ID: 1023878862

View in Genome Browser
Species Human (GRCh38)
Location 7:44307396-44307418
Sequence GGGGGTAAGCAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1316
Summary {0: 1, 1: 0, 2: 6, 3: 123, 4: 1186}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023878862 Original CRISPR GGGGGTAAGCAGAAGGAGGA GGG Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900344109 1:2203070-2203092 GGAGAAAAGCAGAAGGGGGATGG - Intronic
900641783 1:3691065-3691087 TGGGGTGAGCAGAGGTAGGAAGG + Intronic
900708200 1:4093921-4093943 GCTGGAAAGAAGAAGGAGGAGGG - Intergenic
900791519 1:4684002-4684024 GGGAGGAAGGAGATGGAGGAAGG + Intronic
900977146 1:6025059-6025081 GGGAGAAGGGAGAAGGAGGAAGG - Intronic
901264919 1:7903041-7903063 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264928 1:7903068-7903090 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264937 1:7903095-7903117 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264946 1:7903122-7903144 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264951 1:7903140-7903162 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264960 1:7903167-7903189 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264965 1:7903185-7903207 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264974 1:7903212-7903234 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264983 1:7903239-7903261 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264988 1:7903257-7903279 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264997 1:7903284-7903306 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265006 1:7903311-7903333 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265011 1:7903329-7903351 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
902397484 1:16140249-16140271 GAGGGTCTGCAGAAGCAGGATGG - Intronic
902771456 1:18647495-18647517 GGGGGAGAGGAGAAGGAGGCAGG + Intronic
902797963 1:18811644-18811666 GGGAGAAAGATGAAGGAGGAAGG - Intergenic
903033771 1:20481401-20481423 GGGGGCAGGCAGGAGGAAGAGGG - Intergenic
903207296 1:21792192-21792214 GGGGCTAGACAGAATGAGGATGG - Intergenic
903553935 1:24179798-24179820 AGGGGAAAGCAGGAAGAGGAGGG - Intronic
903655973 1:24948942-24948964 AGGGGCAAGCAGCAGGAGGCAGG - Intronic
903657179 1:24956648-24956670 TGGGGTAAGCAGGGGCAGGAGGG - Intronic
903734746 1:25522965-25522987 GGTGGTAAGAAGAAGGGTGAGGG + Intergenic
903799465 1:25955736-25955758 GAGGGAAGGAAGAAGGAGGAAGG + Intergenic
904265019 1:29313168-29313190 GGGAGAAAGCAGAGAGAGGAGGG - Intronic
904277418 1:29393506-29393528 GGGTGGGAGGAGAAGGAGGAAGG + Intergenic
904295747 1:29518784-29518806 GGAGAAAAGGAGAAGGAGGAAGG - Intergenic
904424995 1:30417374-30417396 GTGGGTCAACAGAATGAGGAAGG + Intergenic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
904941731 1:34168393-34168415 GGGGGCCAGGAGGAGGAGGATGG + Intronic
904948233 1:34214819-34214841 GAGGGTGAGGAGAAGGAGCAGGG + Intronic
904978904 1:34480033-34480055 GGGGCAATGCAGGAGGAGGAGGG + Intergenic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905558707 1:38908948-38908970 TGGGGTAGCCAGAAGGCGGATGG + Intronic
905823760 1:41014339-41014361 GGGGGTGAGCAGCAGGAGTTTGG + Intergenic
905942930 1:41878720-41878742 GGGGGGAAGGAGAGGAAGGAAGG - Intronic
906579634 1:46925692-46925714 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
906604089 1:47153196-47153218 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
906644731 1:47466219-47466241 GGAGGTAAGCAGGGAGAGGAAGG - Intergenic
906653712 1:47533150-47533172 TGGGGGAAGAAGAGGGAGGATGG - Intergenic
906689684 1:47784414-47784436 GGGGCTGGGCAGAGGGAGGAGGG + Intronic
906764803 1:48418856-48418878 GAGGGGAAGGAGAGGGAGGAAGG + Intronic
907307489 1:53521432-53521454 GGGAGTAAGAAGAGGTAGGATGG - Intronic
907376949 1:54052257-54052279 GGGGGGAAGCATAGAGAGGAGGG + Intronic
907569387 1:55468805-55468827 GGGGGTAGAGAGAAGAAGGAAGG + Intergenic
907594224 1:55704785-55704807 GGTGGTAAGCAGAGGCAGGGAGG + Intergenic
907794153 1:57697945-57697967 AGAGGAAAGCACAAGGAGGATGG - Intronic
907799414 1:57750018-57750040 GGGGGTAAGGAAAATAAGGATGG + Intronic
907839820 1:58145932-58145954 GAGGCTGAGGAGAAGGAGGAGGG - Intronic
907921591 1:58919202-58919224 AGGAGTGAGCAGAAGGAGAATGG + Intergenic
908116025 1:60941047-60941069 GGGGGTAGGAAGATGGGGGATGG + Intronic
908309672 1:62867063-62867085 TGGGGTGGGCGGAAGGAGGAGGG - Intergenic
908584706 1:65555007-65555029 GAGGGTGAGCTGAAGCAGGATGG - Intronic
908592788 1:65651826-65651848 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
910330918 1:86071855-86071877 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
910549848 1:88463205-88463227 GGGAGAAAGGAGGAGGAGGAGGG - Intergenic
910630701 1:89350930-89350952 GGAGGAAAGGAGAAGCAGGAGGG - Intergenic
910827916 1:91428731-91428753 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
910855323 1:91689145-91689167 GAGGGTGAGAAGAAGGGGGAAGG - Intronic
911474302 1:98357442-98357464 GAGGGTAAGCAGCAGCAGCATGG - Intergenic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
911632570 1:100199742-100199764 GAGGGCCAGCAGAAGCAGGATGG + Intronic
911995696 1:104763182-104763204 GCGGGTTAGAAGAGGGAGGAAGG - Intergenic
912235253 1:107844165-107844187 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
912385991 1:109271409-109271431 GGCGCTCAGCAGCAGGAGGACGG - Exonic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
912894948 1:113576453-113576475 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
913102815 1:115584819-115584841 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
913223401 1:116677636-116677658 GACGGGCAGCAGAAGGAGGAAGG - Intergenic
913552316 1:119927610-119927632 AGGGGGAAGCAGGAGAAGGAAGG - Intronic
914457972 1:147854715-147854737 GAGGGCAAGCAGAAGCAGGGAGG + Intergenic
914680711 1:149936563-149936585 GGGGGTAAGGAGAAGGAATTTGG - Exonic
914926395 1:151892251-151892273 AGGAGCAAGTAGAAGGAGGAGGG + Intronic
915061443 1:153188947-153188969 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
915164779 1:153942376-153942398 GGGGGTACCCAAAAGGAGCAGGG + Intronic
915493858 1:156267245-156267267 GGCAGTAAGGAGAAGGGGGAAGG + Intronic
915587717 1:156853169-156853191 GGGGGTGAGCAGGAGAAGAAAGG - Intronic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915984337 1:160448749-160448771 GAGGGCAAGGAGGAGGAGGAGGG - Intergenic
916058373 1:161083249-161083271 GGGGGTATGCAGCTGGAGGAGGG - Intronic
916105345 1:161425892-161425914 GGTGGTAAGGAGCAGGAGGGTGG + Intergenic
916260168 1:162833991-162834013 GAGGGTAAGCAGGAGGTGGCAGG + Intronic
916611360 1:166395148-166395170 GGGGGAAAGGGGAAGGAGGAGGG + Intergenic
916731678 1:167572196-167572218 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
917023455 1:170614823-170614845 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
917218854 1:172706241-172706263 GGTGGTAGGGAGGAGGAGGAGGG - Intergenic
917243579 1:172975776-172975798 GGGGGTAAACAAGAGGAGGGTGG - Intergenic
917425202 1:174905988-174906010 GGAGCTAAGCAGAACAAGGAAGG + Intronic
917606151 1:176631951-176631973 GAGTGTAAGCAAAAGGAGAAAGG + Intronic
917817341 1:178724925-178724947 GGGGGGAAGGGGTAGGAGGATGG - Intergenic
918163278 1:181920580-181920602 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
918290150 1:183099587-183099609 GGGGGCAGCCAGAGGGAGGAAGG - Intronic
918448269 1:184635358-184635380 GGGAGAAAGAAGAAGGAGGAAGG - Intergenic
918469910 1:184861515-184861537 GGGGGGAAGAGGAGGGAGGAAGG + Intronic
918515571 1:185359067-185359089 GGGAGTAAGCAGCAGCAGGATGG - Intergenic
918632154 1:186730806-186730828 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919465427 1:197918356-197918378 GGGCATAAGCAATAGGAGGACGG + Intronic
919919532 1:202160033-202160055 GGGGATGGGCAGGAGGAGGAAGG - Intronic
920092426 1:203464124-203464146 GGGAGGAAGGAGGAGGAGGAGGG + Intergenic
920285520 1:204875932-204875954 GGGGAAAAGTGGAAGGAGGAGGG + Intronic
920654256 1:207863978-207864000 GGAGGCCAGCAGCAGGAGGAGGG - Intergenic
920985508 1:210885255-210885277 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
920986149 1:210891390-210891412 TGGGGTGAGGAGAAGGGGGAGGG + Intronic
921283813 1:213591411-213591433 GGTGGGAAACAGAAGGAGAATGG - Intergenic
921461629 1:215433449-215433471 GAGGGCAAGCTGAAGCAGGATGG - Intergenic
921631261 1:217437077-217437099 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
921992508 1:221382771-221382793 GGAGGTAAGCAGAAGGATGTTGG - Intergenic
922066129 1:222145642-222145664 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
922213263 1:223501200-223501222 GAGGGAAAGGAAAAGGAGGAGGG - Intergenic
922715928 1:227872034-227872056 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923334098 1:232951776-232951798 GGGGGTGAGGAGGAGGAGGGTGG + Intronic
923490899 1:234483232-234483254 GGGTGTTAGCAGCAGGAGAAAGG - Intergenic
923534496 1:234838321-234838343 AGGGGAAAGAAGAAGGAAGAAGG + Intergenic
923601693 1:235409241-235409263 ATTGGTAGGCAGAAGGAGGAAGG + Intronic
923853345 1:237820368-237820390 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
924527252 1:244863655-244863677 GGAGGTAAGAAGAAGGCGGAAGG - Exonic
924823188 1:247513807-247513829 GAGGGTGAGCAGAAAGAGGGTGG - Intronic
924883390 1:248187685-248187707 GAGAGTGAGCAGAAGCAGGATGG + Intergenic
1062812525 10:477426-477448 GGGGGGAGGCAGGGGGAGGAAGG + Intronic
1062833630 10:622364-622386 GGGGGAGAGAAGAAGGGGGAGGG + Intronic
1063040923 10:2336478-2336500 GGTGGTAAGCAGATGATGGATGG + Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063316183 10:5008648-5008670 GGAGGAAAGCAGATGGAAGATGG + Intronic
1063654099 10:7969897-7969919 GGGAGGAAGGAGACGGAGGAAGG - Intronic
1063938942 10:11107803-11107825 AGGGGGAAGAAGAGGGAGGAGGG - Intronic
1064011182 10:11737788-11737810 GTGGGTGAGCAGAGGGAGGGAGG - Intergenic
1064960472 10:20958318-20958340 GGGGGCAAGGAGAGGGTGGATGG + Intronic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1066648575 10:37634932-37634954 GAGGGTCAGCAGAAGAATGAGGG + Intergenic
1066993574 10:42540000-42540022 GAGGGTGAGCCGAAGCAGGATGG - Intergenic
1067031449 10:42880618-42880640 GGGGGTCAGCAGAAGAATGAGGG + Intergenic
1067065880 10:43103923-43103945 GGGGGCATGCTGAAGGCGGAAGG - Intronic
1067557812 10:47284871-47284893 GGGAGGAAGAAGGAGGAGGAGGG + Intergenic
1067557818 10:47284891-47284913 GGGAGGAAGAAGGAGGAGGAGGG + Intergenic
1067832305 10:49617177-49617199 GGGGGAAAGGGGAAGGGGGAAGG - Intronic
1067842025 10:49688640-49688662 GAGGATAGGCAGAAGCAGGAGGG - Intronic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068357188 10:55923806-55923828 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1068495306 10:57778992-57779014 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1069120899 10:64567792-64567814 GAGGGTGAGCAGAAGTAGGGAGG - Intergenic
1070213086 10:74347277-74347299 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1070342929 10:75514267-75514289 GGAGGAAGGAAGAAGGAGGAGGG - Intronic
1070349175 10:75575716-75575738 GAGGGTGAGCCGAAGCAGGAGGG + Intronic
1070444615 10:76484153-76484175 GAGAGGAAGAAGAAGGAGGATGG - Intronic
1070628568 10:78068221-78068243 GGGGACAGACAGAAGGAGGATGG + Intergenic
1070736275 10:78865833-78865855 GGGGGAAGGCAGAAGGCTGAGGG - Intergenic
1070763854 10:79045141-79045163 GGCCCTAAGCTGAAGGAGGAGGG + Intergenic
1071024559 10:81097465-81097487 GAGGGAAAGAATAAGGAGGAAGG - Intergenic
1071567484 10:86679324-86679346 GGGGGTGAGCATAAGGAAGGTGG - Intronic
1071684773 10:87743345-87743367 AGAGGAAAGCAGAAGAAGGAAGG - Intronic
1071880526 10:89892186-89892208 GTGGGTAAGCAGAAGGGAGAAGG - Intergenic
1072014044 10:91328301-91328323 GGTGCTAAGCAGAAGGGGGAGGG - Intergenic
1072044795 10:91643987-91644009 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1072185498 10:93034352-93034374 GGGGCTAAGAACAAGGAGGTGGG - Intronic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072493788 10:95934683-95934705 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1072541976 10:96405525-96405547 GGGAGTAAACAGAAGGAGATGGG + Intronic
1072838018 10:98737557-98737579 TGGGGTGAGCAGAAGCAGGGTGG - Intronic
1073066749 10:100764921-100764943 GGAGGTAAACAGGAAGAGGAGGG + Intronic
1073597710 10:104817381-104817403 AGGGGGAAGGAGGAGGAGGAGGG - Intronic
1073624002 10:105077395-105077417 TGGGGAAACCAGAAGGATGAAGG + Intronic
1073926433 10:108521593-108521615 GGAGGAAAGCAGACAGAGGAGGG - Intergenic
1074015463 10:109529867-109529889 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1074059288 10:109950283-109950305 GGGTGTGAGAAGTAGGAGGAGGG + Intronic
1074547288 10:114410862-114410884 GGGGCTAGGGAGAAGGAGAATGG - Intergenic
1075153234 10:119953703-119953725 GGGGGCAAGGAGGAAGAGGAAGG - Intergenic
1075433906 10:122417294-122417316 GGGGGCGAGGAGTAGGAGGAAGG + Intronic
1075911213 10:126127175-126127197 GGGAGGAAGCAGAAGGGAGAAGG + Intronic
1076189801 10:128475064-128475086 GGCTGGAAGCAGAAGGGGGACGG - Intergenic
1076411107 10:130251624-130251646 GGGGGTGAGGAGAGAGAGGAAGG - Intergenic
1076640024 10:131909087-131909109 GGGTATAAGAAGAGGGAGGAAGG + Intronic
1076694803 10:132242310-132242332 GGGGGAGTGCAGCAGGAGGACGG + Intronic
1077150767 11:1072172-1072194 GAGGGAAAGGAGGAGGAGGAAGG - Intergenic
1077196050 11:1280725-1280747 GGTGGAAAGCAACAGGAGGAGGG + Intronic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078471661 11:11592510-11592532 GGGGGTAAGGTGAGGGAGCATGG - Intronic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1079528184 11:21415739-21415761 GAGGTTAAGCAAAAGGAGAAGGG + Intronic
1079867821 11:25758137-25758159 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080054800 11:27895376-27895398 GGAGGTATGAAGAAGGAAGAAGG + Intergenic
1080237905 11:30092884-30092906 GGAAGGAAGGAGAAGGAGGAAGG - Intergenic
1080478364 11:32619857-32619879 GAAGGGAAGGAGAAGGAGGAGGG + Intronic
1080709982 11:34737670-34737692 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080767035 11:35306670-35306692 GGGGGAAAGGGGAAGGACGAAGG - Intronic
1081118198 11:39231917-39231939 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1081252436 11:40851431-40851453 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1081659487 11:44879267-44879289 TAGGGAAAGAAGAAGGAGGAAGG - Intronic
1081733737 11:45389365-45389387 GGGTGTAAACAGGAGGTGGAGGG + Intergenic
1082195566 11:49300332-49300354 GGGGGAAAGGAGAAGGAAAAAGG + Intergenic
1082244444 11:49905219-49905241 GGGGGGAAATAGAAGGGGGAAGG + Intergenic
1082670624 11:56032970-56032992 GTGGGTGAGCAGAAGCAGGGTGG + Intergenic
1082876400 11:57992971-57992993 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1083052281 11:59788004-59788026 CGTGGGAAGCAGGAGGAGGATGG - Intronic
1083162785 11:60865590-60865612 GAGGGTAAGAGGAAGGAGAAGGG - Intergenic
1083181309 11:60987595-60987617 GGGGGTATGGAGAAAGAGGTGGG + Intronic
1083253914 11:61485040-61485062 GGCCGTGAGCAGGAGGAGGAAGG - Intronic
1083503490 11:63133285-63133307 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1083506960 11:63167027-63167049 GAGGGTAAGCTGAAGCAGGGTGG + Intronic
1083510140 11:63201990-63202012 GAGGGTGAGCAGAAGCAGGTTGG + Intronic
1083533782 11:63449927-63449949 GGGGGTGGGCAGAAAGGGGAGGG - Intergenic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1083681519 11:64353959-64353981 GGGGGTCAGGACAGGGAGGAGGG - Intronic
1084216131 11:67647787-67647809 GGGGCCCAGCAGAAGGACGAAGG - Intronic
1084557897 11:69885727-69885749 GGGGGAGGGCAGAAGGGGGAGGG + Intergenic
1084941335 11:72614977-72614999 GGGGGTAAGTAGAGGAGGGAGGG - Intronic
1085392672 11:76190404-76190426 GGGGGTCGGCAGAGGGAAGATGG - Intronic
1085783189 11:79428034-79428056 GGGAGAAAGCAGAAGCAGGAAGG + Intronic
1085931554 11:81089343-81089365 GGGAGGAAGCAGAAGGAAGGAGG - Intergenic
1086778273 11:90867554-90867576 GGGAGTAAGGAAAATGAGGAGGG + Intergenic
1087305673 11:96486975-96486997 GGGGGCAAGCCGAAGCAGGGTGG + Intronic
1087515437 11:99154176-99154198 GTGGGGAAGCAGCAGGAGCAGGG + Intronic
1087831057 11:102820212-102820234 GAGGGTAAGCAGGAGCAGGGTGG - Intergenic
1087905232 11:103688252-103688274 GGGAGTAAGCAAAAGAAGAATGG + Intergenic
1088078379 11:105879186-105879208 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1088220227 11:107562844-107562866 GGGGGAGAGGAGAAAGAGGAAGG + Intronic
1088702462 11:112425917-112425939 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1088732258 11:112693901-112693923 GGGTGTGAGCAGAAGGCGGTAGG - Intergenic
1088840980 11:113627390-113627412 GGAGGGAAGGAAAAGGAGGAAGG + Intergenic
1088840995 11:113627436-113627458 GGAGGGAAGGAAAAGGAGGAAGG + Intergenic
1089182162 11:116590540-116590562 GGGGGTGAGGAGGAGGAGGGTGG - Intergenic
1089267177 11:117272437-117272459 GGGGGTAGGGAGGAAGAGGAGGG + Intronic
1089766113 11:120766748-120766770 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090254418 11:125273347-125273369 GGGAGAATGCAAAAGGAGGATGG + Intronic
1090353283 11:126121550-126121572 GGGAGTGTGCAGAGGGAGGAGGG + Intergenic
1090811620 11:130249640-130249662 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1091213613 11:133885545-133885567 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1091387276 12:103332-103354 GGGGCTCAGGAGAAGGAGGTGGG + Intronic
1091440872 12:511242-511264 GGCGGAAGGCAGAAGGCGGAAGG - Intronic
1091440887 12:511308-511330 GGTGGAAGGCAGAAGGCGGAAGG - Intronic
1091441254 12:512820-512842 GGTGGAAGGCAGAAGGCGGAAGG - Intronic
1091441272 12:512894-512916 GGTGGAAAGCGGAAGGCGGAAGG - Intronic
1091672433 12:2462051-2462073 GGGGGTGAGCTTAGGGAGGAAGG - Intronic
1091687291 12:2572547-2572569 GGAGGAGAGGAGAAGGAGGAGGG - Intronic
1092304277 12:7283398-7283420 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1092398876 12:8154208-8154230 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1092440320 12:8495749-8495771 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1092567777 12:9686143-9686165 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1092637479 12:10467195-10467217 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1092720165 12:11433259-11433281 GGGGGAAGGGAGAAGCAGGAAGG + Intronic
1093925221 12:24902826-24902848 GAGGGCAAGGCGAAGGAGGATGG + Intronic
1093992927 12:25610310-25610332 GAGGGCAAGCTGAAGCAGGACGG - Intronic
1094084737 12:26577014-26577036 GGGGGAAGGCAGAAGGTGGAAGG - Intronic
1095380183 12:41581632-41581654 GGGAGAGAGCAGATGGAGGAAGG + Intergenic
1095719746 12:45387438-45387460 GGGGAAAAGCAGATGAAGGATGG + Intronic
1095726997 12:45464808-45464830 GGAGGTAAGTAAAAGGAGGGTGG - Intergenic
1095920699 12:47526870-47526892 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1096046663 12:48568466-48568488 TGGGGTAAGGAGAAGGAGGATGG + Intronic
1096502125 12:52070414-52070436 GGGCGTGAGGAGGAGGAGGAAGG + Exonic
1097007664 12:55931016-55931038 GGGGGTGGGAAGAAGGGGGAGGG - Exonic
1097008598 12:55936618-55936640 GGGTGTAATGAGGAGGAGGAGGG - Intronic
1097727631 12:63093146-63093168 TGGGGTAAGCAGCTGGAGGTGGG - Intergenic
1097898884 12:64853786-64853808 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1098006579 12:66003716-66003738 GGGGGGAAGCAGAGGGAGGTGGG - Intergenic
1098194935 12:67989723-67989745 GGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098606544 12:72397558-72397580 AGGGGTGAGCACAAGGAGAATGG - Intronic
1098720500 12:73891794-73891816 GGGTGTAAGCAGATGTAGGAGGG - Intergenic
1099071449 12:78049504-78049526 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1099142557 12:78997038-78997060 GGAGGTCAGCAGCAGGAGTATGG + Intronic
1099176076 12:79423812-79423834 GGAGGCAAGCAGAGAGAGGAAGG + Intronic
1099239015 12:80116345-80116367 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1099253801 12:80290186-80290208 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
1099512687 12:83556526-83556548 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1099611896 12:84883820-84883842 GGTGATTAGCAGAATGAGGAAGG + Intronic
1099745056 12:86690608-86690630 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1099895803 12:88645109-88645131 GTGGGTAAGTAGAAACAGGAAGG - Intergenic
1099941327 12:89192746-89192768 GTGGCTCAGCAGAGGGAGGAAGG + Intergenic
1100355891 12:93829447-93829469 GGGGGTAGCCAGGATGAGGATGG + Intronic
1100677657 12:96885852-96885874 GGGGAGAAGGAGGAGGAGGAAGG - Intergenic
1100768822 12:97898597-97898619 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1100799505 12:98216467-98216489 GGGTGAAAGCAGAATGAGTAAGG - Intergenic
1100811400 12:98342389-98342411 GGGGCTCTGCGGAAGGAGGAAGG - Intergenic
1100872984 12:98931753-98931775 GGGGGTAAACACAGGGATGAAGG - Intronic
1101000323 12:100351517-100351539 GGGGGTGAGAAGGAGGAGTATGG + Intergenic
1101348157 12:103905251-103905273 GGGGGGAGGGAGAGGGAGGAAGG + Intergenic
1102451495 12:113045058-113045080 GGGGGGAAAAGGAAGGAGGAGGG + Intergenic
1102542804 12:113634817-113634839 GGGGGTGAGCAGAAGGGTGGGGG - Intergenic
1102598745 12:114012888-114012910 GGGAGGAGGGAGAAGGAGGAGGG + Intergenic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1102887670 12:116534065-116534087 GGGGAGAAGGAGGAGGAGGAGGG - Intergenic
1103169238 12:118799447-118799469 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1103520695 12:121535821-121535843 GGGGCAGAGCTGAAGGAGGAGGG + Intronic
1103993647 12:124815320-124815342 GGGGGAGAGCAGAACGAGGCCGG - Intronic
1104239266 12:126971712-126971734 GGGGAGAAAGAGAAGGAGGAAGG - Intergenic
1104301745 12:127570686-127570708 GGAGGAAAGGAGAAGGAGGAAGG + Intergenic
1104684920 12:130778549-130778571 GGAGGAAAGCAGACAGAGGAGGG - Intergenic
1104749940 12:131231916-131231938 GGAGGTGAGGAGGAGGAGGAGGG - Intergenic
1105620481 13:22061361-22061383 GGGGGTTGGCAGAAGGAAAAGGG - Intergenic
1106012291 13:25836505-25836527 GGGAGGACGCAGAAGGAGAAGGG - Intronic
1106042063 13:26103094-26103116 GAGGGCAAGCAGAAGCAGGATGG + Intergenic
1106124019 13:26885384-26885406 AGGGGAAAGTAGCAGGAGGAAGG + Intergenic
1106225828 13:27786314-27786336 GGGATTAAGCCAAAGGAGGAGGG - Intergenic
1106336667 13:28789462-28789484 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1106429339 13:29665429-29665451 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1106720752 13:32432376-32432398 GGGGGAAGGGGGAAGGAGGAAGG + Intergenic
1106766823 13:32921871-32921893 GGGAGGAAGCAGGAGGAAGAGGG + Intergenic
1106874309 13:34055080-34055102 GAGGGTGAGCAGAAGCAGAATGG - Intergenic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1108234961 13:48394097-48394119 GAGGGCAAGCTGAAGCAGGATGG + Intronic
1108262879 13:48675943-48675965 GGGGGTGAGCAGAAGCAGAGTGG - Intronic
1108274018 13:48789764-48789786 GAGGGCAGGAAGAAGGAGGAAGG + Intergenic
1108346422 13:49551125-49551147 GGGGGGAGGGAGAAGGGGGAAGG + Intronic
1108426482 13:50306927-50306949 GGGGATTAGCAGAGGGAGGAAGG - Intronic
1108596193 13:51951692-51951714 GGGGATGAGGAGGAGGAGGAGGG + Intronic
1108837037 13:54563379-54563401 GGGGGTAAGCAGGAGGGGTGGGG + Intergenic
1108940488 13:55947500-55947522 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1109421275 13:62115607-62115629 GGGGGAAACCAAAAGCAGGATGG - Intergenic
1109457570 13:62612017-62612039 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1109606528 13:64704969-64704991 AGGGGTTTGCAGAAGGATGAAGG + Intergenic
1110824598 13:79957955-79957977 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1111444603 13:88330827-88330849 GAGGGAAAGAAGAAGGAGAAGGG - Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1112062281 13:95753078-95753100 GGAGGGAAGAAGAAGGAGGATGG - Intronic
1112626572 13:101111468-101111490 GGGAGGAGGCAGAAGGAGGAGGG - Intronic
1113082024 13:106530245-106530267 GGGGGGAATTAGAAGGAGGCTGG - Intronic
1113222699 13:108123238-108123260 GAGGGAGAGCAGATGGAGGAAGG + Intergenic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1113660273 13:112103018-112103040 GGGGTGAAACAGCAGGAGGAAGG + Intergenic
1113783582 13:112990059-112990081 GGGGGTAAGCAGGAGGTGAGTGG - Intronic
1114260113 14:21030517-21030539 GGGGTGAAGGAGAAGGGGGAGGG - Exonic
1114480980 14:23034457-23034479 GGGGGTAAGTCGGGGGAGGAAGG - Intronic
1114844817 14:26308758-26308780 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1114906408 14:27133272-27133294 GAGGGTAAGGAGAAGGGGGATGG - Intergenic
1115357083 14:32460429-32460451 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1115421474 14:33199706-33199728 GAGGGGAAGAAGAAGGGGGAGGG - Intronic
1115885236 14:37964048-37964070 GGGGCTTATCAGAAGGTGGATGG - Intronic
1116272848 14:42794770-42794792 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116565323 14:46438329-46438351 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116707973 14:48327719-48327741 GGGGGTAAGGGGAGGGGGGAGGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117120976 14:52568149-52568171 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1117236217 14:53779616-53779638 AGTGGTCAGCAGAAGGAGAATGG + Intergenic
1117284504 14:54273887-54273909 TGGGGTGAGGAGAAGGGGGAGGG - Intergenic
1117624134 14:57618382-57618404 GAGGGTAAGCAGAAGCAGGGTGG + Intronic
1117754899 14:58964737-58964759 GGCGACAAGCAGAGGGAGGAGGG - Intergenic
1117850145 14:59958904-59958926 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1118459564 14:65976066-65976088 AGGGGGAAGGAGGAGGAGGAGGG + Intronic
1118595699 14:67433643-67433665 TGGGGGAAAAAGAAGGAGGAGGG + Intergenic
1118796461 14:69150244-69150266 GGGGGGAAGGAAAAGGAGCAAGG + Intronic
1118906807 14:70029253-70029275 GGGTGTCAGCAGAATGAGGCTGG + Intronic
1118979104 14:70701716-70701738 GGGGGTGAGAAGAAAGAGGAAGG + Intergenic
1119180369 14:72601002-72601024 GGGGGAGAGGAGGAGGAGGAGGG + Intergenic
1119437903 14:74610256-74610278 GGGTGAAAGGAGAAAGAGGATGG + Intronic
1119683464 14:76611110-76611132 GGTGGTTAGCAGAAGCTGGAGGG + Intergenic
1119685533 14:76628033-76628055 GGGGGTTAGGAGAAGGAGAGAGG - Intergenic
1119740776 14:77012448-77012470 GTGGTGAAGCCGAAGGAGGAGGG - Intergenic
1119907302 14:78317515-78317537 GGGGGAAAGCAGAAGAGGGGAGG - Intronic
1119956282 14:78801848-78801870 GGAGGGAAGCTGAAGGATGAAGG - Intronic
1119997651 14:79271382-79271404 AGGGGAAGGAAGAAGGAGGAAGG - Intronic
1120033846 14:79673143-79673165 GGGGGTCAGAAGAGGAAGGAGGG + Intronic
1120271863 14:82322389-82322411 GTGGGCAAGCAGAAGCAGGGTGG - Intergenic
1120904923 14:89611946-89611968 GGGGGGAAGAAAAAGCAGGATGG - Intronic
1121062649 14:90929782-90929804 GGGGGAAAGGAGAGGGAGGTAGG + Intronic
1121780117 14:96616872-96616894 GGGCGCGAGCAGAAAGAGGATGG + Intergenic
1121917900 14:97853105-97853127 GGAGGGAAGGAGGAGGAGGATGG - Intergenic
1121966193 14:98308174-98308196 GGAGGTAAAAAAAAGGAGGAGGG + Intergenic
1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG + Intronic
1122322242 14:100862073-100862095 AGGGGGAGGGAGAAGGAGGAAGG - Intergenic
1122546011 14:102523285-102523307 AGGGGAAGGGAGAAGGAGGAAGG + Intergenic
1122741591 14:103874738-103874760 GGGTGTCTGCAGAAGGAGGCTGG + Intergenic
1122874198 14:104655872-104655894 GGGCGTGATCAGGAGGAGGATGG + Intergenic
1123058836 14:105585356-105585378 GTGGGTAGGCGGATGGAGGATGG - Intergenic
1123091879 14:105745565-105745587 GGTGGGAAGCAGGAGGAGCAAGG - Intergenic
1123097464 14:105773295-105773317 GGTGGAAAGCAGGAGGAGCAAGG - Intergenic
1202871950 14_GL000225v1_random:173003-173025 GGGGGGGAGCAGAAAGAGGCTGG + Intergenic
1124608756 15:31193266-31193288 GAGGGAAAGCAGATGGAAGAGGG - Intergenic
1124671608 15:31646128-31646150 GGGCGTAAGCTGAAGAGGGAAGG - Intronic
1124702786 15:31931284-31931306 GGGAGGAAGGAGAATGAGGATGG + Intergenic
1125537899 15:40453110-40453132 GGTGGTAAGCAGAGGCAGGCAGG - Intronic
1125610518 15:40966285-40966307 GCGGGTCAGCAGGCGGAGGAAGG + Intergenic
1125646485 15:41276979-41277001 TGAGGTAAGAAGAATGAGGAAGG + Intronic
1125916790 15:43494818-43494840 GGGAGGAAGCAGAAGCAGGCTGG - Intronic
1126196478 15:45937272-45937294 GGGGATATGCAGAAGGGTGATGG - Intergenic
1126296993 15:47150804-47150826 TGGTGAAAGCAGAAGCAGGAGGG + Intergenic
1126361073 15:47846609-47846631 GGGGAGAAGAAGAAGGAGTAGGG + Intergenic
1126386567 15:48099579-48099601 ATGGGTAGGCAGAAGGAGAAGGG - Intergenic
1127137968 15:55944158-55944180 GAGGGCAAGCCGAAGCAGGATGG + Intronic
1127525462 15:59788041-59788063 GTGGGTTAGCAGCAAGAGGAGGG + Intergenic
1128435780 15:67646106-67646128 AGTGGTAAGAAGAAGGAGGTGGG + Intronic
1128454546 15:67825348-67825370 GGGGGTGAGGAGAAGGAGGAGGG - Intronic
1128454551 15:67825366-67825388 GGGGGTGAAGAGAAGGAGGGGGG - Intronic
1128557463 15:68641466-68641488 GGGAGGAAGCAGAAGGAGCAGGG + Intronic
1128734705 15:70046684-70046706 GGGGAGACGCAGCAGGAGGAAGG + Intergenic
1128857595 15:71032273-71032295 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1129126685 15:73447838-73447860 GGGGGTGAGCCGAAGCAGGGTGG + Intronic
1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG + Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129695273 15:77737432-77737454 GGGAGGAAGGAGAGGGAGGAAGG + Intronic
1129756492 15:78102140-78102162 GGGGGGCAGAAGCAGGAGGATGG + Intronic
1129765040 15:78159297-78159319 TGGGGGAAGAAAAAGGAGGAGGG - Intronic
1130044909 15:80436049-80436071 GGGGGAAAGCTGAATAAGGAGGG - Intronic
1130273946 15:82466812-82466834 GGGGCCCTGCAGAAGGAGGATGG + Intergenic
1130466294 15:84194186-84194208 GGGGCCCTGCAGAAGGAGGATGG + Intergenic
1130497970 15:84479350-84479372 GGGGCCCTGCAGAAGGAGGATGG - Intergenic
1130588588 15:85198779-85198801 GGGGCCCTGCAGAAGGAGGATGG + Intergenic
1130717380 15:86348477-86348499 GGTGGTAAGAATAGGGAGGAGGG + Intronic
1131291714 15:91112147-91112169 GGGGATAGGGAGAAGGGGGATGG + Intronic
1131551225 15:93358713-93358735 GGGGCGAGGCAGATGGAGGAGGG + Intergenic
1131614673 15:94003938-94003960 AGGGGGCAGCAGAAGGAGAATGG - Intergenic
1131649870 15:94387122-94387144 GGGGGAAGGAGGAAGGAGGAAGG - Intronic
1131719502 15:95152134-95152156 GGGGATAAGGAGGGGGAGGATGG - Intergenic
1131726410 15:95230466-95230488 GGGGGCAAGAAGAGGGAGGGAGG + Intergenic
1131947063 15:97635204-97635226 GGGTGGAAGGAGAAGGAGGAGGG - Intergenic
1132242196 15:100266500-100266522 GGGCTTAAGCAGAAGAGGGATGG - Intronic
1132724971 16:1334471-1334493 GTCGGTGAGCAGAGGGAGGAGGG + Intronic
1132753437 16:1470034-1470056 GGGGCTGGGCAGCAGGAGGAAGG + Intronic
1132833478 16:1941171-1941193 TGGGGCAAGCAGAGGGAGGAAGG + Intronic
1132855897 16:2044403-2044425 GCGGGGAAGCAGAGGAAGGAAGG + Intronic
1132894228 16:2220314-2220336 GGGCTTAAGCAGAAGCAGGAAGG - Intergenic
1133392851 16:5423083-5423105 GGGAGGAAGAGGAAGGAGGAGGG + Intergenic
1133448050 16:5879276-5879298 GATGGTAAGCAGAAGCTGGAGGG + Intergenic
1133520126 16:6549124-6549146 GGGAGGAAGGAGGAGGAGGAGGG + Intronic
1133634107 16:7649988-7650010 GGGAGAAAGGAAAAGGAGGAGGG + Intronic
1133717897 16:8466938-8466960 GGGAGGAAGGAGAAGAAGGAAGG + Intergenic
1133720364 16:8488966-8488988 GGGGGGAGGCAGAGGGAGGAAGG + Intergenic
1133749499 16:8713563-8713585 GGAGGGAAGGTGAAGGAGGAGGG - Exonic
1133809827 16:9152826-9152848 AGGGGTGAGCAGAGGGAGGTGGG - Intergenic
1134287165 16:12871984-12872006 GGGAGGAGGAAGAAGGAGGAAGG - Intergenic
1134657302 16:15956797-15956819 GAGGCTAAGGAGGAGGAGGAAGG + Intronic
1134803560 16:17106729-17106751 GGGGGTGAGTAGGGGGAGGATGG + Exonic
1135296547 16:21283993-21284015 GGACGCAGGCAGAAGGAGGAAGG - Intronic
1135623903 16:23979034-23979056 TGGGGTGAGCAGAAGTAGGTAGG + Intronic
1135991613 16:27222025-27222047 TGGGGTAACTAGAAGGGGGATGG + Intergenic
1136081331 16:27854283-27854305 GGGGGAGAGAAGGAGGAGGAGGG + Intronic
1136521631 16:30800357-30800379 GGGGCTGGGCAGAAGCAGGAGGG + Intergenic
1137236560 16:46623215-46623237 GGGGGGAAGCAGAGGGAGGTGGG - Intergenic
1137556998 16:49477140-49477162 GAGGGTGAGCGGAAGGGGGAGGG + Intergenic
1137616331 16:49849670-49849692 GGAGGTAAACAGAGGGAGGCAGG + Intronic
1138151468 16:54661507-54661529 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1138229235 16:55325232-55325254 GGGGGAAGCCAGAAGGAGCAAGG + Intronic
1138886830 16:61090613-61090635 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1139060948 16:63250702-63250724 GAGGGGAAGGGGAAGGAGGAGGG + Intergenic
1139474617 16:67196846-67196868 GGTGGGCAGCAGAAGGAGGAGGG - Intronic
1139513198 16:67438885-67438907 GGGGGGAAGCACAAGCATGAGGG + Intronic
1139659667 16:68412021-68412043 GGGGGAAGGAAGAAGGAGGCAGG + Intronic
1140208069 16:72949593-72949615 GGGGGAAAGCGGAGGGTGGAGGG + Intronic
1140728943 16:77838843-77838865 GGGGAGAAAGAGAAGGAGGAAGG - Intronic
1140874397 16:79137680-79137702 CGGGGGAAGGAGACGGAGGAGGG - Intronic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141417337 16:83886148-83886170 AGGAGGAAGCAGAAGGAGGCTGG + Intergenic
1141527196 16:84618738-84618760 GGGGGTGGGGAGAATGAGGAAGG - Intergenic
1141775773 16:86121797-86121819 AGGGACAAGCAGGAGGAGGAAGG - Intergenic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1141845112 16:86603358-86603380 AGGGGGAAGGAGGAGGAGGAAGG - Intergenic
1142269157 16:89080134-89080156 TGGAGAAAGCAGAGGGAGGAAGG + Intergenic
1142377375 16:89712815-89712837 GGAGGTGAGGAGAAAGAGGAGGG + Intronic
1142798078 17:2324666-2324688 GTGGGTATGAAGGAGGAGGATGG - Exonic
1142832163 17:2557370-2557392 GGAGGAAAGAAGAAGGAAGAAGG + Intergenic
1143005164 17:3827077-3827099 GGGGGAAAGGGGAAGGGGGAAGG + Intronic
1143021317 17:3918302-3918324 GGAGGAAAGAAGAAGGAGGGAGG + Intergenic
1143249399 17:5511645-5511667 GGAGGTCTGCAGAAGGAGGCGGG + Intronic
1143512988 17:7405979-7406001 AGGGATAGGGAGAAGGAGGAGGG + Intronic
1143863691 17:9908934-9908956 GGGGGTATGGAGAAGGTGGCGGG + Intergenic
1144198194 17:12916008-12916030 GGAGGTAAGCAGCAGGAGTGAGG + Exonic
1144273535 17:13643179-13643201 GGGGTTAAGGTGAAGGGGGAGGG - Intergenic
1144434202 17:15224397-15224419 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1144764112 17:17723696-17723718 GGGGGAAGGGAGGAGGAGGAGGG - Intronic
1145110625 17:20158234-20158256 AGGGGGAAGCAGAAGGAGAAGGG + Intronic
1145238733 17:21227088-21227110 CGGAGTCAGAAGAAGGAGGATGG + Intergenic
1145927328 17:28658064-28658086 GGCAGTAACCAGAAGTAGGAAGG - Intronic
1146534314 17:33637010-33637032 GGGGAGGAGAAGAAGGAGGAAGG - Intronic
1146673679 17:34758586-34758608 AGGAGAAAGAAGAAGGAGGAAGG + Intergenic
1146742743 17:35300995-35301017 GAGGGTAAGCCAAAGCAGGATGG + Intergenic
1146746419 17:35334220-35334242 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1147420390 17:40319532-40319554 TGGGGTAAGCAGCAGGGGGTGGG - Intronic
1147422875 17:40331285-40331307 GGGGGGAAGAAGAAGGCGTAGGG - Exonic
1147856488 17:43484224-43484246 TGAGGGAAGCGGAAGGAGGAAGG + Intronic
1147976903 17:44253068-44253090 GGGGGTGAGGGGCAGGAGGATGG + Intronic
1148066682 17:44876123-44876145 GGTGGTAAGAAGAACAAGGAGGG + Intronic
1148209688 17:45800663-45800685 GGGGCTCAGCAGAAGGGCGAGGG + Intronic
1149261392 17:54884099-54884121 GGGCGGGAGCAAAAGGAGGATGG - Intergenic
1149281358 17:55108703-55108725 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1149365373 17:55938837-55938859 GAGGGTGAGCAGAAGCAGGTTGG + Intergenic
1149492185 17:57092952-57092974 GGGGGGAAGCAGGAGGAGAGCGG - Intronic
1149576353 17:57716215-57716237 GGGGATAAGGAGCTGGAGGATGG - Intergenic
1149646505 17:58245284-58245306 GGGGTTAAGCTGAAGGAGGAGGG + Intronic
1149712560 17:58756277-58756299 GAGGGTGAGGAGGAGGAGGAGGG + Exonic
1150200394 17:63350296-63350318 GGGGGAAAGCAGAGGGAAGAGGG - Intronic
1150221843 17:63500053-63500075 GGGGTTAGGCAGACAGAGGAAGG - Intronic
1150827095 17:68486584-68486606 GAAGGAAAGCAGAAGAAGGAAGG - Intergenic
1150976882 17:70097456-70097478 GGAGGTCAGGAGCAGGAGGATGG + Intronic
1151272457 17:73007523-73007545 TGGTGAAAGCAAAAGGAGGAAGG + Intronic
1151284089 17:73097177-73097199 GGGGGCAAGCAGAGGGATCATGG + Intergenic
1151331345 17:73411055-73411077 GGGGGGAGGCAGAGGAAGGAAGG - Intronic
1151359929 17:73582721-73582743 GGGGGTACCCAGGAGGAGAAGGG - Intronic
1151476149 17:74345249-74345271 GGTGGGAAGGGGAAGGAGGATGG + Intronic
1152913131 17:83016781-83016803 GGGAGGAAGGAGGAGGAGGAGGG + Intronic
1153119114 18:1700113-1700135 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1153537075 18:6113977-6113999 GGAAGAAAGCAAAAGGAGGAAGG - Intronic
1153762447 18:8344907-8344929 GGAGGTAGGGAGAGGGAGGAGGG + Intronic
1153798378 18:8646574-8646596 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1153930368 18:9873411-9873433 GTGGGTTTGCAGAAGGATGAGGG + Intergenic
1154432786 18:14321129-14321151 GGTGGTGGGCAGAAGGAAGAGGG + Intergenic
1155355110 18:24944271-24944293 GGCTTTAGGCAGAAGGAGGAGGG + Intergenic
1155388105 18:25303062-25303084 GGAGGTTAGGAAAAGGAGGAAGG - Intronic
1155576403 18:27252505-27252527 GGGGGGAAAGAGGAGGAGGAAGG + Intergenic
1155745549 18:29352730-29352752 GGGAGGAAGAAGAAGGAGCATGG - Intergenic
1155857432 18:30850569-30850591 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1156190608 18:34715941-34715963 AGGGGAAAGCAAAAGGAGGAAGG + Intronic
1156491987 18:37501714-37501736 GTAGGTAGGAAGAAGGAGGAGGG + Intronic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1156760484 18:40583388-40583410 AGGGGTAAGCAGCAGCAGCAGGG - Intergenic
1156840725 18:41607021-41607043 GGGGGAAAGTAGAAACAGGACGG - Intergenic
1156969268 18:43135089-43135111 GGGTGTGATTAGAAGGAGGAGGG + Intergenic
1157312964 18:46566186-46566208 GGGGCTGAGGGGAAGGAGGAGGG - Intronic
1157470263 18:47983117-47983139 GGGGGAAGGCAAAAGGAGGTTGG - Intergenic
1157470287 18:47983173-47983195 GGGGAGGAGAAGAAGGAGGAAGG - Intergenic
1157720842 18:49923067-49923089 GGGAGTAAGCAGTAGGAACAGGG + Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158410324 18:57199519-57199541 GCGGGGAAGTAGAAGGAGGTAGG - Intergenic
1158575029 18:58629498-58629520 GGGGGTAAGCAGGGTGAGGAGGG - Intergenic
1159002793 18:62988371-62988393 GGGGGTGTCCAGAAGGAGGACGG - Intergenic
1159318607 18:66814879-66814901 GAGGGTAAGGAAAATGAGGAAGG + Intergenic
1159362821 18:67427352-67427374 GTAGGAATGCAGAAGGAGGAAGG - Intergenic
1159913895 18:74172060-74172082 GGGGGACAGCAGAGAGAGGAGGG - Intergenic
1159983261 18:74811874-74811896 TGGGGTAAGGGGAAGGGGGAGGG + Intronic
1160413265 18:78688887-78688909 GGGGGTAAACAGGGGGAGGCCGG + Intergenic
1160475111 18:79177164-79177186 GGGGGCAAGGACAGGGAGGAAGG - Intronic
1160901851 19:1432746-1432768 GGGAGGAAGCAGAAGAAGGCAGG - Intronic
1160970661 19:1766440-1766462 GGGGGAGAGAAGGAGGAGGAGGG + Intronic
1161207136 19:3047099-3047121 GGGGGAGAGGGGAAGGAGGAGGG - Intronic
1161347907 19:3777290-3777312 TGGGGGAGGCAGGAGGAGGAGGG + Intergenic
1161643367 19:5437303-5437325 GAGGGTAGGCAGAGGCAGGAGGG + Intergenic
1162053089 19:8046797-8046819 GAGGGGGAGGAGAAGGAGGAGGG - Intronic
1162127640 19:8507933-8507955 GGGGGCAAGGAGAAGGTGGGAGG + Intergenic
1162854789 19:13460050-13460072 GCGGGTGAGCAGAGGGAGGGGGG - Intronic
1163609320 19:18292830-18292852 GAGGGGAAGCTGAAGCAGGAAGG - Intergenic
1163646083 19:18489873-18489895 AGGGGTCAGCAGAAACAGGAGGG - Intronic
1164324721 19:24181203-24181225 GGAGGAGAGGAGAAGGAGGATGG + Intergenic
1164719977 19:30424898-30424920 GGTGGGAAGCAGAAGGTGGCAGG - Intronic
1164866852 19:31611530-31611552 GGGGGAAAGGAGAGAGAGGAGGG + Intergenic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1165434290 19:35787983-35788005 GGGGGAAAGCAGGAGGGGGCTGG - Exonic
1165773201 19:38389971-38389993 AGGGATAAGCAGGAGGGGGAGGG + Intronic
1165802798 19:38563151-38563173 AGGGGTGAGCAGAAGGAAGCGGG - Intronic
1166008636 19:39925174-39925196 GGAGGGAAGAAGAAGGAAGAAGG + Intronic
1166546660 19:43638459-43638481 GTGGCTAGGCAGAAGCAGGAGGG - Intronic
1166617839 19:44267095-44267117 GGAGGGAGGTAGAAGGAGGAAGG - Intronic
1166950769 19:46426627-46426649 GGGTGACAGCCGAAGGAGGATGG + Intergenic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167528711 19:50001542-50001564 GGGGGTAAGGAGCAGGAGGTGGG - Intronic
1167769899 19:51508582-51508604 TGGGGGTAGCAGAAGGAGCAGGG - Intergenic
1167783379 19:51615529-51615551 TGGGGTGAGGAGAAGGAGAACGG + Intronic
1168277724 19:55286456-55286478 GGGGTTCAGGAGAAGGTGGAGGG + Intronic
1168311491 19:55463235-55463257 GGGGCTAGGCAGAAGGAAGGGGG + Intergenic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
1168517073 19:57017542-57017564 GGAGGGAAGCAGAGGGAGAAGGG - Intergenic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
924989029 2:295429-295451 GAGGGTGGGCAGAAGGAGGCAGG - Intergenic
925034252 2:673763-673785 GGGGGGAAGGAGAGGAAGGAGGG + Intronic
925135210 2:1522043-1522065 TGGGGTCAGGAGAGGGAGGAAGG - Intronic
925553452 2:5101982-5102004 GGGGATTAGTAGAAGGAGAAGGG + Intergenic
925718432 2:6806287-6806309 GGGTGAAGGCAGAAGCAGGAAGG - Intergenic
925902055 2:8515836-8515858 GGGAGGAAGGAGAGGGAGGAGGG - Intergenic
926284043 2:11473230-11473252 GGGAGGATGCAGAAAGAGGAGGG + Intergenic
926339877 2:11896133-11896155 TGGTGTAGGAAGAAGGAGGATGG + Intergenic
926434144 2:12821509-12821531 TGATGTAAGAAGAAGGAGGAAGG - Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926753639 2:16219281-16219303 GGGGAGGAACAGAAGGAGGAGGG - Intergenic
926884183 2:17582221-17582243 AGGGGTGAGGGGAAGGAGGAAGG + Intronic
926970680 2:18464164-18464186 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
927182715 2:20458450-20458472 GAGGGTGAGCAGAAGCAAGATGG + Intergenic
927486000 2:23488856-23488878 GGGGGTAAGCAAGAGGTAGATGG - Intronic
927510907 2:23643075-23643097 CGGGGTAAGAAGAGGAAGGAAGG + Intronic
927673475 2:25088556-25088578 GGGGGAAAGCAGAAAGGGGCGGG + Intronic
927810855 2:26179566-26179588 GAGGGCAAGGACAAGGAGGAGGG + Intronic
928102962 2:28450104-28450126 GGGGGAAAGAAGGAGGAGGAGGG - Intergenic
928370602 2:30737450-30737472 AGGGGTACGCAGGAAGAGGATGG + Intronic
928413160 2:31070012-31070034 GGGGGTAAGCGGACACAGGAAGG - Intronic
928533794 2:32219399-32219421 AGGGGGCAGAAGAAGGAGGAGGG - Intronic
929047479 2:37804131-37804153 TGGGGTCAGGGGAAGGAGGAAGG - Intergenic
929164339 2:38865992-38866014 GGAGGGAAGAAGAGGGAGGAAGG + Intronic
929256220 2:39813973-39813995 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929470748 2:42190263-42190285 GGGGGGACTCAGCAGGAGGAGGG - Intronic
929760690 2:44803510-44803532 GGGGGTGGGCAGACGGAGGGAGG - Intergenic
929778265 2:44941960-44941982 AGGGGGGAGCAGGAGGAGGAGGG - Exonic
929778885 2:44944773-44944795 GAGGGGAAGGAGAGGGAGGAGGG - Exonic
929822059 2:45281752-45281774 GGGTGTGAGCAGATGGAGGTGGG - Intergenic
929837934 2:45425661-45425683 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
929846579 2:45535881-45535903 GGGGGGAAGCAGGAAAAGGAGGG + Intronic
929989945 2:46778438-46778460 GGGGGGCAGCAGAGGGAGGTGGG + Intergenic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
930951248 2:57146391-57146413 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
931133383 2:59366199-59366221 GGGGGAGAGAAGAAGGAAGAAGG + Intergenic
931423754 2:62152109-62152131 GGAGGTGAGCAGAGGGAAGATGG - Intergenic
931513147 2:63022276-63022298 GGAGGAAAGAGGAAGGAGGAAGG - Intronic
931547806 2:63408488-63408510 GGGGGTGGCCAGAAGGAAGACGG + Intronic
932752031 2:74377371-74377393 GAGGGGAAGGAGAAAGAGGAGGG - Intronic
933264575 2:80168508-80168530 GAAGGTGATCAGAAGGAGGAGGG - Intronic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
934792149 2:97070478-97070500 GTAGGAAAGCAGAAGGAAGAAGG - Intergenic
934794691 2:97090594-97090616 CGGGGTAACCAGAAGGGGAAAGG - Intronic
934814473 2:97313231-97313253 GTAGGAAAGCAGAAGGAAGAAGG + Intergenic
934823220 2:97395252-97395274 GTAGGAAAGCAGAAGGAAGAAGG - Intergenic
934863569 2:97786011-97786033 AGGGGTAGGCTGAAGAAGGAGGG + Intronic
934921245 2:98346888-98346910 GGCGGGAGGCAGAAGGAGCAGGG + Intronic
936092898 2:109512327-109512349 GGGCATCAGAAGAAGGAGGAAGG - Intergenic
936514695 2:113174259-113174281 AGGGGTAGGCTGAGGGAGGAGGG - Intronic
936900037 2:117472340-117472362 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
936971046 2:118176589-118176611 GGGGGTGGGGAGAAGGAGCAAGG - Intergenic
937153888 2:119704616-119704638 GGAGGAAAGGAGGAGGAGGAAGG + Intergenic
937246390 2:120496807-120496829 GGGCTGAAGCAGAAGGAGAAGGG - Intergenic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937528390 2:122798986-122799008 GAGGGGAAGGAGAAAGAGGAGGG - Intergenic
937737260 2:125307177-125307199 GGAGGAAAGGAGAAGAAGGAAGG + Intergenic
937807205 2:126160627-126160649 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
937969108 2:127536033-127536055 GGGGCTGAGGAGGAGGAGGAGGG + Intronic
938144658 2:128823534-128823556 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
938224357 2:129602877-129602899 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
938249898 2:129806508-129806530 GTGGGGAAGCTGAAGGAGGCTGG - Intergenic
938317705 2:130341637-130341659 GGGGTTCTGCAGAAGGAAGAGGG + Intronic
938625623 2:133105978-133106000 GGGTTTAGGTAGAAGGAGGATGG - Intronic
939180306 2:138795794-138795816 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
939937848 2:148313935-148313957 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
940565240 2:155351827-155351849 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
940995800 2:160148620-160148642 GAGGGTGAGCAGAAGCAGGGCGG + Intronic
941038196 2:160590516-160590538 GAGGGGAAGGAGAAGGGGGAGGG - Intergenic
941060117 2:160837425-160837447 GGGGGTCAGAGGAAGGAGGATGG - Intergenic
941239471 2:163017909-163017931 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
941623420 2:167804468-167804490 TGGGGTGGGCAGAAGGGGGAGGG - Intergenic
941682420 2:168413339-168413361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
941918545 2:170828051-170828073 GGAGGACAGCAGAAGGAGGAGGG - Intronic
941918554 2:170828089-170828111 GGAGGACAGCAGAAGGAGGAGGG - Intronic
941918620 2:170828383-170828405 TGGGGACAGCAGAGGGAGGAGGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942431380 2:175914596-175914618 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
942898673 2:181089066-181089088 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
943147767 2:184066433-184066455 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
943512237 2:188840464-188840486 GAGGGTGAGCTGAAGTAGGATGG + Intergenic
943699259 2:190972053-190972075 GGGGGTAAAGAGAGGGAGGGAGG + Intronic
943811846 2:192196345-192196367 CGGGGGGAGAAGAAGGAGGAGGG - Intergenic
944267820 2:197748093-197748115 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
944272719 2:197802050-197802072 GGGGGTGAGCAGGGGTAGGAAGG - Intergenic
944764265 2:202848983-202849005 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
944774368 2:202947477-202947499 GGGGGTAGGGGGAAAGAGGATGG + Intronic
944831559 2:203538169-203538191 GGAGCTAACCAGAAGAAGGAGGG + Intergenic
945210968 2:207381467-207381489 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
945927326 2:215819167-215819189 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
945968149 2:216210104-216210126 AGAGGAAAGCAGAAGGAAGATGG + Intergenic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946346928 2:219118456-219118478 GGGGGTAGGCAGTGGGAAGATGG + Intronic
946912904 2:224484978-224485000 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
946992731 2:225353394-225353416 GGGGGGAAGATGAAGGAGAAAGG + Intergenic
947364595 2:229381118-229381140 GAGGGCGAGCAGAAGCAGGATGG + Intronic
947722321 2:232377761-232377783 GGGGGCAATAAGCAGGAGGAAGG + Intergenic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
948577647 2:238964986-238965008 GGAGGAAAGAGGAAGGAGGAAGG - Intergenic
1168938711 20:1690759-1690781 GAGGGTAAGCAGAAGCAGGGTGG + Intergenic
1169045541 20:2531884-2531906 GGAGAGAAGGAGAAGGAGGAGGG + Intergenic
1169128639 20:3150252-3150274 GGGAGAAAGCAGAAGGTTGAGGG + Intronic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1170259800 20:14391459-14391481 GGGGCTAATCAGAAGCTGGAAGG + Intronic
1170418748 20:16171421-16171443 GAGGGAAAGCAGAAAGAGAAAGG + Intergenic
1170727425 20:18942151-18942173 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
1171194339 20:23185882-23185904 GGGGGCAAGCTGAAGCAGGCCGG - Intergenic
1171486390 20:25489460-25489482 GGGAGTAAGGAGAAGGAGGGGGG - Intronic
1172300542 20:33846658-33846680 GGGTGTGAGTAGAAGGAGCATGG + Intronic
1172442601 20:34976732-34976754 GGGGGTCCCCAGAAAGAGGATGG + Intronic
1173048867 20:39539780-39539802 GGTGGAAAGCAGAAGGAGAGTGG - Intergenic
1173375422 20:42478203-42478225 GGGTGAAAGGAGAAGGGGGAAGG + Intronic
1173437184 20:43043918-43043940 TGGGATAAGCAGACAGAGGAAGG - Intronic
1173767750 20:45629642-45629664 AGGGGCAAGCAAAAAGAGGAAGG + Exonic
1173838302 20:46139746-46139768 GGAGTTAAGAAGCAGGAGGAGGG + Intergenic
1173980152 20:47217855-47217877 GGGGGCGAGCAGGGGGAGGAAGG - Intronic
1175126341 20:56754815-56754837 GGGGGTAGGGAGAAGGGGAAGGG - Intergenic
1175311334 20:58013674-58013696 GGAGCTGAGCTGAAGGAGGAAGG + Intergenic
1175657805 20:60787023-60787045 GGGAGAAAGGAGGAGGAGGAGGG - Intergenic
1175657846 20:60787159-60787181 GGAGGTAAGAAGAGGGAGGTGGG - Intergenic
1175817374 20:61890368-61890390 ATGGGTAAGCAGATGGTGGATGG + Intronic
1175871833 20:62212893-62212915 GGGGGTAAGGAGAGGGGGGATGG + Intergenic
1175871854 20:62212940-62212962 GGGGGTAAGGAGAGGGGGGATGG + Intergenic
1175871883 20:62213007-62213029 GGGGGTAAGGAGAGCGGGGATGG + Intergenic
1175871912 20:62213077-62213099 GGGGGTAAGGAGAGCGGGGATGG + Intergenic
1175871931 20:62213123-62213145 GGGGGTAAGGAGAGTGGGGATGG + Intergenic
1175871952 20:62213171-62213193 GGGGGTAAGGAGAGCGGGGATGG + Intergenic
1175871988 20:62213258-62213280 GGGGGTAAGGAGAGCGGGGATGG + Intergenic
1175871997 20:62213280-62213302 GGGGGTAAGGAGAGCGGGGATGG + Intergenic
1175872079 20:62213478-62213500 GGGGGTAAGGAGAGCGGGGATGG + Intergenic
1175872088 20:62213500-62213522 GGGGGTAAGGAGAGCGGGGATGG + Intergenic
1177042787 21:16133485-16133507 GTGGGTGAGCAGAAGCAGGGTGG - Intergenic
1177136296 21:17308446-17308468 GAGGGTGAGCCGAAGGAGGGTGG + Intergenic
1177540911 21:22493315-22493337 GCGGGCAAGCAGAAGCAGGGTGG + Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1177833566 21:26167248-26167270 GGGAGTAAGGGGAGGGAGGAGGG + Intronic
1178595818 21:33951419-33951441 GGGGCAAAGCAGAAGGTGGGAGG + Intergenic
1178748297 21:35274969-35274991 GAGGGAGAGCAGAAGGAGGTGGG - Intronic
1178752504 21:35318054-35318076 AGGGCTAAGCAGAAGAAGCATGG + Intronic
1179086588 21:38223825-38223847 GGTGGGAAGCAGAGGGAGGATGG - Intronic
1179111182 21:38446878-38446900 GGGGGCAAGGAGAAGGCAGATGG - Intronic
1179404100 21:41111200-41111222 GGGTTTAAGCAGAGGGAGGCAGG + Intergenic
1179414200 21:41185297-41185319 GGGGCTAAACAAATGGAGGAAGG + Intronic
1179501198 21:41810057-41810079 GGGGGTCTGCAGAGGGAGGTGGG + Intronic
1179787810 21:43739880-43739902 TGGGGTAAGGGGTAGGAGGAGGG - Intronic
1180540968 22:16447367-16447389 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
1180642177 22:17307798-17307820 GGGGTGCAGCAGAAGGAAGAAGG + Intergenic
1181438996 22:22926281-22926303 GGGGGTCAGCAGGGGGAGAAGGG - Intergenic
1181615621 22:24052220-24052242 AGGGCTAAGTAGAAGCAGGAGGG + Intronic
1181977362 22:26740400-26740422 GGAGGGACGCCGAAGGAGGAAGG + Intergenic
1182520315 22:30881211-30881233 GGGGGTAGGCAGAAGGGGCAGGG + Intronic
1182844835 22:33421834-33421856 GGGGGTAAGCAGGTGGAAGAGGG + Intronic
1182924459 22:34109287-34109309 GGTGATAAGCAGAAGGAGTGGGG - Intergenic
1184290953 22:43498008-43498030 GCAGGTAAGCAGAAGGAGAGAGG + Intronic
1184870002 22:47231830-47231852 GGGGGTAGGAACAAGGAGAAGGG - Intergenic
1184920417 22:47601618-47601640 GGAGGGATGGAGAAGGAGGAGGG - Intergenic
1184959365 22:47917906-47917928 GGGAGGAAGGAGAAGGAGGAAGG - Intergenic
1185243955 22:49763410-49763432 TGGGGGAAGAGGAAGGAGGAGGG + Intergenic
949456671 3:4246232-4246254 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
949632613 3:5944545-5944567 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
949954967 3:9259995-9260017 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
950030077 3:9846414-9846436 GGGGGTCAGCAGAGGCAGGATGG + Intronic
950174488 3:10863238-10863260 AGGGCTAAGTAGAAGGAGGAAGG + Intronic
950773365 3:15330028-15330050 GCAGGGAAGCAGAAGGAGGCGGG + Intronic
950991945 3:17449082-17449104 GAGGGTGAGCAGAAGCAGCATGG + Intronic
951741600 3:25931326-25931348 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
951826584 3:26875657-26875679 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
951850795 3:27138040-27138062 GGAGGGATGCTGAAGGAGGATGG + Intronic
952559483 3:34573956-34573978 GGAGGAAGGAAGAAGGAGGAAGG - Intergenic
952569235 3:34694471-34694493 GGGGGAAGGGAGAAGGAGGGAGG - Intergenic
952726827 3:36595314-36595336 GGGTGAAAGGAGAAGGAGAAAGG - Intergenic
952735908 3:36691369-36691391 GGGAGGCAGGAGAAGGAGGAAGG + Intergenic
952794031 3:37223200-37223222 GGGGGTAAGCAGGAGGGGGTTGG + Intergenic
953006892 3:38987234-38987256 GGGAGGAAGAAGAAAGAGGAGGG - Intergenic
953430498 3:42835882-42835904 TCGGGTGGGCAGAAGGAGGAAGG - Intronic
953555867 3:43946353-43946375 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
954038456 3:47866404-47866426 GAGGGGAAGAAAAAGGAGGAAGG + Intronic
954411764 3:50374121-50374143 GGAGGTAAGGGGAAGGAGGAAGG + Intronic
954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG + Intronic
954619649 3:51988311-51988333 GGAGGTAAGTAGACGGAGGGTGG + Intronic
954667481 3:52264683-52264705 GGAAGCAAGCAGAAAGAGGAAGG + Intronic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
954886587 3:53880792-53880814 GGAGCTAACCAGAGGGAGGAGGG - Intronic
955807991 3:62756903-62756925 GGAGGTATTCAGGAGGAGGAGGG + Intronic
956440904 3:69279690-69279712 GGGGAAGAGGAGAAGGAGGAGGG - Intronic
956440915 3:69279721-69279743 GGGGAAGAGGAGAAGGAGGAGGG - Intronic
956440926 3:69279752-69279774 GGGGAGGAGGAGAAGGAGGAGGG - Intronic
956737619 3:72250195-72250217 GGGGAGAAGCAGGAGGAGGCTGG + Intergenic
956784427 3:72630576-72630598 GGGGAGAAGCAGAAGGAAGAAGG + Intergenic
957025186 3:75173632-75173654 GGAGGCAAGCTGAAGGAGGAAGG + Intergenic
958094772 3:88929659-88929681 GAGGGCAAGCCGAAGGAGGGTGG + Intergenic
958154604 3:89740372-89740394 GGGGGGGAGGAGGAGGAGGAGGG + Intergenic
958163667 3:89851431-89851453 AGGGGAGAGGAGAAGGAGGAAGG + Intergenic
959034664 3:101346961-101346983 GGAGGAAAGGAGGAGGAGGAAGG + Intronic
959133902 3:102392558-102392580 GGGGGAAGGAGGAAGGAGGAAGG - Intronic
959256833 3:104025797-104025819 GGGGGAAAGAAGAAGAAGGAAGG + Intergenic
959345664 3:105191471-105191493 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
959453689 3:106533909-106533931 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
959534526 3:107470203-107470225 GAGGGTGAGCAGAAGAAGGGTGG + Intergenic
959542635 3:107557900-107557922 GGGGGAAAGCAGGATGAGGAGGG + Intronic
959941730 3:112087409-112087431 GGAGTTAATCAGAAGGTGGATGG - Intronic
960773236 3:121217477-121217499 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
960822865 3:121752891-121752913 GGGGGGAAAAAGAAGAAGGAAGG + Intergenic
961037780 3:123654661-123654683 GGGGGTTAGGAGAAGGTGGAGGG - Intronic
961485128 3:127210789-127210811 GGCGGTCAGCAGCAGGAGGTGGG + Intergenic
961749680 3:129087913-129087935 GGGGGGAAGCAGAGGGAGGTGGG - Exonic
961977431 3:131041947-131041969 GAGGGCGAGCAGAAGGAGGGTGG + Intronic
962156763 3:132956549-132956571 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
962203425 3:133417279-133417301 AGGGGTGAGCAGAAGGGAGAGGG - Intronic
963048531 3:141122914-141122936 GAGGGCAAGCGGAAGCAGGACGG - Intronic
963629376 3:147713457-147713479 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
963842048 3:150117689-150117711 GAGGGTCAGCCTAAGGAGGATGG - Intergenic
963928714 3:150979190-150979212 GGAGAGAAGCAGAAGGAGTAGGG + Intergenic
963994590 3:151693203-151693225 AATGGTAACCAGAAGGAGGAAGG - Intergenic
964391325 3:156201110-156201132 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
964650966 3:159010845-159010867 TGGGGTAGGCAGAGGGGGGACGG - Intronic
965172184 3:165279927-165279949 GAGGTGAAGAAGAAGGAGGAGGG - Intergenic
965221359 3:165931244-165931266 GAGGGTGAGCCGAAGGAGGGTGG + Intergenic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
966309322 3:178576191-178576213 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
966599046 3:181756870-181756892 GGGGGTGAACAGCTGGAGGAGGG + Intergenic
966908496 3:184544545-184544567 GGGGAGAAGGAGGAGGAGGAGGG - Intronic
967419653 3:189259293-189259315 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
967648605 3:191957467-191957489 GGAGGGATGGAGAAGGAGGAAGG + Intergenic
968581450 4:1397193-1397215 GGAGGTGAGCACAGGGAGGAAGG - Intergenic
968663700 4:1809655-1809677 GGAGGAGAGCAGAGGGAGGACGG - Intergenic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
968677890 4:1894933-1894955 TGGGGGAAGAAAAAGGAGGATGG - Intronic
969176353 4:5402022-5402044 GGGGATAAGCTCAAGGAGCAGGG - Intronic
969495330 4:7523089-7523111 GGGAGGAGGCAGAGGGAGGAGGG - Intronic
969497611 4:7535027-7535049 GTGTGTCAGCAGGAGGAGGAGGG - Intronic
969526052 4:7704648-7704670 GGGGCTGAGCAGAAGGAAGCCGG - Intronic
969596005 4:8149608-8149630 GGGGGCAGGCAGAAGGCGGCAGG + Intronic
969670262 4:8586236-8586258 GGGGGAAAGCAGCAGGGGGATGG - Intronic
970214605 4:13745665-13745687 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
970563420 4:17306138-17306160 GGCGGTAAGGTGCAGGAGGATGG + Intergenic
970679290 4:18489024-18489046 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
971089018 4:23317831-23317853 GGAGCTAAGAAGAAGGATGAGGG + Intergenic
971390541 4:26181428-26181450 GGAGGTATGGAGAGGGAGGAAGG - Intronic
971420251 4:26467893-26467915 GAGGGGAAGAAGAAGAAGGAGGG + Intergenic
972260945 4:37407878-37407900 GAGGGCGAGCAGAAGCAGGATGG + Intronic
972292689 4:37704609-37704631 GGTGGAAAGCAGAAGGTGTAGGG - Intergenic
972372531 4:38438493-38438515 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
972962661 4:44473557-44473579 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
973335794 4:48955350-48955372 GGAGGAAAGAGGAAGGAGGAAGG - Intergenic
973629023 4:52801797-52801819 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
973760386 4:54109671-54109693 GGGTGGACGCAGAGGGAGGAAGG + Intronic
974264060 4:59560900-59560922 GAGGGCAAGCAGAAGCAGGTGGG - Intergenic
974491717 4:62572211-62572233 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
975137926 4:70892598-70892620 GGAGGTTGCCAGAAGGAGGAAGG + Intergenic
975270381 4:72425475-72425497 TGGGGTAAGGGGAAGGGGGAGGG - Intronic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
975510841 4:75192761-75192783 TGGAGGGAGCAGAAGGAGGAAGG - Intergenic
975524168 4:75331146-75331168 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
975638700 4:76477821-76477843 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
976362981 4:84202471-84202493 GAGGGCCAGCAGAAGCAGGATGG + Intergenic
977536880 4:98263809-98263831 GGGGATAAGCAGAAACAGAAAGG + Intronic
977792852 4:101128592-101128614 GAGGGCAAGCAGAAGCAGGGCGG + Intronic
979012248 4:115387092-115387114 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
979421310 4:120508953-120508975 GAGGGAAAGCAGAAGCAGGGTGG + Intergenic
979474456 4:121138819-121138841 GGGGGTAAGCAGGATGAGTGAGG - Intronic
979543260 4:121910671-121910693 GGGGGTGAGGAGAAGAAAGAAGG + Intronic
979558945 4:122080470-122080492 AGGGGAAAGAAGAAAGAGGAGGG + Intergenic
979972894 4:127159601-127159623 GGGGGAAAGGAGATGGAGGAAGG + Intergenic
980494243 4:133570584-133570606 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
980654803 4:135767512-135767534 AGGGGTAAGGGGAAAGAGGAGGG + Intergenic
980717067 4:136640277-136640299 GGGGGAAACCAAAAGGGGGATGG - Intergenic
980769254 4:137350722-137350744 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
980888224 4:138786034-138786056 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
980894915 4:138852869-138852891 GGGAATAAGCAGATGGAGCAGGG + Intergenic
981044635 4:140253462-140253484 GGGGGTGGGGATAAGGAGGAAGG + Intergenic
981457149 4:144966037-144966059 GGGGGTAGGCAGCAAGGGGAGGG + Intergenic
981528839 4:145733306-145733328 GGGGGGAATCAGCAGGAGGAGGG - Intronic
981795031 4:148585892-148585914 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
982566416 4:156992501-156992523 AGGGGAAAGCAAAAGGAGCAAGG + Intergenic
982725682 4:158903272-158903294 GAGGGCAAGTAGAAGGAGGGTGG - Intronic
982794622 4:159630013-159630035 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
982815468 4:159878220-159878242 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
982825655 4:160001498-160001520 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
982915498 4:161203793-161203815 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
983047563 4:163005016-163005038 GAGGGCAAGCCGAAGCAGGATGG - Intergenic
983308210 4:166021368-166021390 GGAGGGAAGCAGAGGGAGGAAGG - Intronic
983840777 4:172455059-172455081 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
983932293 4:173465768-173465790 AGGGGGAAGCGGAGGGAGGAAGG - Intergenic
984526142 4:180861031-180861053 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
984702230 4:182825777-182825799 GGGGAAAGGGAGAAGGAGGAGGG - Intergenic
984703430 4:182833006-182833028 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703447 4:182833055-182833077 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703483 4:182833155-182833177 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703489 4:182833174-182833196 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703505 4:182833227-182833249 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703523 4:182833278-182833300 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703561 4:182833376-182833398 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703567 4:182833395-182833417 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703578 4:182833430-182833452 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703627 4:182833556-182833578 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703633 4:182833575-182833597 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703639 4:182833594-182833616 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703650 4:182833629-182833651 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703699 4:182833755-182833777 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703705 4:182833774-182833796 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703711 4:182833793-182833815 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703724 4:182833832-182833854 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703730 4:182833851-182833873 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703744 4:182833889-182833911 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703755 4:182833924-182833946 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703768 4:182833959-182833981 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703774 4:182833978-182834000 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703780 4:182833997-182834019 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703800 4:182834048-182834070 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703837 4:182834145-182834167 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703843 4:182834164-182834186 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703849 4:182834183-182834205 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703855 4:182834202-182834224 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703866 4:182834237-182834259 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703915 4:182834363-182834385 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703921 4:182834382-182834404 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703927 4:182834401-182834423 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703933 4:182834420-182834442 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703939 4:182834439-182834461 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703952 4:182834478-182834500 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703958 4:182834497-182834519 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703964 4:182834516-182834538 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703970 4:182834535-182834557 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703976 4:182834554-182834576 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703982 4:182834573-182834595 AGGGGAAAGGAGAAGGAGGAGGG - Intergenic
984924140 4:184791811-184791833 GGGTGTAAGCAGAAAGAAGGAGG + Intronic
985026459 4:185743979-185744001 GGGGGACAGGAGGAGGAGGAGGG - Intronic
985030414 4:185783650-185783672 CGGGGTAAGCAGAAGTAGACTGG + Intronic
985652281 5:1112560-1112582 GAGGGGGCGCAGAAGGAGGAGGG - Intergenic
986358458 5:6951964-6951986 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
986670571 5:10139530-10139552 GGTGGAGAGCAGAGGGAGGAAGG + Intergenic
986675110 5:10177546-10177568 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
987614524 5:20255132-20255154 GGAGGGAAGGAGAGGGAGGATGG + Intronic
988618130 5:32794853-32794875 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
988719121 5:33858855-33858877 GAAGGCAAGCAGAAGCAGGATGG + Intronic
988787619 5:34579138-34579160 GGGAGGAAGGAGAAGGAGAAAGG + Intergenic
989358114 5:40567359-40567381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
989451878 5:41596466-41596488 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
989630038 5:43472806-43472828 GGGGGTCAGCAGGGGGAGGTGGG + Intronic
990803426 5:59631592-59631614 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
991436048 5:66597439-66597461 GGGGGTAAGAGGCAGGAGTAGGG + Intronic
991501518 5:67281992-67282014 GGGGGAAGGGGGAAGGAGGAAGG - Intergenic
991501524 5:67282006-67282028 GGGGGAACGGAGAAGGGGGAAGG - Intergenic
991544344 5:67765015-67765037 GTGGGTGAGCAAAAGGAGAAAGG + Intergenic
991649989 5:68842804-68842826 GGTGGCATTCAGAAGGAGGATGG - Intergenic
992077767 5:73206913-73206935 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992093648 5:73340611-73340633 TGGGGGAGGCAGAAGGGGGATGG - Intergenic
992287207 5:75247990-75248012 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992376186 5:76190044-76190066 TGGTGGAAGCAGAAGGAAGATGG + Intronic
992383936 5:76265769-76265791 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
992740702 5:79770583-79770605 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
993492474 5:88568931-88568953 GTGGGTCGGCAGAAGGGGGAGGG + Intergenic
993879557 5:93346846-93346868 TGGGGTCAGGAGAAGGGGGAGGG - Intergenic
993904957 5:93612319-93612341 GGGGGTAAGGGGAAAGGGGAGGG + Intergenic
994014963 5:94955109-94955131 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
995069668 5:107904925-107904947 GGGGTGAAGCAGGAGGAGGAGGG + Intronic
995263860 5:110136247-110136269 GAGGGTGAGCAGAAGCAGGCTGG - Intergenic
995464339 5:112435843-112435865 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
995746957 5:115414315-115414337 GGGGGTAGGAAGCAGGAGGGAGG + Intergenic
995785182 5:115820122-115820144 GGGGATAACTAGAGGGAGGATGG - Intergenic
996096429 5:119404067-119404089 GGGGGCAAGGAGGAAGAGGAGGG - Intergenic
996428000 5:123335642-123335664 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
996491142 5:124098929-124098951 AGAGGTAAGCTGAAGGAAGAAGG + Intergenic
996910963 5:128656268-128656290 GAGGGGGAGCAGAAGCAGGATGG - Intronic
997262389 5:132475067-132475089 GGGGGTGTGGAGATGGAGGAGGG + Intronic
997809608 5:136954339-136954361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
998392673 5:141797425-141797447 GGGTGTGAGAAGAAGCAGGAGGG - Intergenic
998565017 5:143209308-143209330 GGAGGTAGGAAGAAGTAGGAAGG - Intronic
998620932 5:143793564-143793586 CCTGGTAAGCAGAAGGAGAATGG - Intergenic
1000194858 5:158947487-158947509 GAGGGCGAGCAGAAGCAGGACGG - Intronic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000574791 5:162964661-162964683 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1001132891 5:169079491-169079513 GGGGGGAGGGAGGAGGAGGAAGG + Intronic
1001320940 5:170680928-170680950 GGAGGGAGGCAGAAAGAGGAAGG + Intronic
1001801502 5:174548234-174548256 GAGGGTGAGGAGAAGGAAGAAGG - Intergenic
1001981130 5:176037627-176037649 GGTGGTAAGGAGGAGTAGGAAGG + Intergenic
1002002555 5:176206272-176206294 TGGTGAAAGCAGAAGGAAGAGGG + Intergenic
1002017917 5:176340556-176340578 GGGGAAAAGCAGAAGCAGGTAGG + Intronic
1002236330 5:177806439-177806461 GGTGGTAAGGAGGAGTAGGAAGG - Intergenic
1002434990 5:179225740-179225762 GGGGGAAGCCAGAAGGAGGATGG - Intronic
1002812811 6:649595-649617 GGGGATAACCAGAACTAGGAGGG + Intronic
1002929845 6:1625459-1625481 TGGGGAAAGCGGGAGGAGGAAGG - Intronic
1003064864 6:2895257-2895279 GTGGGTGAGGAGAGGGAGGAGGG + Intronic
1003381918 6:5632570-5632592 GGGGGAAGGGGGAAGGAGGAAGG - Intronic
1003487847 6:6595217-6595239 GGGGAAAAGGAGTAGGAGGAGGG + Intronic
1003528258 6:6916540-6916562 GAAGGAAAGCAGAAGGAGGCAGG + Intergenic
1003637519 6:7846510-7846532 GGGGAAACACAGAAGGAGGAAGG + Intronic
1004042450 6:11993889-11993911 GGGAGAAAACAGAAGCAGGAGGG + Intergenic
1004751371 6:18565769-18565791 GGAGGGAAGAAGAAGGAGGGAGG - Intergenic
1004944549 6:20596937-20596959 GGGGGCAAGCCGAAGCAGGGCGG - Intronic
1005120096 6:22380120-22380142 GGGGATACAGAGAAGGAGGAGGG - Intergenic
1005773319 6:29099934-29099956 GGAGGGGAGCAGAAGGGGGATGG + Intergenic
1005778437 6:29162307-29162329 GAGGGCAAGCAGAAGAAGGGTGG - Intergenic
1005779369 6:29172408-29172430 GGAGGGGAGCAGAAGGGGGATGG + Intergenic
1006361173 6:33588236-33588258 GGGGATGAGAAGAAGGAGGAGGG - Intergenic
1006373765 6:33660448-33660470 GGAGGTAAGAAGGATGAGGAGGG - Intronic
1006473279 6:34239997-34240019 AGGGGTAAGGGGAAAGAGGAGGG + Intronic
1006592448 6:35168530-35168552 GGGGGAAAGCAGAAAGATGCAGG - Intergenic
1006735067 6:36267710-36267732 AAGGGTAAGCAGGCGGAGGAGGG - Intronic
1007339891 6:41184570-41184592 TGGGGTAGGGAGAAGGGGGAGGG + Intergenic
1007694843 6:43725511-43725533 CGTGGCAAACAGAAGGAGGAAGG - Intergenic
1007962204 6:45970069-45970091 GGGGGTGAGGAGAGGGAGGAAGG - Intronic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1008413065 6:51205848-51205870 GGGGGTGTGTAGAAAGAGGAAGG + Intergenic
1008737117 6:54558405-54558427 GGGGGTAGGGGGAAAGAGGAGGG + Intergenic
1009264031 6:61531638-61531660 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
1009305982 6:62089522-62089544 GAGGGCGAGCAGAAGGAGGGTGG - Intronic
1009455181 6:63848530-63848552 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
1009729437 6:67580883-67580905 GGGGCCAACCAGAAGGTGGAGGG - Intergenic
1009988155 6:70806476-70806498 GAGGGTGAGCTGAAGGAGGGCGG - Intronic
1010042073 6:71396768-71396790 AGGGGTAGGAAGAGGGAGGAGGG - Intergenic
1010574870 6:77518357-77518379 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1010615280 6:78005471-78005493 GAGGGCAAGCAGAAGTAGGGTGG + Intergenic
1011235656 6:85213452-85213474 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1011753117 6:90473103-90473125 TGGGCTGAGCAGAAGGAAGAGGG - Intergenic
1011831315 6:91374987-91375009 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1011832155 6:91387183-91387205 GGGGTAAAGAAGAAGGAGAACGG + Intergenic
1012577602 6:100822008-100822030 GGGGGTAGGGAGAAGGAGAATGG + Intronic
1013183961 6:107741298-107741320 GGTGCTAAGCAGATGGAGGGAGG - Intronic
1013190591 6:107801715-107801737 GGGGGTTAGCACATGGAGGGTGG + Intronic
1013682506 6:112541095-112541117 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1013920239 6:115394892-115394914 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1013972687 6:116039805-116039827 GGGTGTAAGAAGGAAGAGGATGG - Intronic
1014107334 6:117582249-117582271 GGGGGGAGGCAGAGGGAGGGAGG - Intronic
1014134386 6:117871268-117871290 GGGGGCAAGCGGAAGGAGTGGGG + Intergenic
1014243056 6:119039610-119039632 GGGGTTGAGGAGAGGGAGGAAGG + Intronic
1014358232 6:120438557-120438579 TGGGGTGAGGGGAAGGAGGAGGG + Intergenic
1014527905 6:122522706-122522728 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1014771496 6:125462948-125462970 GGTGGTAAGATGTAGGAGGAGGG + Intergenic
1015121368 6:129704897-129704919 AGGGGTCAGGATAAGGAGGAGGG - Intronic
1015338943 6:132075211-132075233 GGTGGAAAGCAGAAGGAATAAGG - Intergenic
1015510893 6:134037313-134037335 GAGGGTAAGCCTATGGAGGAGGG - Intronic
1015648664 6:135427502-135427524 GGTAGAAAGTAGAAGGAGGAGGG - Intronic
1016995921 6:149962578-149962600 GGAGGAAGGCAGAAGGAGGCTGG - Intergenic
1017103306 6:150866425-150866447 GGGGGCGAGGAGCAGGAGGAGGG + Intronic
1017150031 6:151271278-151271300 GGGGGTAAGCAGAAGAATGTAGG - Intronic
1017357039 6:153521464-153521486 GAGGGTGAGCTGAAGCAGGAGGG - Intergenic
1017449684 6:154542968-154542990 GGGGGGAAGCCGTGGGAGGAAGG - Intergenic
1017949085 6:159120379-159120401 GGAGCAAAGGAGAAGGAGGAAGG - Intergenic
1018108628 6:160513532-160513554 GAGGGTTAGCAGAAGCAGGCTGG + Intergenic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018399778 6:163411414-163411436 TGGGGTAAGCAGATGGAAGAAGG + Intergenic
1018471362 6:164101175-164101197 GGGGGGCTGCAGATGGAGGAGGG - Intergenic
1018471369 6:164101195-164101217 GGGGGGCTGCAGATGGAGGAGGG - Intergenic
1018471391 6:164101257-164101279 GGGGGGCTGCAGATGGAGGAGGG - Intergenic
1018573444 6:165233941-165233963 GGAGGGAAGCAGAGGCAGGAAGG - Intergenic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1019071976 6:169354150-169354172 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019484085 7:1280526-1280548 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1019484088 7:1280543-1280565 GGAAGGAAGAAGAAGGAGGAAGG + Intergenic
1019484100 7:1280601-1280623 GGGAGAAGGAAGAAGGAGGAAGG + Intergenic
1019484153 7:1280881-1280903 GGGAGAAGGAAGAAGGAGGAAGG + Intergenic
1019484182 7:1281034-1281056 GGGAGAAGGAAGAAGGAGGAAGG + Intergenic
1019549245 7:1594006-1594028 GAGGGAAAGAAGAAGGAGGAGGG - Intergenic
1019688842 7:2398387-2398409 GGGGATCAGCTGAAGGAGGAAGG - Intergenic
1019776113 7:2913000-2913022 GGAGGGAAGAAGAGGGAGGAGGG + Intronic
1020011402 7:4807704-4807726 GGGGAGAAGGAGAGGGAGGAGGG - Intronic
1020339071 7:7089572-7089594 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1020416931 7:7957158-7957180 GGGGGTGAGAAGAAGTTGGAAGG + Intronic
1020715974 7:11675113-11675135 GAGGGCAAGCAGAAGCAGGTGGG + Intronic
1020823930 7:13003261-13003283 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1021347751 7:19548540-19548562 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1022037814 7:26550591-26550613 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1022058930 7:26770750-26770772 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1023003721 7:35840138-35840160 GGGGGAAGGGGGAAGGAGGAAGG - Intronic
1023271706 7:38470114-38470136 GGGGATCAGGACAAGGAGGAAGG - Intronic
1023511707 7:40959969-40959991 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1023878683 7:44306727-44306749 GGGTGTGGGCAGGAGGAGGAGGG + Intronic
1023878724 7:44306865-44306887 AGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878754 7:44306982-44307004 GGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878769 7:44307042-44307064 GGCGGTGAGCAGGGGGAGGAGGG + Intronic
1023878793 7:44307119-44307141 GGGTGTGAGCAGGGGGAGGAGGG + Intronic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878806 7:44307179-44307201 GGGTGTGAGCAGAGAGAGGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878835 7:44307296-44307318 GGGTGTGAGCAGGCGGAGGAGGG + Intronic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1023894230 7:44418771-44418793 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1024017643 7:45332692-45332714 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1024233103 7:47377767-47377789 GGGGAGAAGGAGAAGGAGGGAGG - Intronic
1024664993 7:51537073-51537095 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1024702931 7:51924369-51924391 GGGGGTAGGGGGAAAGAGGAGGG - Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026523336 7:71134392-71134414 AGGGGCAGGGAGAAGGAGGATGG + Intronic
1026678351 7:72446940-72446962 GAGGAAAAGCAGAAGGGGGAAGG + Intronic
1026771569 7:73204251-73204273 GGGAGTAAACAGAAGGATAAGGG + Intergenic
1026998012 7:74631824-74631846 AGGGGTAACGGGAAGGAGGATGG - Intergenic
1027012435 7:74757647-74757669 GGGAGTAAACAGAAGGATAAGGG + Intronic
1027075605 7:75188406-75188428 GGGAGTAAACAGAAGGATAAGGG - Intergenic
1027261258 7:76466043-76466065 GGGGAAAAGGAGAATGAGGAAGG + Intronic
1027312642 7:76964151-76964173 GGGGAAAAGGAGAATGAGGAAGG + Intergenic
1028872710 7:95786761-95786783 GGGGCCAAGGGGAAGGAGGATGG - Intronic
1029067194 7:97862445-97862467 GGGGGTTAGGAGGAAGAGGACGG + Intronic
1029248707 7:99220855-99220877 GGGGGAAAGGAGAGGGAAGAAGG + Intergenic
1029371068 7:100151028-100151050 GGTGGTAAGAAGGAGGAGCAAGG + Intronic
1030021424 7:105278747-105278769 AGGGGAAGGCAGAAGGCGGAAGG + Intronic
1030103482 7:105967095-105967117 TGGGGTGAGGGGAAGGAGGAGGG - Intronic
1030482225 7:110119552-110119574 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1031613852 7:123857477-123857499 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1031759904 7:125699467-125699489 GGGAGGAAGCAGAAGTAAGAAGG + Intergenic
1032253008 7:130273715-130273737 GGTCGTATGCAGAAGGATGATGG + Intronic
1032432760 7:131875358-131875380 GAGGTTAAGCATAAGGAGGAAGG - Intergenic
1032476019 7:132211922-132211944 GGAGGTCAGAAGAAGGAGGGTGG + Intronic
1032659834 7:133970640-133970662 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1032678676 7:134158890-134158912 GAGGGTAAGAAGTAGGAGAAAGG - Intronic
1032893225 7:136222315-136222337 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1032957201 7:136984741-136984763 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1033133342 7:138764223-138764245 AGGGGAAAGGAGATGGAGGAGGG + Intronic
1034314402 7:150116928-150116950 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1034431483 7:151043399-151043421 GGGGGTCAGAGGCAGGAGGAGGG + Intronic
1034431558 7:151043710-151043732 GGGGGTCAGAGGCAGGAGGAGGG + Intronic
1034431570 7:151043748-151043770 GGGGGTCAGAGGCAGGAGGAGGG + Intronic
1034431595 7:151043825-151043847 GGGGGTCAGAGGCAGGAGGAGGG + Intronic
1034633936 7:152552475-152552497 GGGGGTGAGCAAGAGGAAGAAGG + Intergenic
1034792493 7:153983841-153983863 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1034945454 7:155259071-155259093 GGAGGGAAGGAGGAGGAGGAGGG - Intergenic
1034945460 7:155259088-155259110 GGAGGGAAGGAGGAGGAGGAGGG - Intergenic
1034945466 7:155259105-155259127 GGAGGGAAGGAGGAGGAGGAGGG - Intergenic
1035141462 7:156766698-156766720 GTGGGCAAGCAGGAGGAGCAGGG + Intronic
1035793982 8:2336757-2336779 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1035798823 8:2384951-2384973 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1035946742 8:3971667-3971689 GGGGGTACTCAGAGGGAGAAAGG + Intronic
1035998403 8:4574419-4574441 GAGGGTAAGCAGAAGAAGGGTGG - Intronic
1036381178 8:8237442-8237464 GGGGGCTTGCAGCAGGAGGAGGG + Intergenic
1036767263 8:11556884-11556906 CGGGCTTAGCAGGAGGAGGAGGG + Intronic
1037065233 8:14568233-14568255 GGGGGTGGGGAGAAAGAGGAGGG + Intronic
1037285559 8:17294725-17294747 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1037635104 8:20694554-20694576 AGGGGTGAGCAGGAGGAGAAAGG - Intergenic
1037656173 8:20886042-20886064 GGAGGGAAGGAGAGGGAGGAGGG + Intergenic
1038034082 8:23672303-23672325 GGAGCAAAGGAGAAGGAGGAGGG - Intergenic
1038311601 8:26449646-26449668 AGGGGTGAGCAGGAGGAGGGAGG + Intronic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1039043478 8:33429578-33429600 GGGGGAGGGCAGATGGAGGAAGG + Intronic
1039774080 8:40718645-40718667 GAGGGAAAGAAGAAGGAGGCTGG - Intronic
1039836238 8:41258551-41258573 GGGGGTGGGAAGAAGGAGAAAGG - Intergenic
1040546445 8:48401633-48401655 AGGGGTAGGAGGAAGGAGGAGGG + Intergenic
1040968890 8:53112787-53112809 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1041011445 8:53547598-53547620 GAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1041172288 8:55156419-55156441 GGGGGTGGGGAGAGGGAGGAAGG + Intronic
1041207242 8:55511425-55511447 GGGGGAAGGCAGAAGGTAGAGGG - Intronic
1041342758 8:56863419-56863441 GGGGAAAAAGAGAAGGAGGAGGG + Intergenic
1041401366 8:57448750-57448772 GAGGGGGAGGAGAAGGAGGAGGG - Intergenic
1041419160 8:57647278-57647300 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1041630658 8:60083230-60083252 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1041717147 8:60942756-60942778 GGGGGTGAACACCAGGAGGATGG + Intergenic
1041900718 8:62979009-62979031 GAGGGCAAGCAGAAGCAGGGTGG - Exonic
1042627244 8:70771208-70771230 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1042852748 8:73233107-73233129 AGTGGGAAGAAGAAGGAGGAAGG - Intergenic
1042969386 8:74391475-74391497 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1043036749 8:75208635-75208657 GAAGGTGAGCAGAAGCAGGATGG - Intergenic
1043253749 8:78106872-78106894 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044405189 8:91818602-91818624 GGAGGCAAGCAGAAGCAGGATGG + Intergenic
1044509559 8:93058759-93058781 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044591579 8:93917711-93917733 GGGGGGAAGAGGATGGAGGAGGG - Intronic
1044595354 8:93953565-93953587 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1044940346 8:97335434-97335456 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1045185265 8:99830895-99830917 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1045233088 8:100324824-100324846 GGAGGGAGGAAGAAGGAGGAAGG - Intronic
1045291400 8:100835634-100835656 GGAGGGATGCTGAAGGAGGAAGG - Intergenic
1045390499 8:101710120-101710142 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1046014550 8:108589901-108589923 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1046153560 8:110258200-110258222 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1046351530 8:113020809-113020831 GGGGAACAGTAGAAGGAGGATGG + Intronic
1046357930 8:113112010-113112032 GGGAGTAAGAAGAAGAAGAAGGG - Intronic
1046776010 8:118164114-118164136 GAGGGAGAGCAGCAGGAGGAAGG + Intergenic
1047016127 8:120725145-120725167 GGAGGTAAGTGGAAAGAGGATGG + Intronic
1047203695 8:122786700-122786722 GGGGGGAGGCAGAAGGGGAATGG - Intronic
1047403212 8:124563048-124563070 AGTGGTAAGAGGAAGGAGGAAGG + Intronic
1047485834 8:125330032-125330054 GTGGGTAAGCTACAGGAGGAAGG + Intronic
1047500686 8:125438503-125438525 GGGGGTGAGCAGCAAGGGGAAGG + Intergenic
1047907008 8:129483149-129483171 GGGGGAAGGGGGAAGGAGGAAGG + Intergenic
1048073030 8:131040936-131040958 GGGGCAAAGAAGGAGGAGGAGGG + Exonic
1048115486 8:131517197-131517219 GAGGGTAAGCAGAAGGATGCAGG - Intergenic
1048518916 8:135136116-135136138 GAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1048679919 8:136829881-136829903 GGGTTTTAGCAGGAGGAGGAGGG + Intergenic
1048861410 8:138726938-138726960 TGGGGTGACCAGAGGGAGGAAGG + Intronic
1048898386 8:139015349-139015371 GGAGGTGAGAAGCAGGAGGAGGG + Intergenic
1049215590 8:141406412-141406434 GGGTGGCAGCAGAAAGAGGACGG - Intronic
1049226957 8:141458318-141458340 GGTGGTAAGCAAAAGGATTATGG - Intergenic
1049457914 8:142703322-142703344 GGAGGCCAGCAGCAGGAGGATGG - Exonic
1049533931 8:143169361-143169383 GAGGGTAAGCAGTAGGATGATGG - Intergenic
1050092721 9:2031711-2031733 GGGGCCAAGGAGAAGCAGGATGG - Intronic
1050132467 9:2426991-2427013 GGGTGTAATGAGAAGGATGACGG + Intergenic
1050515893 9:6444321-6444343 GATGGTAATCAAAAGGAGGAAGG + Intronic
1050640579 9:7663046-7663068 GGGAGTAAGAAGAAAAAGGAAGG - Intergenic
1050985637 9:12078657-12078679 GGGGGTGGGGGGAAGGAGGAGGG - Intergenic
1051452057 9:17207635-17207657 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1051695895 9:19767597-19767619 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1052114913 9:24638879-24638901 TGGGGTAGGCAGAGGGGGGAGGG - Intergenic
1052144127 9:25026158-25026180 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1052205497 9:25834809-25834831 GGGGGTAAGGAAAATGATGAGGG - Intergenic
1052366278 9:27615214-27615236 GAGGGTGAGCAGAAGTAGGGTGG - Intergenic
1052506284 9:29358808-29358830 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
1052901518 9:33798094-33798116 GGGGGGAAGTAGAAGGACAAAGG - Intronic
1052947344 9:34179023-34179045 GGCGGTGAGGGGAAGGAGGAGGG + Exonic
1053007790 9:34615461-34615483 GGGGGTAGGTAGAAGGCAGAAGG + Intronic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053441621 9:38120958-38120980 GAGGGGGAGGAGAAGGAGGAGGG + Intergenic
1053654126 9:40197930-40197952 GGTGGTGAGCAGCAGGAGTAGGG + Intergenic
1054366240 9:64344146-64344168 GGTGGTGAGCAGCAGGAGTAGGG + Intergenic
1054673871 9:67833876-67833898 GGTGGTGAGCAGCAGGAGTAGGG + Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055339053 9:75262234-75262256 GAAGGTGAGCAGAAGCAGGATGG - Intergenic
1055345124 9:75327443-75327465 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1055398607 9:75899530-75899552 CGGGGTGAGGAGAGGGAGGAGGG - Intronic
1055581479 9:77711145-77711167 GAGGGGAAGGGGAAGGAGGAGGG - Intergenic
1055628676 9:78200799-78200821 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1055708252 9:79031885-79031907 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1055792235 9:79935203-79935225 ATGGGTAAGCAAAAGGAGCAGGG + Intergenic
1055823970 9:80301562-80301584 GAGGGCGAGCAGAAGCAGGATGG - Intergenic
1056165547 9:83937409-83937431 GAAGGGAAGAAGAAGGAGGAGGG + Intergenic
1056385227 9:86091052-86091074 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1057175375 9:92993606-92993628 TGGGGTAAGGGGAGGGAGGAGGG - Intronic
1057226654 9:93296431-93296453 GGGAGGATGGAGAAGGAGGAAGG - Intronic
1057490081 9:95513790-95513812 GGGAGGAAACAGAAGGTGGAAGG - Intronic
1058069276 9:100585199-100585221 GAGGGAATGAAGAAGGAGGAGGG + Intronic
1058190940 9:101914892-101914914 GGGGGTTGGGAGAAGGGGGATGG + Intergenic
1058265712 9:102897255-102897277 GAGGGTGAGCAGAAGCAGGGAGG + Intergenic
1058785897 9:108386434-108386456 GGGGGAAAGGAAAAGAAGGAAGG + Intergenic
1058869666 9:109191065-109191087 TGGGGGAAGCAGATGGAGGGAGG + Intronic
1059350635 9:113662460-113662482 GGGGGGCAGGAGAAGGAGGCAGG - Intergenic
1059354226 9:113687062-113687084 GGAGGGAAGAAGGAGGAGGAAGG + Intergenic
1060035275 9:120250205-120250227 GAGGGTACGTAGAAGGAGGATGG - Intergenic
1060368377 9:123043634-123043656 GGGGGTGAGGGGAAGGAGGGTGG + Intronic
1060720915 9:125976787-125976809 GGAGGGAAGGAGAGGGAGGAAGG - Intergenic
1061390605 9:130315315-130315337 GGGGGAGGGCAGAGGGAGGAGGG - Intronic
1061637119 9:131919102-131919124 GGGAGTAGGGAGAAGGAGGATGG + Intronic
1061808280 9:133148476-133148498 GGGGGAAAGAAGAAAGAGGGCGG - Intronic
1061811965 9:133167417-133167439 GGGGGTGGGCAGCAGCAGGAGGG + Intergenic
1062095176 9:134699433-134699455 GGGAGGAAGCAGAGAGAGGAAGG - Intronic
1062097897 9:134712219-134712241 GGGGATAAGAAGAAGGGGGCAGG - Intronic
1062159514 9:135072410-135072432 GGGGCTAAGGGGAAGGAGGTTGG - Intergenic
1062425910 9:136506068-136506090 GGGGGTCGGGAGATGGAGGAAGG + Intronic
1062469707 9:136697013-136697035 AGGGGGAAGGAGGAGGAGGAGGG - Intergenic
1062480954 9:136751086-136751108 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1062571420 9:137187431-137187453 GCGGGGAACCAGAAGGAGCAAGG + Intronic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638390 9:137503515-137503537 AGGAGGAAGGAGAAGGAGGAGGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1203774287 EBV:64052-64074 GGGAGGAAACAGGAGGAGGAGGG + Intergenic
1185485846 X:481525-481547 GGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485914 X:481752-481774 GGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485936 X:481820-481842 GGGAGGAAGGAGACGGAGGAAGG + Intergenic
1185485956 X:481894-481916 GGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185868063 X:3640165-3640187 AGGGGCAAGCAGAAGAAAGAAGG + Intronic
1186017818 X:5217994-5218016 AGGGGTAGAGAGAAGGAGGAGGG + Intergenic
1186299602 X:8185419-8185441 GGGTGAATGCAGAATGAGGATGG + Intergenic
1186497840 X:10026034-10026056 GGGTGTAGGGAGAAGGAAGAGGG - Intronic
1186659193 X:11651280-11651302 GAGGGTGAGCAGTGGGAGGAGGG - Intronic
1186688623 X:11951591-11951613 GAGGGTGAGCAGTGGGAGGAGGG + Intergenic
1186735840 X:12463070-12463092 TGTGGTAAGCTGAGGGAGGATGG + Intronic
1186773393 X:12839656-12839678 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1186832432 X:13404141-13404163 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1187248408 X:17574671-17574693 GAGGGTGAGCCGAAGCAGGATGG - Intronic
1187316768 X:18203126-18203148 TGGGGGAAGGAAAAGGAGGATGG + Intronic
1187660759 X:21544734-21544756 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1188915539 X:35905161-35905183 GAGAGTGAGCAGAAGCAGGATGG - Intergenic
1189175533 X:38953616-38953638 AGGGGGAAGCAGCAGCAGGAAGG - Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189289710 X:39876494-39876516 GGGGGCAAGGAGAGGGAGAAGGG + Intergenic
1189292288 X:39894918-39894940 GGGAGGCAGAAGAAGGAGGAGGG - Intergenic
1189532760 X:41903274-41903296 GGGAGACGGCAGAAGGAGGAAGG + Intronic
1190058119 X:47193935-47193957 GGGGAGGAGGAGAAGGAGGAGGG + Exonic
1190734466 X:53246897-53246919 GGGGGTAAGGGGAAGGATGCAGG - Intronic
1190963805 X:55278395-55278417 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191003836 X:55689100-55689122 GAGGGTAAGCCGAAGCAGGGTGG - Intergenic
1191004996 X:55702268-55702290 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191094428 X:56659427-56659449 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1191108379 X:56786596-56786618 AGGAGAAAGAAGAAGGAGGAGGG - Intergenic
1191119660 X:56890468-56890490 GAGTGTAAGCAGAAGCAGGATGG + Intergenic
1191129853 X:56995794-56995816 GGTGGAAAGCAGAAGGGGCAGGG - Intergenic
1191148181 X:57190691-57190713 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1191174241 X:57482534-57482556 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191194346 X:57705526-57705548 GTGGGCAAGCAGAAGCAGGGTGG + Intergenic
1191591253 X:62887957-62887979 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191606165 X:63065475-63065497 GAGGGGAAGCAGAAGCAGGGTGG + Intergenic
1191657374 X:63613313-63613335 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1191675230 X:63785687-63785709 GGGAGTATGCAGAGGGAGGGTGG - Intergenic
1191676556 X:63797624-63797646 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191802632 X:65098592-65098614 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1191809865 X:65175174-65175196 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1191987306 X:66995435-66995457 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192129063 X:68530761-68530783 GGGGGTGAGCTGAAGCAGGGTGG - Intronic
1192430754 X:71109998-71110020 GGGGGAAAGGAGTTGGAGGAGGG + Intronic
1192438080 X:71154899-71154921 GGGGGGCAGCAGAAAGAGGAAGG - Intronic
1192496678 X:71620913-71620935 GGAGGTAAGCTGCAGGGGGAGGG - Intergenic
1192589405 X:72347350-72347372 GGAAGTAAGGAGGAGGAGGAGGG - Intronic
1192703246 X:73498409-73498431 GAGGGTGAGCTGAAGTAGGATGG - Intergenic
1192724434 X:73733206-73733228 GGGGGTAGGGAGAAAGGGGAGGG - Intergenic
1192759273 X:74078346-74078368 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1192980292 X:76332183-76332205 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1193019981 X:76781082-76781104 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193040540 X:76999266-76999288 CAGGGTAAGCAGAAGTAGGGTGG - Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193228498 X:79013712-79013734 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1193254102 X:79325977-79325999 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1193341384 X:80352970-80352992 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1193398182 X:81010527-81010549 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193404398 X:81083781-81083803 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1193514314 X:82445443-82445465 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1193645627 X:84065963-84065985 GAGGGTGAGCAGAAGTAGGGTGG + Intronic
1193797936 X:85899252-85899274 GGGGGTAAGGAGAAAGAAGAGGG + Intronic
1193897181 X:87128461-87128483 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1194143022 X:90228621-90228643 AGAGGCAAGCAGAAGGAGAAGGG - Intergenic
1194203193 X:90979359-90979381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194315371 X:92369793-92369815 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1194631539 X:96291548-96291570 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1194643487 X:96429882-96429904 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1195140021 X:101950016-101950038 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1195435996 X:104843688-104843710 GAGAGCAAGCAGAAGCAGGATGG - Intronic
1195519535 X:105815189-105815211 GGGGGTTAGGAAAAGGAGGCAGG - Intergenic
1195810708 X:108825504-108825526 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1195820952 X:108944660-108944682 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1196058100 X:111377779-111377801 GGAGGAAGGAAGAAGGAGGAAGG - Intronic
1196133315 X:112181025-112181047 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1196224175 X:113146104-113146126 GGGGCTAAGAAGATGGAAGAAGG - Intergenic
1196411417 X:115424157-115424179 GTGGGTAAGGAAATGGAGGAAGG - Intergenic
1196603049 X:117623388-117623410 GAGGGTCAGCAGAAGCAGGGTGG - Intergenic
1196657333 X:118232206-118232228 GGGAGGAAGAGGAAGGAGGAGGG + Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197614400 X:128675351-128675373 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1197968805 X:132093696-132093718 TGGGGTAAGCAGAGGGAGTGGGG + Intronic
1198576357 X:138014053-138014075 GGTGGGAAGAAGAAAGAGGAAGG + Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1198757936 X:140000755-140000777 GAGGGCAAGCAGAAGTAGGGTGG + Intergenic
1198944624 X:141996603-141996625 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1199297049 X:146171219-146171241 AGGAGAAAGGAGAAGGAGGAAGG - Intergenic
1199710226 X:150463779-150463801 GGTGGCAAGCAGCAGGAGGCAGG + Intronic
1199794238 X:151179468-151179490 AGGGGGAGGGAGAAGGAGGAGGG - Intronic
1200405949 Y:2811580-2811602 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
1200488775 Y:3797940-3797962 AGAGGCAAGCAGAAGGAGAAGGG - Intergenic
1200549026 Y:4554785-4554807 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1200623420 Y:5481328-5481350 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1200796175 Y:7343182-7343204 GGGGGCAAGCAGAAGAAAGAAGG - Intergenic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201543145 Y:15131532-15131554 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1201710941 Y:16990914-16990936 TGGGGTGAGGGGAAGGAGGAGGG + Intergenic
1201922123 Y:19245213-19245235 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic