTGAGAGGATGGAGGAGGG + Exonic
1124918454 15:33999543-33999565 GGGTCTGAACAGTGAGAAGAAGG - Intronic
1125680758 15:41528811-41528833 TTTTGTGAGCAGAGGGAAGCTGG + Intronic
1125909164 15:43420922-43420944 GGGTGTCAGGAGGGAGAAGAGGG - Intronic
1126437254 15:48648047-48648069 GGATCTGAGCAGAGGGACCATGG + Intergenic
1126524019 15:49630185-49630207 TGGTGAGAGGAGAAGGAAGAAGG + Intronic
1126697668 15:51340026-51340048 TGGTGGGAGCAGGAGGAAGAGGG + Intergenic
1126759947 15:51960888-51960910 GAGTGTGGGGAGAGGGAAGGGGG + Intronic
1127088944 15:55447799-55447821 GGGAGAGGGCAGAGGGGAGAGGG + Intronic
1127088952 15:55447820-55447842 GGGAGAGGGCAGAGGGGAGAGGG + Intronic
1127088960 15:55447841-55447863 GGGAGAGGGCAGAGGGGAGAGGG + Intronic
1127646532 15:60964471-60964493 GGGATGGAGCAGAGGGGAGAGGG + Intronic
1127827287 15:62715861-62715883 AGGTGGGGACAGAGGGAAGAGGG - Intronic
1128454546 15:67825348-67825370 GGGGGTGAGGAGAAGGAGGAGGG - Intronic
1128498207 15:68210244-68210266 CGGTGTGTGGAGAGGGGAGAGGG - Intronic
1129115922 15:73365458-73365480 GGGTGTGGGGATAGGGAAGCGGG - Intronic
1129508792 15:76104735-76104757 ATGTGTGAGGAGAGGGGAGAAGG + Intronic
1129509161 15:76107947-76107969 GGTTGTGGACAAAGGGAAGAGGG - Intronic
1129888037 15:79052418-79052440 GGATGGGGGCAGAGGGAAGCAGG - Intronic
1130517734 15:84639126-84639148 GGGTGGGAGCAGGGGGGTGAGGG - Intergenic
1130766651 15:86877850-86877872 GAATGTGAGAAGAGAGAAGAAGG - Intronic
1130846221 15:87748711-87748733 AGATGAGAGCAGAGTGAAGACGG + Intergenic
1130994887 15:88898140-88898162 GGTAGAAAGCAGAGGGAAGAGGG + Intergenic
1131214063 15:90522341-90522363 GGGTGTGAGCAGAAGTAATATGG - Intergenic
1131603282 15:93872201-93872223 GTGAGAGAGCAGAGAGAAGAGGG - Intergenic
1131611712 15:93971249-93971271 GGGTTTGAAAAAAGGGAAGAAGG + Intergenic
1131642532 15:94307770-94307792 GGCTGTGGGCAGAGGGAAAATGG + Intronic
1132072116 15:98787431-98787453 GAGCGTGAGCAAAGGGAAAATGG + Intronic
1132344037 15:101096841-101096863 GGGTAGGAGGAGAGGGAGGATGG + Intergenic
1132481546 16:168781-168803 AGGTGTGAGCAGGGAGAGGAGGG - Intergenic
1132664770 16:1076331-1076353 GGGTGGGAGAAGAGGGGAGGTGG - Intergenic
1132717888 16:1301240-1301262 GGGGGCGGGCAGAGGCAAGAGGG - Intergenic
1132724971 16:1334471-1334493 GTCGGTGAGCAGAGGGAGGAGGG + Intronic
1132768226 16:1545899-1545921 GGGTGTCAGAGCAGGGAAGAGGG - Intronic
1132839283 16:1971015-1971037 GAGTGGGTGCAGAGGGCAGAGGG - Intergenic
1132880883 16:2161214-2161236 GGGAGGGGGCAGAGGGAAGCAGG - Intronic
1133177240 16:4024726-4024748 GGATGTGAACAAAGGGAACAAGG + Intronic
1133285491 16:4688769-4688791 AGGTGGGAGCAGAGGGAGGAGGG - Intronic
1133392837 16:5423036-5423058 AGGAGTGGGGAGAGGGAAGAGGG + Intergenic
1133647247 16:7775856-7775878 AGGGGAGAGCAGGGGGAAGAGGG + Intergenic
1133755333 16:8758406-8758428 TGGTCTCAGCAGAGAGAAGAGGG + Intronic
1133809827 16:9152826-9152848 AGGGGTGAGCAGAGGGAGGTGGG - Intergenic
1133920556 16:10149083-10149105 GGGTGTGAGGGCAGGGAATAGGG + Intronic
1133978768 16:10618699-10618721 GGCTGTGAACTGGGGGAAGAAGG + Intergenic
1134090852 16:11390986-11391008 GAGTGTCAGCACAGGGAAGGGGG - Intronic
1134233879 16:12450585-12450607 CGGTGTGAGAGAAGGGAAGACGG + Intronic
1134313974 16:13101110-13101132 GGCTGTGGGGAGAGGGAAGTGGG + Intronic
1134523274 16:14927992-14928014 GGGGGAGAGGAGAGGGAAGGGGG - Intronic
1134523281 16:14928010-14928032 GGGGGAGAGGAGAGGGAAGGGGG - Intronic
1134523288 16:14928028-14928050 GGGGGAGAGGAGAGGGAAGGGGG - Intronic
1134803560 16:17106729-17106751 GGGGGTGAGTAGGGGGAGGATGG + Exonic
1135241691 16:20812652-20812674 AGGTATGAGGAGAGGGAAGCAGG - Intronic
1135293962 16:21263508-21263530 GGGGGTGAGGAGAGGGAAAGGGG - Intronic
1135627263 16:24006836-24006858 GGGGGTGGGGAGGGGGAAGAAGG + Intronic
1135644872 16:24152970-24152992 GGCTGTGATGAGAGAGAAGATGG + Intronic
1136153727 16:28368380-28368402 CGGTGGGAGCAGCGGGAAGCCGG - Intergenic
1136209365 16:28746890-28746912 CGGTGGGAGCAGCGGGAAGCCGG + Intergenic
1136394470 16:29985633-29985655 GGGCGAGTGCAGAGGGAAGCAGG - Intronic
1136607913 16:31348889-31348911 GGTCATGAGCAAAGGGAAGAGGG - Intergenic
1137936531 16:52640229-52640251 GTCTGTGAGAAGAAGGAAGAGGG + Intergenic
1138116289 16:54363041-54363063 GGGTGAGAGCAAGGGGAAGAGGG - Intergenic
1138613713 16:58147744-58147766 GGGTGTGAGGAGAAGGATGTAGG - Intergenic
1139114907 16:63938372-63938394 GGATGGGAGCAAAGGGAAGCTGG + Intergenic
1139144590 16:64308335-64308357 GGAGGTGAGCAGAGGGCAGCAGG + Intergenic
1139504568 16:67392532-67392554 GGGTGTGGCCAGAGGGCTGAGGG - Intronic
1139528810 16:67531561-67531583 GGGGCTGAGTAGTGGGAAGAAGG + Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140268612 16:73442693-73442715 GGCTGTGAGGAAAGAGAAGAGGG - Intergenic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1140477661 16:75247086-75247108 AGGTGGGGGCAGAGGGGAGAAGG - Intronic
1141364695 16:83431944-83431966 GATTTTGAGCAGAGGAAAGAGGG + Intronic
1141623654 16:85250179-85250201 TGGTGTGGGCAAGGGGAAGAGGG - Intergenic
1141667773 16:85474704-85474726 GGGAGTGGGGAGAGGGAGGAGGG - Intergenic
1141769750 16:86082626-86082648 GGATGGGAGGAGAGGGAAGCAGG + Intergenic
1141840940 16:86573664-86573686 GGGTGTGTGAAGAGGGAAGGGGG + Intergenic
1141906820 16:87032225-87032247 GGGTGTGAGCTGGTGGGAGAGGG - Intergenic
1141927193 16:87177603-87177625 TGGCGTGTGCAGAGTGAAGACGG + Intronic
1142323717 16:89400894-89400916 GGGTGTCTGCAGAGGGTGGAGGG - Intronic
1142401748 16:89862478-89862500 GGCTGTGAGCCCAGGGCAGATGG - Intronic
1142419718 16:89962914-89962936 GGGCGGGAGCCGAGGGCAGACGG + Intronic
1142421022 16:89970182-89970204 GGGGAGGAGGAGAGGGAAGATGG - Exonic
1142564017 17:827825-827847 GGGCAGCAGCAGAGGGAAGAGGG + Intronic
1142638154 17:1270497-1270519 GGCAGTGGGCAGAGGGCAGAGGG + Intergenic
1143365453 17:6405622-6405644 GCTTGTGGGCAGAGGGAAGGAGG - Intronic
1143441858 17:6981025-6981047 GGGAGGGAGGAGAGTGAAGAAGG - Intronic
1143538881 17:7558032-7558054 AGGTGGGAGCAGAGGTAGGAAGG + Intronic
1143622856 17:8090972-8090994 GGGAGGGAGGAGAGGGGAGAAGG + Intergenic
1143709143 17:8721874-8721896 GGGTGAGAACAGAGGCAAGCAGG - Intergenic
1143786338 17:9258572-9258594 GGGTGTGATCAGAGGCAGGTAGG - Intronic
1143900388 17:10170137-10170159 AGGGGGGAGCAGAGGGTAGAAGG - Intronic
1144478417 17:15609289-15609311 GAGAGGGAGCAGAGGAAAGAGGG - Intronic
1144792116 17:17866307-17866329 AGCTGGGAGGAGAGGGAAGATGG + Exonic
1144843903 17:18205954-18205976 AGGTGGGAGCAAAGGGCAGAAGG - Intronic
1144919873 17:18754422-18754444 GAGAGGGAGCAGAGGAAAGAGGG + Intronic
1146575775 17:33989909-33989931 GGGTTGCAGCAGTGGGAAGAAGG + Intronic
1146691863 17:34882399-34882421 GGGTGAGGGCAGAGGGAAGGGGG - Intergenic
1146847990 17:36196704-36196726 GAGTGTCAGCAGAGCCAAGAAGG + Exonic
1146908607 17:36633514-36633536 GGGAGAGAGGAGAGGGAGGAGGG + Intergenic
1146923814 17:36730659-36730681 GGGTGTGTGCATAGGGGAGGGGG + Intergenic
1147032872 17:37655108-37655130 GGGTGTGGGGAGTGAGAAGAGGG + Intergenic
1147038068 17:37696487-37696509 GAGTGTGAGCAGGAGGGAGAAGG - Intronic
1147180987 17:38685636-38685658 GGGTGGAAGCAGATGGAAGCGGG - Intergenic
1147370901 17:39992361-39992383 GTGTGAGGGCAGAGGGCAGAGGG - Intronic
1147407141 17:40220117-40220139 TGGTGTGAAGTGAGGGAAGATGG + Intronic
1147540329 17:41351927-41351949 GGGTGTGGGTAGAGTGATGAAGG + Intergenic
1147553408 17:41461056-41461078 AGGTGAGTGGAGAGGGAAGAGGG - Intronic
1147904888 17:43816335-43816357 GAGTGTGAGCAGTGTGAATAGGG + Intronic
1148019220 17:44542415-44542437 GGTTGGAAGCAGAGGGAAGATGG - Intergenic
1148444344 17:47728377-47728399 GGCTGGGAGTAGAGGAAAGAGGG + Intergenic
1148686173 17:49502396-49502418 GGAAGTGTGCAGAGGGAGGAGGG + Intronic
1148764507 17:50029265-50029287 GGAGGTGACCAGAGGGCAGAGGG - Intergenic
1148860536 17:50602214-50602236 GGGTGTGAGCACAGAGAGGAGGG - Intronic
1149304630 17:55335827-55335849 GGGAGGGAGCAGAGGGAAGAGGG - Intergenic
1149427630 17:56570285-56570307 GGCTGTGAGAGGAGGGGAGATGG - Intergenic
1149564416 17:57630939-57630961 GGGGATGAGGAGAGGGCAGAGGG - Intronic
1149658608 17:58323209-58323231 GGGTGGGAGCAGAGCTGAGAGGG + Intronic
1150200394 17:63350296-63350318 GGGGGAAAGCAGAGGGAAGAGGG - Intronic
1150562230 17:66303354-66303376 GGGTGTGAGCCCAGGGGACAGGG + Intronic
1150929881 17:69573098-69573120 GGGAGGGAGGGGAGGGAAGAGGG - Intergenic
1151159120 17:72150119-72150141 GGGTGGGGGCAGGGGGAACAGGG + Intergenic
1151215910 17:72576254-72576276 GGGTCTGAGCAAACAGAAGAGGG - Intergenic
1151649955 17:75460973-75460995 GGGTGGGAGCAGGGGGGAAATGG - Intronic
1151713895 17:75821800-75821822 GCGAGTGAGCAGAGGGCAGCTGG + Intronic
1151765356 17:76130876-76130898 TGGTGAGAGCAGGAGGAAGAGGG - Intergenic
1151887787 17:76933323-76933345 GGAAGGGAGCAGAGGGTAGAGGG - Intronic
1151954495 17:77373625-77373647 GGGGGTGCGCTGAGGGGAGACGG + Intronic
1151954500 17:77373646-77373668 GGGAGTGCGCTGAGGGGAGACGG + Intronic
1152207277 17:78980867-78980889 GGGGCAGAGCAGAGGGAAGCAGG + Intergenic
1152232801 17:79123068-79123090 GGGTGTGGGCTGGGGGAAGGTGG + Intronic
1153051761 18:907495-907517 GGGTGGGAGCAGAGGTAAGGAGG - Intronic
1153513006 18:5875926-5875948 AGGTGTGAACAGAAGGATGAAGG + Intergenic
1154079674 18:11243567-11243589 GGCTGTGAGCAGAGGGGTGACGG + Intergenic
1154109381 18:11552656-11552678 GGGTGAGAGCAGTGGGCACACGG - Intergenic
1154157984 18:11959003-11959025 GGGAGAGAGGAGAGGGGAGAGGG - Intergenic
1154275166 18:12952745-12952767 GGGTGGGAGGGGAGGGGAGAGGG - Intronic
1154432786 18:14321129-14321151 GGTGGTGGGCAGAAGGAAGAGGG + Intergenic
1155156584 18:23162826-23162848 GAGTATAAGCAGCGGGAAGAGGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155670932 18:28370271-28370293 AGGCCTGAGCAGAAGGAAGAAGG + Intergenic
1156139569 18:34090548-34090570 GGGAGTGAGAAAAAGGAAGAGGG + Intronic
1156209614 18:34925473-34925495 GGTTGGGAGCAGAGTGAACAGGG + Intergenic
1156969268 18:43135089-43135111 GGGTGTGATTAGAAGGAGGAGGG + Intergenic
1157811876 18:50703168-50703190 GGGAGTGAGCATGGGGAGGAGGG - Intronic
1157826109 18:50813846-50813868 GGGTGGGAGGAGGGTGAAGATGG + Intronic
1157856608 18:51110407-51110429 AGGAGGGAGGAGAGGGAAGAGGG + Intergenic
1158431909 18:57396759-57396781 GGGTGAGAGGAAGGGGAAGAAGG + Intergenic
1158452001 18:57574982-57575004 GGGTGAGAGGGGAGGGAACAGGG - Intronic
1159116122 18:64114970-64114992 GGGTGGGAGGAGAAGGGAGAAGG - Intergenic
1159485895 18:69056906-69056928 GGGGCTGAGAAGAGGAAAGATGG - Intergenic
1159936453 18:74371959-74371981 GGGTGAGAGGAGAGGCAAAAGGG + Intergenic
1160398236 18:78587986-78588008 AGGTGTGTGCAGAAGGAAGGGGG + Intergenic
1160410311 18:78671225-78671247 TGCTGTGATCAGAGAGAAGACGG - Intergenic
1160509839 18:79447232-79447254 GTCAGTGGGCAGAGGGAAGATGG - Intronic
1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG + Intergenic
1160965277 19:1744634-1744656 GGGAGGAAGCAGAGGGGAGATGG - Intergenic
1161093834 19:2377465-2377487 GGGAGAGAGGAGAGGGGAGAGGG - Intergenic
1161489090 19:4552125-4552147 GGGTGTGAGATGGAGGAAGAGGG - Intronic
1161705812 19:5820920-5820942 GTGTCTGAGCAGAGTGAGGAGGG - Intergenic
1161742387 19:6030579-6030601 GGCTGTCAGGAGATGGAAGAAGG + Intronic
1162175029 19:8824022-8824044 GGGTGTGAGCACCGGGAGGCTGG - Intronic
1162410036 19:10500087-10500109 GGGAGAGAGCACAGGGCAGAGGG + Intronic
1162430866 19:10627643-10627665 GGGTGTTTGCAGAGGGCAGATGG + Intronic
1162782041 19:13011525-13011547 GGGTGGGAGCAGAGGCAGGGGGG + Intronic
1162854789 19:13460050-13460072 GCGGGTGAGCAGAGGGAGGGGGG - Intronic
1162954995 19:14092507-14092529 GGGTGGGAGTAGAGGAAGGAGGG + Exonic
1163241348 19:16065767-16065789 GGGAGGGGGCAGAGGGAAGCTGG + Intergenic
1165051142 19:33142349-33142371 GGGAGGGAGCACAGGGATGAGGG + Intronic
1165064494 19:33221078-33221100 GGCTTTGAGCAGAGGGATGATGG - Intronic
1165078910 19:33296700-33296722 GGCTGTGAGGGGAGGGAAGCTGG - Intergenic
1165079790 19:33300719-33300741 GGGTGTGTGCGGAGGGAGGTGGG + Exonic
1165245589 19:34496718-34496740 GAGTGAGGGCAGGGGGAAGAGGG + Intronic
1165802798 19:38563151-38563173 AGGGGTGAGCAGAAGGAAGCGGG - Intronic
1165912346 19:39237078-39237100 AGGTGGGAGTAGAGGGAAGGGGG + Intergenic
1166140924 19:40804762-40804784 GGGAGTGAGCAGTGCAAAGAAGG + Intronic
1166318539 19:42002575-42002597 GGATGTGAGGAGGGGGAGGAAGG + Intronic
1166515130 19:43440802-43440824 GTGTGTGAGCAATGGAAAGAAGG + Intergenic
1166668531 19:44695989-44696011 GGGGGTGGGCAGCGGGGAGATGG + Intergenic
1166690955 19:44821010-44821032 GGGAGAGGGAAGAGGGAAGAGGG - Exonic
1166749524 19:45158382-45158404 GGGTGTCGGCAGAGGGAAAGGGG + Intronic
1166781293 19:45344982-45345004 GGGTGGGAGGAGAGGGCCGAGGG - Intronic
1167037121 19:47001133-47001155 GGGTGTGTGCAGATGGAAGGTGG - Exonic
1167284775 19:48592850-48592872 GGGTGTGAGCAGAGGGTATGGGG - Intronic
1167537734 19:50065751-50065773 GGGTGTGAGCAGGGGAGGGAGGG + Intergenic
1167548545 19:50143895-50143917 GGGTATGAGGAGAGGGGAGCCGG - Intergenic
1167619602 19:50553410-50553432 GCGAGTGAGCAGGGGGAGGAGGG - Intronic
1167744574 19:51342964-51342986 GGCTGTGAGCAGGGGGAGGCAGG - Intergenic
1167773828 19:51541901-51541923 GTGTGTGAGCAAAGGCATGAAGG - Intergenic
1167785201 19:51630276-51630298 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1167787300 19:51646700-51646722 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1167867870 19:52342984-52343006 GGGTGGGTGGAGAGGGAAAATGG - Intronic
1167874592 19:52401121-52401143 GGGTGGGTGAAGAGGGAAAATGG - Intronic
1168241571 19:55091613-55091635 GGCTGTGGGCAGAGGGCCGAGGG - Intronic
1168283685 19:55320165-55320187 GGCTGGGAGTAGAGGGGAGAAGG + Exonic
1168310278 19:55456492-55456514 GGGGGTGGGCAGAGGGACGGTGG + Intronic
924998702 2:386792-386814 GGGAGCGGGCAGAGGGGAGAGGG - Intergenic
924998716 2:386827-386849 GGGAGAGGGCAGAGGGCAGAGGG - Intergenic
924998725 2:386855-386877 GGGAGAGGGCAGAGGGCAGAGGG - Intergenic
924998729 2:386869-386891 GGGAGAGGGCAGAGGGGAGAGGG - Intergenic
924998739 2:386897-386919 GGCAGAGAGCAGAGGGCAGAGGG - Intergenic
924998746 2:386925-386947 GGGAGAGCGCAGAGGGCAGAGGG - Intergenic
925053476 2:835559-835581 GGTTATGGGCAGAGGGAGGAAGG + Intergenic
925128696 2:1479220-1479242 GGGGTTGAGCAGAGGGGAGAAGG - Intronic
925363524 2:3295754-3295776 GTGTGTGTGCAGAGAGAGGACGG - Intronic
925363547 2:3295859-3295881 GGGTGTGTGCAGAGAGAGGATGG - Intronic
925363568 2:3295960-3295982 GTGTGTGTGCAGAGAGAGGATGG - Intronic
925363587 2:3296060-3296082 GTGTGTGTGCAGAGAGAGGAGGG - Intronic
925363655 2:3296375-3296397 GTGTGTGTGCAGAGAGAGGATGG - Intronic
925510869 2:4623465-4623487 GGAAGTGAGAAGAGGGATGATGG + Intergenic
925994627 2:9281993-9282015 GAGCATGAGCAGAGGGAAGAAGG - Intronic
926557465 2:14376167-14376189 GGGTGAGAACAAAGGGTAGATGG - Intergenic
926645993 2:15290075-15290097 GGGAGAGAGTAGAGGGGAGAGGG + Intronic
926646000 2:15290096-15290118 GGGAGAGAGGAGAGGGGAGAGGG + Intronic
926711834 2:15888275-15888297 GGCTGTGAGCAGAAGGAACTTGG + Intergenic
927106049 2:19827026-19827048 GAGTGTTAGCAGAGATAAGAAGG + Intergenic
927182715 2:20458450-20458472 GAGGGTGAGCAGAAGCAAGATGG + Intergenic
927703122 2:25280468-25280490 GAGAGTGAGAACAGGGAAGAAGG - Intronic
927889852 2:26741503-26741525 GAGTGTGAGCACAGGGCTGATGG + Intergenic
928087515 2:28355290-28355312 GGGTGTGGGCAGAGGGAATGGGG - Intergenic
928224065 2:29432333-29432355 GGGAGAGAGCAATGGGAAGATGG - Intronic
928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG + Intergenic
929461818 2:42107649-42107671 GGGTTTGAGAAGAGAAAAGAAGG - Intergenic
929578990 2:43070024-43070046 GGGTTTGAGGGGAGGGAACAGGG - Intergenic
929796019 2:45058823-45058845 GGGTGTGAGGAGAATGAACATGG + Intergenic
929822059 2:45281752-45281774 GGGTGTGAGCAGATGGAGGTGGG - Intergenic
929868314 2:45736958-45736980 GGGAATGAGCAGATGGAAGAGGG + Intronic
930739104 2:54811146-54811168 GGGTGTTAGGAGAGGCAAGGTGG - Intronic
931133383 2:59366199-59366221 GGGGGAGAGAAGAAGGAAGAAGG + Intergenic
931223141 2:60306306-60306328 GGGTGGGAGTGGAGGGAGGAAGG - Intergenic
931423754 2:62152109-62152131 GGAGGTGAGCAGAGGGAAGATGG - Intergenic
931547806 2:63408488-63408510 GGGGGTGGCCAGAAGGAAGACGG + Intronic
931987576 2:67756451-67756473 GGGTGTGAGAGGATGGAAAAAGG - Intergenic
932029457 2:68168457-68168479 GAGTGTGGGAAGAGGGAAGCTGG + Intronic
932418352 2:71586944-71586966 GGGTGGGAGCAGTGGGAGTAGGG - Intronic
932450996 2:71810738-71810760 GGGTGGGAGCAGAGGGTATCAGG + Intergenic
932659523 2:73640308-73640330 GGGTCTCTGCAGAGGGAAGAAGG - Intergenic
932666087 2:73699979-73700001 GGGTCTCTGCAGAGGGAAGAAGG - Intergenic
933286627 2:80391239-80391261 TGGTGTGAACAGAGTGAAGAGGG - Intronic
933778676 2:85787050-85787072 GGGTGAGGGCGGAGGGGAGAGGG - Exonic
933805061 2:85992759-85992781 GGTTGTGGGCAGAGAGTAGATGG - Intergenic
933807716 2:86012189-86012211 TGGTGGGAGCACAGGGCAGAGGG - Intergenic
933841051 2:86285901-86285923 GGGCTCAAGCAGAGGGAAGATGG + Intronic
934087894 2:88525498-88525520 GGGTAGGAGCCCAGGGAAGATGG + Intronic
934300713 2:91774587-91774609 AGGTGTGACAACAGGGAAGAGGG - Intergenic
934520575 2:95017842-95017864 TGATGTGATCAGAGGGAGGATGG + Intergenic
934560893 2:95312792-95312814 TGGTGGGAGCTGAGGGACGAGGG + Intronic
934962314 2:98687503-98687525 GAAAGTGAGAAGAGGGAAGAAGG - Intronic
934998710 2:98989711-98989733 GGGAGAGAGGAGAGGGGAGAGGG + Intergenic
935075949 2:99744040-99744062 GGGTGGGGGCAGAGGGCAGAAGG - Intronic
935156935 2:100491709-100491731 TGGTCTGACCAGAGGGCAGAGGG + Intergenic
935494667 2:103765419-103765441 GTGTGTGGGCAGAAGGATGAGGG - Intergenic
935985207 2:108665966-108665988 GTGTGCAAGCAGAGGGAAAATGG - Intronic
936137642 2:109909610-109909632 GTGTGCAAGCAGAGGGAAAATGG - Intergenic
936207055 2:110461875-110461897 GTGTGCAAGCAGAGGGAAAATGG + Intronic
936503026 2:113081505-113081527 AGGTGGGAGTAGTGGGAAGAGGG + Intergenic
936661712 2:114550241-114550263 GGGTGTGAGCATAGGACAAAGGG + Intronic
937123222 2:119455173-119455195 GGAGGTGGGCAGAGGGTAGAGGG - Intronic
937466795 2:122139816-122139838 GGGCCAGAGAAGAGGGAAGAAGG + Intergenic
937660886 2:124428449-124428471 GGGTTTGAGCTTTGGGAAGATGG + Intronic
937921802 2:127136547-127136569 GGGTGGGAGACGGGGGAAGACGG + Intergenic
939031873 2:137086398-137086420 GGGTGTGGGCAGATAGAAAATGG - Intronic
939137290 2:138312619-138312641 GGGTGTGAGCTGAGAGGAGCAGG + Intergenic
939270668 2:139935349-139935371 GTCTGTGAGGAGAGGAAAGAGGG - Intergenic
939606708 2:144262919-144262941 GGGAGAGGGGAGAGGGAAGAGGG + Intronic
939623248 2:144446400-144446422 GGGGATGTGGAGAGGGAAGAAGG - Intronic
939839847 2:147173676-147173698 GGGTGTCAGAAGAGAGAGGAAGG - Intergenic
940005946 2:149009826-149009848 GGGTGTGTGTAGAGGAAAGGGGG - Intronic
940581383 2:155584656-155584678 GGGTGTGAGCAAAGTGATCAGGG - Intergenic
941008466 2:160270826-160270848 GGGTTGGAGGAGAGGAAAGAGGG - Intronic
941687475 2:168461914-168461936 AGGTGGCAGCAGAGGGAAAATGG + Intronic
941918606 2:170828317-170828339 AGATGACAGCAGAGGGAAGAGGG - Intronic
942468895 2:176239091-176239113 AGGTGGGAGCAAAGGGAAAATGG - Intergenic
942597907 2:177609561-177609583 GGGTGGGGGCAGAGTGAAGCTGG + Intergenic
943370588 2:187010996-187011018 GGGTGTGTGCAGAGAGGGGAAGG - Intergenic
944142775 2:196475347-196475369 GGGGATGCGCAAAGGGAAGAGGG + Intronic
944272719 2:197802050-197802072 GGGGGTGAGCAGGGGTAGGAAGG - Intergenic
944354015 2:198763569-198763591 GAGTGTGTGCAGAAGGGAGATGG - Intergenic
944619460 2:201499039-201499061 GGGTGTGTGGGGATGGAAGATGG - Intronic
944652804 2:201848544-201848566 GGGAGTGTGGGGAGGGAAGATGG - Intronic
945282874 2:208052867-208052889 GGGTGGGACTAGAGGGAAAATGG - Intergenic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
946231150 2:218292045-218292067 GCTGGTGAGAAGAGGGAAGAGGG - Intronic
946346928 2:219118456-219118478 GGGGGTAGGCAGTGGGAAGATGG + Intronic
946374737 2:219301326-219301348 GGGTGTGAGCAGGGAAAAGGAGG - Intronic
946394033 2:219434548-219434570 GGGTCTGAGATGAGGGAGGAAGG + Intergenic
946410134 2:219511621-219511643 GGGTGTGAGCAAAGGGGGCAGGG - Intergenic
946427880 2:219609036-219609058 GGCGGTGATCAGAGGGATGAGGG - Intronic
946498746 2:220222794-220222816 AGGTGTGAGAAAAGGGTAGAAGG - Intergenic
946565275 2:220957395-220957417 GGTTGTCAGCATAGGGAAGCTGG + Intergenic
946884780 2:224211988-224212010 GGGTGGGAGTGGAGGGAGGAGGG - Intergenic
946965377 2:225031531-225031553 AGGTGTGAGCAGGGAGAAGGAGG + Intronic
946996469 2:225397914-225397936 GGGAGGGAGGAGAGGGAGGAAGG + Intergenic
947331674 2:229035455-229035477 GTGTGTGAGTAGAGGGAAGGAGG - Intronic
947666432 2:231908832-231908854 GGGCGTGGGCAGCGGGGAGAAGG + Intergenic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
947935780 2:234002218-234002240 AGGAGTGGGCAGAGGGAGGAGGG + Intronic
947978154 2:234385483-234385505 AGATGCGTGCAGAGGGAAGATGG - Intergenic
948056237 2:235011004-235011026 GGGTTTCAGGAGAGGGAGGAAGG - Intronic
948172908 2:235919825-235919847 GGGTGTAAGCATTGTGAAGACGG - Intronic
948186363 2:236024473-236024495 GGGTGCGAGGGGAGGGAAGGAGG - Intronic
948266309 2:236637682-236637704 GTGTGGGGGCAGGGGGAAGATGG - Intergenic
948534317 2:238634837-238634859 GGATGTGACTAGAGGGAGGAGGG + Intergenic
948568239 2:238899872-238899894 GGGTGGGAGCAGAGGGTATATGG + Intronic
948766916 2:240227137-240227159 GGGTGTCAGCAAAGAGAAGCAGG + Intergenic
949063888 2:241977595-241977617 GGGTGTGCTCAGTGGGACGAGGG + Intergenic
1169085247 20:2822089-2822111 GGGTGGGAGTAGGGCGAAGAGGG + Intergenic
1169112262 20:3041853-3041875 GGGTGTGGGCAGTGGGAGGCAGG - Intergenic
1169203484 20:3727384-3727406 GGCAGTGGGCAGAGGGAAGCAGG + Intergenic
1169347707 20:4841896-4841918 GGATGGGAGCAGGGGGGAGATGG - Intergenic
1169524027 20:6403402-6403424 GTATGTGAACAGAGGGAGGAAGG + Intergenic
1169754573 20:9030127-9030149 GGATGTGAGCAGAGTGATGTAGG + Intergenic
1169820909 20:9708925-9708947 GGATGTGAGCAGAGGAAGGAAGG - Intronic
1171031729 20:21682654-21682676 GGGTGGGGGCTGAGGGAGGAGGG - Intergenic
1171381903 20:24740023-24740045 TGCTGTGAGCATAGGGAAAAGGG - Intergenic
1171958730 20:31478180-31478202 GGGTGGGAGGGGTGGGAAGAGGG - Intronic
1172099554 20:32476965-32476987 GGGTTTGAGGAGAGGCAAGGAGG + Intronic
1172300542 20:33846658-33846680 GGGTGTGAGTAGAAGGAGCATGG + Intronic
1172402461 20:34661345-34661367 GGGTGGGAGGAGGGTGAAGATGG - Intronic
1172612149 20:36260298-36260320 GGAAGTGGACAGAGGGAAGAGGG - Intronic
1172656999 20:36543453-36543475 GGGTTTGGGCAGAGGGAAGAGGG + Intronic
1172693048 20:36803642-36803664 GACTGTGAGCAGTGGGAAGAAGG + Intronic
1172969999 20:38866283-38866305 GTGTCTGTGCAGCGGGAAGAAGG + Intronic
1173441188 20:43077692-43077714 GGGTATATGCAGAGGGAAAAAGG + Intronic
1173545491 20:43894685-43894707 GGGAGTGAGCTGAGGGAGGCTGG - Intergenic
1173549722 20:43924129-43924151 GGGGATGAGCATATGGAAGAGGG + Intronic
1173565072 20:44032655-44032677 GGCTCTGAGCAGAGGAGAGAGGG + Intronic
1173654937 20:44693445-44693467 GGGTGCGAGCAGGGAGGAGAAGG - Intergenic
1173759886 20:45550135-45550157 GAGTGTGATAAGTGGGAAGATGG + Intergenic
1173980152 20:47217855-47217877 GGGGGCGAGCAGGGGGAGGAAGG - Intronic
1174164571 20:48575695-48575717 GGGAGGGAGCAGAGGGGAGGAGG + Intergenic
1174443502 20:50575010-50575032 GAGTCTGAAGAGAGGGAAGAAGG + Intronic
1175366867 20:58461674-58461696 GGGAGTGAGGAGAGAGAGGAGGG - Intronic
1175385537 20:58592630-58592652 CGGGGTGAGATGAGGGAAGATGG + Intergenic
1175613985 20:60376965-60376987 GTTTATCAGCAGAGGGAAGAAGG + Intergenic
1175966713 20:62663491-62663513 CGGTGTGAGCAGAGGCGACATGG + Intronic
1175985613 20:62762922-62762944 GGCTGTGAGCAGAGGGATCCCGG - Intergenic
1176257729 20:64160843-64160865 GGGTGTGTGCAGAGGCCAGCTGG + Intronic
1176513691 21:7767423-7767445 GGGAGGGAGGAGAGGGGAGAGGG - Intronic
1177019033 21:15829293-15829315 GGGTGGGAGCAGGGTGAGGATGG - Intronic
1177259182 21:18706909-18706931 GAGGGTGAACAGGGGGAAGAGGG - Intergenic
1178025277 21:28459305-28459327 GGGTGAGAGCTGATGGAATAGGG - Intergenic
1178647804 21:34397947-34397969 GGGAGGGAGGAGAGGGGAGAGGG - Intronic
1178897216 21:36568760-36568782 GTCTGTGAGAAGAGGAAAGAGGG - Intronic
1179008641 21:37535848-37535870 AGGTTTGCGCAGAGGGCAGATGG + Intergenic
1179149666 21:38799095-38799117 GGGTGGGAGCTGAGGGGACAAGG + Intergenic
1179404100 21:41111200-41111222 GGGTTTAAGCAGAGGGAGGCAGG + Intergenic
1179465752 21:41570963-41570985 GGGTGTCAGCGCCGGGAAGAGGG - Intergenic
1179550580 21:42141040-42141062 GGACCTGAGCACAGGGAAGACGG - Intronic
1179635070 21:42703553-42703575 CGCTGGGAGCAGAGGAAAGAGGG + Intronic
1179673940 21:42969078-42969100 GGGTGTGTGCAGGGGGCAGTGGG + Intergenic
1179947496 21:44688176-44688198 GGCTATGATCAGAGGGAAGTGGG + Intronic
1180210954 21:46295377-46295399 GGGTTTGGGTGGAGGGAAGAGGG - Intronic
1180259192 21:46656176-46656198 GGGTGGGAGCAGAGGCAAGTGGG - Intronic
1180616494 22:17131709-17131731 GGGTGTTGGAAGTGGGAAGATGG - Exonic
1180673980 22:17574432-17574454 TGGTGTGAGCAGAGGGTTCAGGG - Intronic
1180816449 22:18792550-18792572 AGGTGTGACAACAGGGAAGAGGG + Intergenic
1181202636 22:21226882-21226904 AGGTGTGACAACAGGGAAGAGGG + Intronic
1181463050 22:23096571-23096593 AGGTGGGGGCAGAGGGAACAGGG + Intronic
1181479829 22:23191705-23191727 GGGTGTTTGCAGATTGAAGATGG + Intronic
1181699067 22:24609723-24609745 AGGTGTGACAACAGGGAAGAGGG - Intronic
1181901050 22:26155980-26156002 GGGAGGGAGGAAAGGGAAGAAGG + Intergenic
1182060690 22:27395040-27395062 GTGAGTGAGCAGATGGATGAGGG + Intergenic
1182760859 22:32721273-32721295 GGGTGGGCACAGAGGAAAGAGGG + Intronic
1182844835 22:33421834-33421856 GGGGGTAAGCAGGTGGAAGAGGG + Intronic
1182910631 22:33981284-33981306 GGCTGTGAGGAGTGGGAAAAAGG - Intergenic
1183385470 22:37511648-37511670 GGGTGTGAGGGGAGAGGAGAGGG + Intronic
1183392995 22:37556441-37556463 GGGAGTGGGCAGTGGGTAGATGG + Intergenic
1183705704 22:39473867-39473889 GTGTGTGGGCAGGGGGCAGATGG + Intronic
1183933199 22:41247826-41247848 GGCTGGGAGCTGAGGGAAGAGGG + Intronic
1184067663 22:42129566-42129588 AGGTGTGAGCATGGGGACGAGGG - Intronic
1184156542 22:42671227-42671249 GGGTGGGAGCAGGGTGAGGATGG + Intergenic
1184293370 22:43509597-43509619 GGGGGTGAATAGAGGGATGATGG - Intergenic
1184335491 22:43850590-43850612 GAGGGAGAGCAGAGGGAACAGGG - Intronic
1184509354 22:44924062-44924084 GGGAGGGAGGGGAGGGAAGAGGG + Intronic
1184552746 22:45213273-45213295 GGCTGAGGGCAGAGGGCAGAGGG - Intronic
1184596049 22:45514889-45514911 GGGTGAGAGCAGTGGGCAGGAGG + Intronic
1184729581 22:46365268-46365290 GGGTGGGAGCTGAGGAAAAATGG - Exonic
1184874050 22:47261514-47261536 GGGTCAGAGAGGAGGGAAGATGG - Intergenic
1184961140 22:47929510-47929532 GGTTGTGGGGAAAGGGAAGAGGG + Intergenic
1185164402 22:49251912-49251934 GAGTGTGAGCTGAGGGAAGGAGG + Intergenic
1203224277 22_KI270731v1_random:68531-68553 AGGTGTGACAACAGGGAAGAGGG - Intergenic
1203266549 22_KI270734v1_random:18261-18283 AGGTGTGACAACAGGGAAGAGGG + Intergenic
949276140 3:2284049-2284071 GCATGTTAGCAGAGGGAAAAAGG + Intronic
949577587 3:5353536-5353558 GTGTGTGTGCACAGGGGAGAGGG + Intergenic
949948264 3:9207574-9207596 GGGAGGGAGGAGAAGGAAGAAGG + Intronic
950030077 3:9846414-9846436 GGGGGTCAGCAGAGGCAGGATGG + Intronic
950217440 3:11169441-11169463 GGGTGTGAGCAATGGAATGATGG - Intronic
950755092 3:15164178-15164200 GGGAGAGGGAAGAGGGAAGAGGG + Intergenic
950797135 3:15519375-15519397 GGATGGGAGGAGAGAGAAGATGG + Intronic
951035802 3:17930621-17930643 GGGTGGGAGGTGAGGGTAGAGGG + Intronic
951360123 3:21715226-21715248 GGGTGAGAGGAGAGGGAATGAGG - Intronic
951524840 3:23643944-23643966 AGGTGAGAGAAGAGGGAATACGG - Intergenic
951607290 3:24450040-24450062 GGAAGTAAACAGAGGGAAGAAGG + Intronic
951700851 3:25495238-25495260 GGGTATCAGAGGAGGGAAGATGG + Intronic
952364529 3:32663441-32663463 GGGAGAGGGAAGAGGGAAGAGGG - Intergenic
952707453 3:36393668-36393690 GAGGGAGAGCAGAGAGAAGAAGG - Intronic
952970009 3:38644848-38644870 GGGTTGGAGCAGAGGGAATAGGG - Intronic
953197982 3:40751982-40752004 GGGAGAGATCAGAGGGAAGTGGG + Intergenic
953203757 3:40801586-40801608 GGGTATGGGCAGAGGAAGGAAGG + Intergenic
953412072 3:42696303-42696325 TGGTGTGAGAAGAGGAGAGACGG - Intronic
953737483 3:45508844-45508866 GGGAGGGAGGAGAGGGAGGAAGG - Intronic
953925965 3:46982497-46982519 GGGTGGCTGCTGAGGGAAGAGGG + Intronic
953982925 3:47421733-47421755 GGGGGTGAGCAGAGAACAGATGG - Intronic
954407803 3:50355242-50355264 TGCTCTGAGGAGAGGGAAGAAGG - Exonic
954681554 3:52348818-52348840 GTGAATGAGCAGAGGGGAGATGG - Intronic
954697437 3:52435282-52435304 GGGTGTGCCCAGAGGCAAGAGGG - Exonic
955036240 3:55270621-55270643 GGGGTTGAGGGGAGGGAAGAGGG + Intergenic
955144370 3:56301493-56301515 GGGGGAGAGAAGAGGGGAGAGGG - Intronic
955523903 3:59801839-59801861 GGGTATGAGCAAAGGTCAGAGGG - Intronic
955896439 3:63705693-63705715 TGGTGTGAGCAAAGGCAAGGAGG + Intergenic
956591919 3:70924313-70924335 GGATGTGAGGGAAGGGAAGAGGG - Intergenic
956778713 3:72587711-72587733 TGGAGGGAGCAGAGGGAAGCAGG + Intergenic
956870384 3:73411454-73411476 AGGTGTGAGCAAAGGCAAGGTGG + Intronic
959468609 3:106721013-106721035 GGGTGCCAGCAGAGGGCAGAGGG + Intergenic
959683592 3:109123331-109123353 GGGAGAGGGGAGAGGGAAGAGGG - Intergenic
959717986 3:109454440-109454462 GGGTGTGTGTAGGGGGAAGTGGG + Intergenic
960619327 3:119623660-119623682 GGGTGTGTGGAGAGGGAGCAGGG + Intronic
960961798 3:123076036-123076058 TGCTGGTAGCAGAGGGAAGATGG + Intronic
960991444 3:123314181-123314203 GGCTGAGAGAAGCGGGAAGAAGG + Intronic
961141843 3:124562727-124562749 GTGTGAGAGCAGAGGTAAGGAGG - Intronic
961194557 3:124990688-124990710 AGGTGTGAACTGAGGGAAGTGGG + Intronic
961345405 3:126260528-126260550 GGGGAGGAGGAGAGGGAAGAGGG - Intergenic
961640309 3:128360728-128360750 GGGTGGGAGTGGAGGGAGGAGGG + Intronic
961659920 3:128463258-128463280 GGGTGAGAGGAGAGGGAACGTGG + Exonic
961662241 3:128475543-128475565 GGGTGCAAACAGAGGGAAGAAGG + Intergenic
961683012 3:128611508-128611530 GGCTGTCAGAAGAGGGCAGAAGG - Intergenic
962075192 3:132074099-132074121 GGGTGGGGGCAGGGGTAAGATGG + Intronic
962202719 3:133414442-133414464 AGGGGTGAGTAGAGGGGAGAGGG - Intronic
962202817 3:133414844-133414866 AGGTGTGAGTAGATGGAAGAGGG - Intronic
962202833 3:133414916-133414938 AGGGGTGAGCAGAGGGGACAGGG - Intronic
962202843 3:133414951-133414973 AGGGGTGAGTAGAGGGGAGATGG - Intronic
962203070 3:133415826-133415848 AGGGGTGAGTAGAGGGAAGAGGG - Intronic
962203077 3:133415850-133415872 GAGGGTGAGTAGAGGGGAGAGGG - Intronic
962203128 3:133416072-133416094 AGGGGTGAGTAGAGGGAAGATGG - Intronic
962203201 3:133416374-133416396 AGGGGTGAGTAGAGGGGAGAGGG - Intronic
962203255 3:133416605-133416627 AGGGGTGAGTAGAGGGGAGATGG - Intronic
962203375 3:133417090-133417112 AGGGGTGAGTAGAGGGGAGAGGG - Intronic
962203425 3:133417279-133417301 AGGGGTGAGCAGAAGGGAGAGGG - Intronic
962203460 3:133417397-133417419 TGGGGTGAGTAGAGGGGAGATGG - Intronic
962203478 3:133417468-133417490 AGGGGTGAGTAGAGGGGAGAGGG - Intronic
962203510 3:133417585-133417607 AGGAGTGAGTAGAGGGGAGATGG - Intronic
962270629 3:133975533-133975555 GGGTTTGAGCTGAGGGAACATGG - Intronic
962273953 3:133998397-133998419 GGGTGGGAGCAGGGGGAGGCAGG - Intronic
963247273 3:143074854-143074876 GGCTTGGAGCAGAGGGAGGATGG + Intergenic
963310683 3:143706993-143707015 GGGTGGGGGCAGTAGGAAGATGG + Intronic
964276151 3:155010950-155010972 GTGTGTAAGCAGATGGAAGGAGG - Intergenic
964662864 3:159140057-159140079 GGGGGTGAACAGGGGGAACATGG - Intronic
965456330 3:168905511-168905533 GGGTGTGAGAGAAAGGAAGAAGG - Intergenic
966188518 3:177249442-177249464 AGGTGTGAGCAGAAGCAACACGG - Intergenic
966365716 3:179185360-179185382 GTGTGAGAGCAGAGGAAAAATGG - Intronic
966457286 3:180131919-180131941 TGGTGATGGCAGAGGGAAGAAGG + Intergenic
966468209 3:180256232-180256254 TGAGGTGAGGAGAGGGAAGAGGG + Intergenic
966636914 3:182145286-182145308 GGAGGTTAGGAGAGGGAAGAAGG - Intergenic
967195520 3:187022305-187022327 GTGTGAGAGCAGAGGAAAGATGG + Intronic
967249570 3:187523028-187523050 GGGAGAGAGGAGAGGAAAGAAGG - Intergenic
967947897 3:194818587-194818609 GTGGGTGAGGAGAGGGGAGAGGG - Intergenic
968248131 3:197176224-197176246 GTGTGTGAGCAGGGGGCATATGG - Intronic
968581450 4:1397193-1397215 GGAGGTGAGCACAGGGAGGAAGG - Intergenic
968663700 4:1809655-1809677 GGAGGAGAGCAGAGGGAGGACGG - Intergenic
968887348 4:3341656-3341678 GGGTGTGGGGGGAGGGGAGATGG + Intronic
969061110 4:4435908-4435930 GGTTGGGAGCGGAGGGGAGAGGG + Intronic
969203644 4:5625213-5625235 TGGAGTGTGCAGAGGGACGAGGG - Intronic
969212603 4:5699195-5699217 AGGTGTGGGAAGAGGGAAAATGG + Intronic
969307737 4:6335463-6335485 AGGAGTGAGCAGGGGGAACAGGG + Intronic
969526052 4:7704648-7704670 GGGGCTGAGCAGAAGGAAGCCGG - Intronic
969586461 4:8097005-8097027 GGGAGGGAGCAGGAGGAAGAAGG + Intronic
969591816 4:8126438-8126460 GGGAGTGAGATGAGGGGAGAGGG - Intronic
970016601 4:11519189-11519211 GGGTGAGAGCAGAGACAATAGGG - Intergenic
970066673 4:12102809-12102831 GAGTGTGAGAAAAGGGAAAATGG - Intergenic
971309741 4:25515051-25515073 GGAGGAGAGCAGAGGGAAGCGGG + Intergenic
971400859 4:26274175-26274197 GGGTGTGAGCATGGGGCAGATGG - Intronic
972746345 4:41935782-41935804 AGGTGGGAGAAGAGGAAAGAAGG - Intronic
973754900 4:54064769-54064791 GGGTAGAAGCAGAGGAAAGACGG - Intronic
973760386 4:54109671-54109693 GGGTGGACGCAGAGGGAGGAAGG + Intronic
974159852 4:58124536-58124558 GGGTGGGAGGAGAGAAAAGATGG + Intergenic
975147062 4:70980143-70980165 GAGTGTGTACAGGGGGAAGATGG - Intronic
975156489 4:71078651-71078673 GAGTATGAGCTGAGCGAAGAAGG - Intergenic
975177188 4:71301412-71301434 CGGAGTTAGGAGAGGGAAGAAGG + Intronic
976478329 4:85510572-85510594 GGGAGAGAGGGGAGGGAAGAAGG - Intronic
976681137 4:87757427-87757449 GAGTGTGAGGAGAAGGAAAAGGG + Intergenic
978198924 4:106002058-106002080 GGTTGTGAGGAGAGGGCATATGG + Intronic
979145125 4:117237298-117237320 GGGTGTAATCAGAGGGTACACGG + Intergenic
979543260 4:121910671-121910693 GGGGGTGAGGAGAAGAAAGAAGG + Intronic
980084594 4:128378233-128378255 AGGAGAGAGAAGAGGGAAGAAGG + Intergenic
981931404 4:150192756-150192778 AGTTGTTAGGAGAGGGAAGAAGG + Intronic
982717447 4:158823879-158823901 GACTGAGAGTAGAGGGAAGATGG + Intronic
983535156 4:168849875-168849897 GGGGGTGAGAAGAGGGAATGGGG - Intronic
984710651 4:182881331-182881353 GGGTGGGAGCAGGGAGGAGAGGG - Intergenic
984918417 4:184743482-184743504 AGGGGAGGGCAGAGGGAAGAGGG + Intergenic
984924140 4:184791811-184791833 GGGTGTAAGCAGAAAGAAGGAGG + Intronic
984998937 4:185465890-185465912 TGGTGAGAGCAGATGGATGAGGG + Intronic
985549528 5:525907-525929 GGGTGGGTGCAGATGGAGGATGG + Intergenic
985658074 5:1142343-1142365 GGGAGAGGGGAGAGGGAAGAGGG - Intergenic
985909738 5:2869498-2869520 GGATGTGTGCTGAGGGAAGATGG + Intergenic
986581459 5:9270701-9270723 GGGTGGGGGCAGGGGGAGGAGGG + Intronic
986670571 5:10139530-10139552 GGTGGAGAGCAGAGGGAGGAAGG + Intergenic
987299624 5:16585806-16585828 TGGTGGGAGCAGTGGCAAGAGGG + Intronic
988018742 5:25596286-25596308 AGGGGTGAGCTGAGAGAAGATGG + Intergenic
988963362 5:36391424-36391446 GTGCGTGAGGAGAGGGAAAAAGG + Intergenic
989608833 5:43272433-43272455 GGCTGAGAGCAGAATGAAGAAGG - Intronic
989634679 5:43521480-43521502 GGGAGAGGGGAGAGGGAAGAGGG - Intergenic
990257410 5:53985219-53985241 GAGTGTGAGCAGAGGGAGTGAGG - Intronic
990446201 5:55896608-55896630 GGGAGTGGGCAGGGGGAAGGTGG - Intronic
990539366 5:56757114-56757136 GGCTGTGAGGGGAAGGAAGAGGG - Intergenic
990849144 5:60181995-60182017 AGGCATTAGCAGAGGGAAGAAGG + Intronic
990943871 5:61230152-61230174 GGGTGAGAGGAGAGGGGAGAGGG - Intergenic
990972089 5:61519320-61519342 TGGTGTAAGCACAGGGAAAAAGG - Intronic
991262732 5:64684595-64684617 GGATGTGGGGAGAGTGAAGAGGG - Intergenic
991574686 5:68090667-68090689 GGGGGTGGGCAGAGGGCACATGG - Intergenic
992376186 5:76190044-76190066 TGGTGGAAGCAGAAGGAAGATGG + Intronic
994133211 5:96255111-96255133 GGGGGTTGGCAGGGGGAAGAAGG + Intergenic
994305044 5:98192876-98192898 GAGTGTGAGCAGAGAGCAAAGGG + Intergenic
994439540 5:99784931-99784953 GTGTGAGAGCAGAGGAAACATGG - Intergenic
995050356 5:107696488-107696510 TGGAGAGAGAAGAGGGAAGAAGG + Intergenic
995369053 5:111398097-111398119 GGAAGAGAGCAGAGGGAAGCAGG - Intronic
995855140 5:116584006-116584028 AGGTCTGAGCAGACGGAAGGAGG - Intergenic
996075221 5:119185102-119185124 AGGTGAAAGCAGAGGAAAGAAGG - Intronic
996613740 5:125414859-125414881 GGATGTGAGAAAATGGAAGATGG + Intergenic
997415768 5:133727453-133727475 AGGTGTGCCCAGTGGGAAGATGG - Intergenic
997983275 5:138483730-138483752 GGGGGTGAGGGTAGGGAAGAGGG - Intergenic
998170340 5:139868860-139868882 GGGTAGGGGCAGAGGGATGAGGG + Intronic
998216749 5:140243281-140243303 TGGAGGGAGAAGAGGGAAGAGGG - Intronic
998392673 5:141797425-141797447 GGGTGTGAGAAGAAGCAGGAGGG - Intergenic
998889948 5:146735339-146735361 GGGTGGGAGAAGAGAGTAGAAGG - Intronic
999307118 5:150526846-150526868 GGCTGTGAGCCTAAGGAAGAGGG + Intronic
999521728 5:152357856-152357878 TGGTGTGTGCAGATGGCAGATGG - Intergenic
1000041250 5:157486682-157486704 GAGTGCCAGCAGAGGGAGGAGGG - Intronic
1000243949 5:159433563-159433585 GAGTGTGACCTTAGGGAAGAAGG + Intergenic
1000346958 5:160322258-160322280 GGTTGGGAAAAGAGGGAAGAGGG - Intronic
1001314558 5:170633079-170633101 GGGGGAGAGCAGAGGGAAGGGGG + Intronic
1001682490 5:173569267-173569289 GGGAGGGGGTAGAGGGAAGAAGG + Intergenic
1001801502 5:174548234-174548256 GAGGGTGAGGAGAAGGAAGAAGG - Intergenic
1002002555 5:176206272-176206294 TGGTGAAAGCAGAAGGAAGAGGG + Intergenic
1002426912 5:179181978-179182000 GGGTGTGTGCGGTGGGAAGCTGG - Intronic
1002434368 5:179221861-179221883 GGGCTGGAGCAGAGGGAAGGAGG - Intronic
1002561883 5:180088226-180088248 GCGTGGGAGCAGAGGAAAAACGG - Intergenic
1002985069 6:2181773-2181795 AGGCCTGAGGAGAGGGAAGAGGG - Intronic
1003064864 6:2895257-2895279 GTGGGTGAGGAGAGGGAGGAGGG + Intronic
1003231391 6:4256832-4256854 GAGTTTGAACAGAGGAAAGACGG + Intergenic
1004415221 6:15417146-15417168 GTGGGTGAGTAGGGGGAAGAGGG + Intronic
1004743448 6:18486508-18486530 ATGTGTTAGAAGAGGGAAGATGG + Intergenic
1004903003 6:20211185-20211207 GGGTGTGCGCAAAGGGCAGCAGG + Intronic
1005421375 6:25654878-25654900 TGGTCTGACCAGAGGAAAGAAGG - Intronic
1005699160 6:28382827-28382849 GGGGGGGAGCCAAGGGAAGAGGG - Intronic
1005879315 6:30043034-30043056 GTGTGTGGGGACAGGGAAGATGG + Intergenic
1005994482 6:30922998-30923020 CGGGGTGAGCAGAGGGCAGCGGG + Intronic
1006082637 6:31576228-31576250 GGGTGTGAGAAGAGAGATGGGGG + Intronic
1006266649 6:32931345-32931367 GCCTAAGAGCAGAGGGAAGAGGG + Intergenic
1006295324 6:33167577-33167599 GGGTGTGGGCAGGGGGCAGAGGG + Intronic
1006297792 6:33177721-33177743 GGGTGTGAGCAGCCTGAAGGTGG + Intronic
1006934059 6:37705344-37705366 GGGTGTGAGGAGAAAGGAGAAGG + Intergenic
1007018198 6:38490723-38490745 GTCAGTGAGAAGAGGGAAGAAGG + Intronic
1007120659 6:39377908-39377930 GGCAGTGAGAAGAGGGAGGAGGG + Intronic
1007363773 6:41375835-41375857 GGGTGTGAGATGAGGGAAGTTGG + Intergenic
1007502835 6:42311803-42311825 GGTTGTGAGCAGAGGAGAGATGG + Intronic
1007530199 6:42535352-42535374 AGGTCTGAGAAGAGGAAAGAAGG - Intergenic
1007749390 6:44062853-44062875 GGGAGAGGGCAGAGGCAAGATGG - Intergenic
1007798906 6:44375307-44375329 GGGTCTGAGCAGCAAGAAGAGGG + Intronic
1007962204 6:45970069-45970091 GGGGGTGAGGAGAGGGAGGAAGG - Intronic
1008042974 6:46821472-46821494 GTGTGTGTGTAGAAGGAAGAAGG + Intronic
1008505564 6:52226433-52226455 AGGTGAGAGCTGAGGAAAGATGG + Intergenic
1010363211 6:75018868-75018890 GGGAGTGAGGAGAGGGAGGCAGG - Intergenic
1011075074 6:83430711-83430733 TGGTGTGGGCAGAAGGAAGAAGG - Intronic
1011357984 6:86492260-86492282 TGGGGTGGGGAGAGGGAAGAGGG - Intergenic
1011394435 6:86891462-86891484 GGGTGGGGGCTGGGGGAAGAGGG + Intergenic
1011547686 6:88499222-88499244 GGGTCTGGGCAGAGGGAGCAGGG + Intergenic
1011726853 6:90218464-90218486 GGGTGGGGGAAGAGGAAAGAGGG - Intronic
1011753117 6:90473103-90473125 TGGGCTGAGCAGAAGGAAGAGGG - Intergenic
1011784007 6:90824054-90824076 GGCTGTGGGGAGAGGTAAGAAGG - Intergenic
1012581751 6:100878757-100878779 GTGTGAGAGCAGAGGAAAAACGG - Intronic
1012601454 6:101102590-101102612 GGGTGGGAACAGAGTGAAGCTGG - Intergenic
1012617674 6:101297006-101297028 GGGTATGAGCAGATGAAAAATGG + Intergenic
1012687094 6:102265688-102265710 GGCTGAGGACAGAGGGAAGATGG - Intergenic
1012858417 6:104529531-104529553 GGTTGAGAGCAGATGGCAGAGGG - Intergenic
1012961857 6:105630517-105630539 GGATGTGGGGTGAGGGAAGAAGG + Intergenic
1014045702 6:116883347-116883369 GAGTGGTAGAAGAGGGAAGAGGG - Intronic
1014243056 6:119039610-119039632 GGGGTTGAGGAGAGGGAGGAAGG + Intronic
1015465342 6:133542806-133542828 GTGTGTGTGCAGAGGAAGGAGGG + Intergenic
1015485628 6:133766797-133766819 GAGTGTAAGAAGAGGGAAAAAGG + Intergenic
1015619696 6:135118302-135118324 TGGTGAGAGCAGAGGGTGGAGGG - Intergenic
1015816781 6:137219270-137219292 GGGTGTGAGCAGGGCTGAGATGG - Exonic
1015925643 6:138307986-138308008 GGGCGAGAGCACAGGGAAGCTGG - Intronic
1016134235 6:140519403-140519425 GGGTCTGAGAAGAGGGGAAATGG + Intergenic
1016308988 6:142713527-142713549 GGCTGTGAGAAGAAGCAAGAGGG - Intergenic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1016923391 6:149317637-149317659 GGGTGGGGGCAGAGGGAGGTGGG + Intronic
1017062116 6:150493564-150493586 GTGTGTGTGTAGAGGGGAGAGGG + Intergenic
1017256578 6:152340282-152340304 AGGTGTGAGCAGAGGTCGGAGGG + Intronic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018007085 6:159632291-159632313 TGATGTGATCAGAGGGAGGACGG - Intergenic
1018399778 6:163411414-163411436 TGGGGTAAGCAGATGGAAGAAGG + Intergenic
1018652492 6:166003730-166003752 GGCTGTGAGCAGAGGAATGCAGG + Intergenic
1018793903 6:167171453-167171475 GGGTGTGAGCAGATGTGAGCAGG - Intronic
1018822432 6:167383638-167383660 GGGTGTGAGCAGATGTGAGCAGG + Intronic
1019018766 6:168900484-168900506 AGGGGTGAGAAGAGGGAAGCAGG + Intergenic
1019018815 6:168900664-168900686 AGGAGTGAGAAGAGGGAAGCAGG + Intergenic
1019059098 6:169242836-169242858 AGGTGGGAGCAGTGGGAAGGTGG - Intronic
1019059137 6:169242952-169242974 AGGTGGGAGCAGTGGGAAGGTGG - Intronic
1019059177 6:169243075-169243097 AGGTGGGAGCAGTGGGAAGGTGG - Intronic
1019275219 7:172593-172615 GGGAGTGAGGAGAGGGATGCGGG + Intergenic
1019427455 7:984303-984325 GGGTGGGGACAGAGGGAAAATGG - Intronic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1019480692 7:1265349-1265371 GGCTGGGAGCAGAGGGAGGGGGG + Intergenic
1019508412 7:1404943-1404965 GAGAGGGAGGAGAGGGAAGAGGG + Intergenic
1019803329 7:3104704-3104726 GGGTTGGAGGAGTGGGAAGAAGG + Intergenic
1019805079 7:3117685-3117707 GGGGGAGAAGAGAGGGAAGAAGG + Intergenic
1020107354 7:5428265-5428287 CGGCGTGAGCAGCGGGAAGGAGG - Intergenic
1020727409 7:11832378-11832400 GGGGGCGAGCAAAGGGGAGAGGG + Intergenic
1020967617 7:14891618-14891640 GGTTGTGAGTAGAGAGAAGTAGG + Intronic
1022010521 7:26304527-26304549 GGGTGTGGGCAGATGGGAGAGGG + Intronic
1022473427 7:30695178-30695200 GGGTGTCAGATGAGGGAAGTGGG + Intronic
1022625269 7:32029571-32029593 GGGTGGGAGGAGAGGAAAGAAGG + Intronic
1022695841 7:32704715-32704737 GGGGGTTGGCAGAGGGCAGAGGG + Intergenic
1023305108 7:38817816-38817838 GTTTGTGACCGGAGGGAAGAAGG - Exonic
1023447919 7:40251222-40251244 GGAAGTGAAGAGAGGGAAGATGG - Intronic
1023878683 7:44306727-44306749 GGGTGTGGGCAGGAGGAGGAGGG + Intronic
1023878719 7:44306845-44306867 GGGTGTGAGCAGGGGAAGGAAGG + Intronic
1023878724 7:44306865-44306887 AGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1023878754 7:44306982-44307004 GGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878757 7:44307002-44307024 GGGTGTGAGCAGGAAGAAGAGGG + Intronic
1023878769 7:44307042-44307064 GGCGGTGAGCAGGGGGAGGAGGG + Intronic
1023878776 7:44307062-44307084 GGGTCTGAGCAGGGGGAGGAGGG + Intronic
1023878793 7:44307119-44307141 GGGTGTGAGCAGGGGGAGGAGGG + Intronic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878806 7:44307179-44307201 GGGTGTGAGCAGAGAGAGGAGGG + Intronic
1023878816 7:44307216-44307238 GGGTATGAGCAAGGGGAGGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878826 7:44307256-44307278 GGGTGTGAGCAAGGGGAGGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878835 7:44307296-44307318 GGGTGTGAGCAGGCGGAGGAGGG + Intronic
1023878856 7:44307376-44307398 GGGTGTGAGCAGGGAGAAGAGGG + Intronic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1023878869 7:44307416-44307438 GGGTGTGATCAGGGGGAGGAGGG + Intronic
1024757451 7:52552291-52552313 GAGTGAGAGCTGAGCGAAGAGGG - Intergenic
1025152906 7:56574428-56574450 TGGTGTGCGAAGGGGGAAGAGGG - Intergenic
1025796214 7:64739617-64739639 GGGAGAGGGGAGAGGGAAGAGGG + Intergenic
1025796216 7:64739624-64739646 GGGAGAGGGAAGAGGGAAGAGGG + Intergenic
1026602468 7:71787920-71787942 AGGTGTGGGAAGAAGGAAGAGGG + Intronic
1026984442 7:74546100-74546122 GGGTGAGGGCGGAGGGATGAGGG - Intronic
1027238777 7:76314046-76314068 GGGTGGGAGCTCAGGGAAGACGG - Intergenic
1027441591 7:78224968-78224990 TGAGGTGAGCAGAGGGAAGGCGG - Intronic
1027659252 7:80969312-80969334 GGGTTTGGGCAGGGGGAAGGAGG + Intergenic
1027806349 7:82829309-82829331 GGGAGTAAGCAGGGGCAAGAGGG - Intronic
1028202770 7:87981533-87981555 TGGTGTGGGGATAGGGAAGAGGG + Intronic
1028746894 7:94337491-94337513 GGGTTTGAGCACAGAGCAGATGG - Intergenic
1028892881 7:96008307-96008329 GGGAGAGAGCAGAGGGAAGGGGG + Intronic
1029129221 7:98317584-98317606 CGGTGTGAACTGAGGGATGAGGG - Intronic
1029139765 7:98401248-98401270 GGGCGTGGCCAGAGGGAAGCGGG + Intergenic
1029248707 7:99220855-99220877 GGGGGAAAGGAGAGGGAAGAAGG + Intergenic
1029504067 7:100951512-100951534 GGGTGTGACCAGAGGAGGGAAGG + Intronic
1029619763 7:101682838-101682860 ATGTGTGAGCATAGGGATGATGG - Intergenic
1030288116 7:107847510-107847532 GGGAGTGGGGAGAGGGGAGAGGG - Intergenic
1030529453 7:110695051-110695073 GGGTGTGAGGATAGGGAAATGGG + Intronic
1032155173 7:129462130-129462152 TGGTTTGAGGAGAGAGAAGATGG + Intronic
1032530511 7:132615854-132615876 GGGAGAGAGGAGAGGGGAGAGGG - Intronic
1032880438 7:136084374-136084396 GGGTGAGAGCTGTGGGGAGAAGG - Intergenic
1032928414 7:136636803-136636825 GGGTGAGGGGAGAGGGGAGAGGG + Intergenic
1032961682 7:137042489-137042511 GAGAGAGAGAAGAGGGAAGAGGG - Intergenic
1033200443 7:139363658-139363680 AGTTGTTAGCAGAGGGGAGAGGG + Intronic
1033208872 7:139445542-139445564 GGGAGTGAGTCCAGGGAAGAAGG + Intergenic
1033223293 7:139542892-139542914 GGAAGTGTGCAGAGGGAAGTGGG + Intronic
1033792620 7:144809533-144809555 GTGTATGAGCAGAGAGATGATGG - Intronic
1034348532 7:150401939-150401961 GGTGGTGAGCAGAGGGGAGAAGG - Intronic
1034422116 7:150995768-150995790 GGGTCGGGGCAGAGGGAGGAGGG - Intronic
1034422210 7:150995997-150996019 GGATGGGAGCAGAGGGAGGAGGG - Intronic
1034422223 7:150996031-150996053 GGGTAGGGGCAGAGGGAGGAGGG - Intronic
1034422249 7:150996097-150996119 GGGTAGGGGCAGAGGGAGGAGGG - Intronic
1034471798 7:151258709-151258731 AGGTGAGAGCAGAGGGGACAGGG - Intronic
1034499581 7:151440831-151440853 TGGAGTGAGCAGAGCGAACATGG + Intergenic
1034633936 7:152552475-152552497 GGGGGTGAGCAAGAGGAAGAAGG + Intergenic
1035171036 7:157017713-157017735 GGGTGGGAGCAGAGGGCTGGAGG - Intergenic
1035341613 7:158166264-158166286 GGGTGTGAGGACAGGGAACGCGG - Intronic
1035341630 7:158166317-158166339 GGGTGTGAGGACAGGGAACGCGG - Intronic
1035341643 7:158166369-158166391 GGGTGTGAGGACAGGGAACGCGG - Intronic
1035341659 7:158166421-158166443 GGGTGTGAGGACAGGGAACGCGG - Intronic
1035341687 7:158166524-158166546 GGGTGTGAGGACAGGGAACGCGG - Intronic
1035341702 7:158166576-158166598 GGGTGTGAGGACAGGGAACGCGG - Intronic
1035768424 8:2127121-2127143 GAATTTGAGCAGAGGGAAGGGGG + Intronic
1035836160 8:2754410-2754432 GGGTGGGGCCAGAGGGTAGATGG + Intergenic
1035850635 8:2915819-2915841 GGGTAGGAGGAGAGAGAAGAAGG + Intergenic
1036426485 8:8649635-8649657 GGGTGTGAGAAAGGGGAAGAGGG - Intergenic
1036481893 8:9147385-9147407 GGGTGTGAACTGAGGGAGGAAGG + Intronic
1036505376 8:9350022-9350044 GGGTGGGAGAGGAGAGAAGAGGG + Intergenic
1038229337 8:25685836-25685858 GGGGGTGAGAAGTGGGAAGAGGG + Intergenic
1038287108 8:26215191-26215213 GGGTTAGAGAAGAAGGAAGAAGG + Intergenic
1038337904 8:26660220-26660242 GGGTGTGAGCAAAGGGGACAGGG + Intergenic
1038574791 8:28695714-28695736 GGCTGGGACCAGAGGGAAGGAGG + Intronic
1039133076 8:34289945-34289967 GGGTGAGTGCAGAGGGAGGGAGG + Intergenic
1039254968 8:35709106-35709128 GGGTTTGAGCAGAGTGGAGATGG - Intronic
1039468076 8:37797601-37797623 GGGTGGGAGCAGGGGGAAGGGGG + Intronic
1039839694 8:41284916-41284938 GTGTCTGACCTGAGGGAAGAAGG - Intronic
1040626605 8:49157155-49157177 AGGAGTGAGCAGGGAGAAGATGG - Intergenic
1040831466 8:51681596-51681618 GGGTGGGAGGAGAGGGCAGCAGG - Intronic
1041170494 8:55137231-55137253 GGATGTGAGTAGAGAGAGGAGGG + Intronic
1041172288 8:55156419-55156441 GGGGGTGGGGAGAGGGAGGAAGG + Intronic
1041330480 8:56719109-56719131 GGGCAGGAGGAGAGGGAAGAGGG - Intergenic
1041340982 8:56845107-56845129 GGGAGTGAGCAGATGGGAGAGGG + Intergenic
1041639747 8:60184467-60184489 GGCTGGGAGCTGAGGGAAGAGGG - Intergenic
1041718993 8:60959497-60959519 GGGTGAGAGAAGAAGGAAGGTGG - Intergenic
1041871605 8:62640614-62640636 GGGTCAGGGCAGAGGAAAGAAGG - Intronic
1042156382 8:65848705-65848727 GGGCGTCAACAGAGGGGAGAGGG + Intergenic
1042176516 8:66042677-66042699 GGGGGAGAGAGGAGGGAAGAGGG - Intronic
1042435893 8:68764170-68764192 GGGTGTGAGGAGAGGGGACAGGG + Intronic
1042852289 8:73227832-73227854 GGGTAGGACCAGATGGAAGAAGG - Intergenic
1043246681 8:78012092-78012114 GGGTTTTATCAGAGGGAAGCAGG + Intergenic
1043469157 8:80544835-80544857 GAAAGTGAGCAGAGGGAAGCTGG + Intergenic
1045259198 8:100557552-100557574 GGTTTTGAGCAGAGGAATGAGGG - Intronic
1045327546 8:101127799-101127821 GTGTGGGAGCAGAGGGATGGGGG + Intergenic
1046013224 8:108575251-108575273 GGTGGTGAGCAGAGGCAAGAAGG + Intergenic
1046131781 8:109975062-109975084 GGGTGTGAGCAGGTGGGGGAGGG + Exonic
1046897708 8:119490774-119490796 GGGTGGGTGGAGAGGTAAGAAGG - Intergenic
1047158288 8:122347037-122347059 GGCTGGGAGGAGAGGAAAGAGGG + Intergenic
1047192054 8:122687139-122687161 GCGTTTAAGTAGAGGGAAGAAGG - Intergenic
1047462894 8:125085733-125085755 AGGGGTGAGCAGATGGTAGAAGG + Intronic
1047647686 8:126886163-126886185 GTGTTTAAGAAGAGGGAAGAAGG - Intergenic
1047682072 8:127264510-127264532 TGGTGGGAGCAGGAGGAAGAGGG + Intergenic
1047737554 8:127779869-127779891 GGGACTGAGGAGAGGGAAAATGG + Intergenic
1047986774 8:130243554-130243576 GTGTGGGAACAGAGGGGAGAGGG - Intronic
1048048702 8:130796939-130796961 GGGTGTTTGCAGAGGGAAGTTGG - Intronic
1048065721 8:130966428-130966450 GGTTAGGTGCAGAGGGAAGAAGG + Intronic
1048148183 8:131866004-131866026 GGGTGTGAGGAAAGAGAAGATGG - Intergenic
1048436511 8:134423465-134423487 AGGTTTGAACAGAGGTAAGAGGG - Intergenic
1048754531 8:137722308-137722330 GTGTGTGGGCAGAGGGCATATGG + Intergenic
1048779351 8:137984679-137984701 TGGTGTGGGCAGAGAGAAAAGGG - Intergenic
1048861410 8:138726938-138726960 TGGGGTGACCAGAGGGAGGAAGG + Intronic
1048871938 8:138806392-138806414 GGGTGTGAGATGAGGGAGGGAGG + Intronic
1049249756 8:141581988-141582010 GGCTGAGATCAGAGGGCAGAGGG + Intergenic
1050119074 9:2289377-2289399 GGGCATCAGCAGAGGGAAGCAGG + Intergenic
1051733716 9:20175960-20175982 GGGTGTGAGCTGAGCTAGGAAGG + Intergenic
1051895152 9:21978774-21978796 GGGTGGGGGCAGAGGGGAGTAGG + Intronic
1052463502 9:28798561-28798583 TGGTTTGAGAAGAGGGAGGAAGG + Intergenic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1052973873 9:34398143-34398165 GGGTGTGGGCAAGGGGCAGATGG - Intergenic
1052988896 9:34507011-34507033 GGGTGTCAGAAAAGGGCAGAAGG + Intronic
1053462584 9:38282021-38282043 GAGGCTGAGCAGAGGGCAGAGGG + Intergenic
1054918900 9:70522346-70522368 GTGTGAGAGCAGAGGAAAAATGG - Intergenic
1055398607 9:75899530-75899552 CGGGGTGAGGAGAGGGAGGAGGG - Intronic
1055408997 9:76007557-76007579 GGGTGTGAGAGGAGGGTAGATGG + Intronic
1056409411 9:86311583-86311605 GGGAGAGGGGAGAGGGAAGAGGG - Intronic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1056544249 9:87600830-87600852 GGGTGTGAGGAGGGGGCAGAAGG + Intronic
1056688535 9:88786323-88786345 GGGAGTGGGCAGAGGGGAAACGG + Intergenic
1056709879 9:88983840-88983862 GGGGGTGGGGAGAGGGGAGAGGG - Intergenic
1057369441 9:94456935-94456957 GGGTGGGAAAAGAGGGAAGAAGG - Intronic
1057588810 9:96353752-96353774 GGGTGTTAGGAGTGGGTAGAAGG - Intronic
1057909425 9:99006074-99006096 GGTTCTCAGCAGAGAGAAGAGGG - Intronic
1057912794 9:99033389-99033411 GGGTGGGAGGGGAGGGGAGATGG + Intronic
1057931312 9:99195955-99195977 GAGGAAGAGCAGAGGGAAGAGGG - Intergenic
1058014002 9:100009467-100009489 GGGGGTGGGGAGAGGGGAGATGG - Intronic
1058536268 9:105963490-105963512 GGGTGGGATCAGAGGGGAAAAGG - Intergenic
1058750478 9:108034260-108034282 GGATGGGGGCAGAGGGTAGAAGG - Intergenic
1058804526 9:108578032-108578054 GCGTGTGAGCAGAGAGAGAAGGG - Intergenic
1059424865 9:114214700-114214722 AGATGGGAGCAGAGAGAAGAGGG - Intronic
1059772510 9:117440908-117440930 GGGTTTGAGTAAATGGAAGACGG + Intergenic
1060197207 9:121631478-121631500 GGGAGAGAGCAGAGGGAGGTGGG + Intronic
1060205346 9:121679654-121679676 GTGTGCAAGCAGAGGAAAGAAGG + Intronic
1060206040 9:121683376-121683398 GGGTGGGGGCAGAGGAAGGAGGG - Intronic
1060471388 9:123951447-123951469 TGGTGGGAGCAGAGGGAATGAGG + Intergenic
1061007464 9:127936306-127936328 AGGTGTGAGCAGAGTGATGATGG + Intronic
1061131866 9:128712994-128713016 TGGTGGTAGCAGTGGGAAGATGG + Intronic
1061278825 9:129585391-129585413 GGGAGGGAGGGGAGGGAAGAAGG + Intergenic
1061390605 9:130315315-130315337 GGGGGAGGGCAGAGGGAGGAGGG - Intronic
1062179581 9:135184073-135184095 GGCTGTGAGCAGAAGGGAGGAGG + Intergenic
1062713441 9:137989300-137989322 GGGTGTGATCAGAGAGAGTATGG + Intronic
1203742538 Un_GL000218v1:14717-14739 GAATGTGGGCAGAGGGTAGAGGG + Intergenic
1185559376 X:1047524-1047546 TTATGTGAGCAGAAGGAAGATGG - Intergenic
1185566595 X:1099686-1099708 GGGTGTGGGCAGAGGGCAGGAGG + Intergenic
1185647993 X:1628707-1628729 GGGAGAGAGGAGGGGGAAGATGG - Intronic
1185734301 X:2485626-2485648 GGGAGGGAGGAGAGGGAAGGAGG + Intronic
1185775407 X:2799224-2799246 GGGTGGGAGTAGAGTGAGGATGG - Intronic
1185991861 X:4900495-4900517 GGATGTGAGAAGAGTGAAAAAGG - Intergenic
1186497840 X:10026034-10026056 GGGTGTAGGGAGAAGGAAGAGGG - Intronic
1186641779 X:11463243-11463265 GGGCGTGTGGAGAGGGAGGATGG + Intronic
1186659193 X:11651280-11651302 GAGGGTGAGCAGTGGGAGGAGGG - Intronic
1186688623 X:11951591-11951613 GAGGGTGAGCAGTGGGAGGAGGG + Intergenic
1187030186 X:15478777-15478799 AAGTGTGAGCAGAAGGCAGAGGG - Intronic
1187401051 X:18960502-18960524 TGGTGAGAGCAGAAGCAAGAGGG + Intronic
1187504438 X:19867315-19867337 GGGAGGGAGGAAAGGGAAGAGGG + Intronic
1187812962 X:23200424-23200446 GGGTGTGAGTACAGGGGAGCAGG - Intergenic
1187904633 X:24054565-24054587 GGGTGTGGGAACAGAGAAGAGGG - Intergenic
1188969135 X:36591693-36591715 GGGTCTTATCAGAGGGTAGAAGG - Intergenic
1189088400 X:38051194-38051216 GGAGATGACCAGAGGGAAGAGGG + Intronic
1189158980 X:38791134-38791156 GAATGTGAGCAGAGAGAAGATGG - Intergenic
1189654396 X:43226842-43226864 GGGTGTAAGTAGAGGGAAATTGG + Intergenic
1189938872 X:46099801-46099823 GGGTCTGATTAGAGGGTAGAGGG - Intergenic
1190107414 X:47570214-47570236 GGATGTGAGAAGAGGGAAGTTGG - Intronic
1190237505 X:48628311-48628333 GGGTGGAGGGAGAGGGAAGAAGG + Intergenic
1190285768 X:48960417-48960439 GGCTGTGAGGAGAGGAAGGATGG - Intergenic
1190466662 X:50731365-50731387 GGCTGGGAGCTGAGGGGAGAAGG - Intronic
1191663838 X:63677660-63677682 GGGTGAGAGGAGAGGGAATCAGG + Intronic
1191745894 X:64486053-64486075 TGGGGTGAGGGGAGGGAAGAGGG + Intergenic
1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG + Intergenic
1192008925 X:67247411-67247433 TGGTGTGGGCAGATGGAAAAGGG + Intergenic
1192199895 X:69060226-69060248 GGGGCTTAGCAGAGGGAAGGGGG + Intergenic
1192256829 X:69468544-69468566 GAGTGTGAGCAGTGGGGCGAGGG + Intergenic
1192430479 X:71108180-71108202 GGGTGGGGGCAGAGAGGAGAGGG - Intronic
1193727237 X:85056899-85056921 GGGAGTTAGAAGTGGGAAGAAGG - Intronic
1193889215 X:87022509-87022531 AGGAGAGAGCAGAGGGAAGGAGG + Intergenic
1194098356 X:89671995-89672017 GGGAGTGAGGAGAGGGAACGCGG - Intergenic
1195097105 X:101513701-101513723 TGCTGAGAGCAGAGGGAATATGG - Intronic
1195688159 X:107603618-107603640 TGCTGTGAGCAGAGTGAAGAGGG - Exonic
1196814791 X:119656472-119656494 AGGTTTGAGCAATGGGAAGACGG + Intronic
1196980864 X:121212146-121212168 GGGCAAGAGCAAAGGGAAGAAGG - Intergenic
1197640655 X:128964262-128964284 AGGAGTGAGGGGAGGGAAGAGGG + Intergenic
1197654720 X:129104619-129104641 GGGAGTGAGCAGCAGAAAGAAGG - Intergenic
1197865758 X:131014984-131015006 GTGTGGGAGCAGAGGGTATATGG - Intergenic
1198013670 X:132586685-132586707 GGTTGTGAGGAGAGGAGAGAGGG + Intergenic
1198574401 X:137994169-137994191 GGTTATAAGCAGGGGGAAGAGGG + Intergenic
1198727621 X:139693094-139693116 GGGACTGGGCCGAGGGAAGATGG + Intronic
1198801010 X:140447762-140447784 GGGTGTGAGGTGGGGGATGAGGG - Intergenic
1199895817 X:152127290-152127312 GGGTATGGAGAGAGGGAAGAGGG - Intergenic
1201146591 Y:11068046-11068068 GGGAGGGAGAAGAAGGAAGAGGG + Intergenic