ID: 1023880808

View in Genome Browser
Species Human (GRCh38)
Location 7:44320286-44320308
Sequence TTTGGGCACCTGTCCTTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023880808_1023880814 7 Left 1023880808 7:44320286-44320308 CCGGCCAAGGACAGGTGCCCAAA 0: 1
1: 0
2: 2
3: 8
4: 166
Right 1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG 0: 2
1: 0
2: 1
3: 11
4: 88
1023880808_1023880816 25 Left 1023880808 7:44320286-44320308 CCGGCCAAGGACAGGTGCCCAAA 0: 1
1: 0
2: 2
3: 8
4: 166
Right 1023880816 7:44320334-44320356 GCTGGCCATGAGTCAGCCAGTGG 0: 1
1: 0
2: 1
3: 16
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023880808 Original CRISPR TTTGGGCACCTGTCCTTGGC CGG (reversed) Intronic
900512436 1:3067023-3067045 GTTGGGAACCTGCCCTTGGCGGG + Intergenic
900540660 1:3201061-3201083 TTTGGGCAGCTGGCCTTCCCCGG - Intronic
901006257 1:6173040-6173062 GTGGGGTCCCTGTCCTTGGCAGG - Intronic
901229415 1:7633608-7633630 AGGGGGCACCTGGCCTTGGCTGG - Intronic
902807212 1:18868612-18868634 ATTGGGCACCTCACCCTGGCAGG + Intronic
903951749 1:26999659-26999681 CTTGGGCCTTTGTCCTTGGCTGG - Intronic
903975780 1:27149131-27149153 GTTGGGCACATGTCGTTGGTGGG - Intronic
903990066 1:27260972-27260994 TTTGTGGACCTGGGCTTGGCTGG + Exonic
904343290 1:29852083-29852105 TTTGGCCACATGCCCTTCGCAGG - Intergenic
904623239 1:31788220-31788242 TTTGGGCAACTATCCCTGGACGG - Intergenic
904837317 1:33347778-33347800 TTTTGGCACCTGCCCTTTCCAGG - Intronic
906097464 1:43234064-43234086 CTTGTGCACCTGCCCTCGGCTGG - Intronic
910532118 1:88249502-88249524 TTGGAGCAACTGGCCTTGGCTGG - Intergenic
911838271 1:102649064-102649086 TTTGGGTACCTGCCAATGGCTGG - Intergenic
912573035 1:110638403-110638425 TGTGGGCACCTGTCCCTGAGGGG + Intergenic
915979624 1:160411602-160411624 TTTTGGCACCTGTGTTTGGTAGG + Intronic
918170102 1:181988376-181988398 TGCTGGCCCCTGTCCTTGGCAGG - Intergenic
920533389 1:206721651-206721673 TTTGGCCAGTTGTCCCTGGCAGG - Intronic
1064565878 10:16638528-16638550 TTGGGGCCCCTGTCCTTGTGCGG - Intronic
1067798275 10:49336759-49336781 TTTGGCCTCCTTTTCTTGGCAGG - Intergenic
1068401356 10:56531769-56531791 TTTGGGGGCCTGTCCTGGGGTGG + Intergenic
1070311775 10:75279031-75279053 TTTGGGAAGCTGTCTGTGGCTGG + Intergenic
1073462309 10:103672965-103672987 TTTGGGTCCCTGTATTTGGCCGG - Intronic
1075708702 10:124518720-124518742 TAGGGGCACCTGGCCTGGGCTGG - Intronic
1076536663 10:131182350-131182372 TTTGTGCCCCTGTCCCTAGCTGG + Intronic
1077177986 11:1199239-1199261 TGTGGGGACCTGTCGTTGCCAGG + Intronic
1077528386 11:3082953-3082975 GTTGGGCACCTGTACTCGGGAGG - Intergenic
1083856292 11:65394600-65394622 TTTCCTCACCTGTCCTGGGCTGG + Intronic
1084493381 11:69490093-69490115 CTGGGGCACTTCTCCTTGGCTGG - Intergenic
1086680579 11:89666861-89666883 TTTGTTCACCTGTCCTTGTGGGG + Intergenic
1090293449 11:125566537-125566559 TCTGGGTACCTGTACTTGGTGGG + Intergenic
1090900381 11:131025790-131025812 GTAGGTCACCTCTCCTTGGCAGG - Intergenic
1091414479 12:269406-269428 TTTGGACACCAGTACTTGACAGG - Intergenic
1091453923 12:591259-591281 TTGGGGCCCCAGTCCTTAGCAGG + Intronic
1097240126 12:57569394-57569416 TTTGGGCAGCGGTCAGTGGCAGG + Exonic
1097746586 12:63310364-63310386 TTTGGGTACCTGCACTTGGTGGG + Intergenic
1098125530 12:67288791-67288813 CCTGGGCCCCTGTCCTTGCCAGG - Intronic
1101041756 12:100762505-100762527 TCTGGTCACCTGCCCTTGCCAGG - Intronic
1102459517 12:113091709-113091731 TCTGGTCACCTGTCCTTGGCAGG - Intronic
1103990637 12:124797032-124797054 TGTGGGCACCTCTGCCTGGCAGG - Intronic
1106146599 13:27054863-27054885 CATGTGCACCTGTCATTGGCTGG - Intergenic
1106458519 13:29948345-29948367 TTTGGACATCTGTTCCTGGCGGG + Intergenic
1106809101 13:33342035-33342057 TTAGGGAAGCTGTCCGTGGCGGG - Intronic
1108473262 13:50788330-50788352 TGTGGGCACCAGTTCTGGGCTGG + Intronic
1110938216 13:81318674-81318696 TTTGGGCACCTCTCCATTGTGGG - Intergenic
1111895246 13:94133890-94133912 TGTGTGTACCTGTCTTTGGCAGG - Intronic
1117737755 14:58784891-58784913 TTGGGGCACATGCCCATGGCAGG - Intergenic
1117901430 14:60537923-60537945 GTTAGGCATCTCTCCTTGGCTGG + Intergenic
1122960295 14:105091073-105091095 TTTAGGCACCTGTGCTGGGTGGG - Intergenic
1124238778 15:28013152-28013174 TTGGGGCACCTGTGCTTCACAGG - Intronic
1126088336 15:45029668-45029690 TCTGGGTACCTGTACTTGGTGGG + Intronic
1126689829 15:51280577-51280599 TCTGGACACTAGTCCTTGGCAGG + Intronic
1129019604 15:72504365-72504387 TTTGGGTACCTGCACTTGGTGGG + Intronic
1129319958 15:74768989-74769011 TTTCGGCTCCAGTTCTTGGCTGG - Intergenic
1130295856 15:82646957-82646979 TCTGGGCACCTGGCCTCGTCCGG + Intronic
1131736635 15:95339549-95339571 TTTGGGCAGCTGTCAATGCCAGG + Intergenic
1131822371 15:96286035-96286057 TTTGCGCACCTCACCTTTGCTGG + Intergenic
1135911821 16:26568101-26568123 TTTGAGAAGCTGTCCTTTGCAGG - Intergenic
1138173683 16:54876725-54876747 TTTGTGCACCTATTCATGGCTGG - Intergenic
1138193662 16:55036472-55036494 CTTGGGCCCCTGTCCCGGGCAGG - Intergenic
1139590649 16:67931109-67931131 GTTGGGCTCCTGGCCCTGGCAGG - Exonic
1140321096 16:73952257-73952279 GGTGGGCACCTGTACTTGGGAGG + Intergenic
1141610287 16:85177307-85177329 TCTGGGCACCTTTTATTGGCTGG + Intronic
1141961793 16:87413799-87413821 TCTGGGCACCAGTCCTGGGGTGG + Intronic
1142874379 17:2842672-2842694 CTTTGACACCTTTCCTTGGCAGG + Intronic
1146745289 17:35323508-35323530 TTTGGGTACCTGCACTTGGTGGG + Intergenic
1148579281 17:48732762-48732784 TTAGGGCAACTGTCCTTTTCAGG - Intergenic
1148863031 17:50614430-50614452 TTGGGGCACATGTTCTTGGGAGG - Intronic
1148901843 17:50884490-50884512 TTTGGGAAGCTGTCTTTGCCTGG + Intergenic
1148906803 17:50917468-50917490 TGTGGGCAGCTGTCCTTGGCCGG - Intergenic
1149054042 17:52341266-52341288 TTTGGTCACCTGTGCTTGTGGGG + Intergenic
1151226499 17:72651853-72651875 TTTGTGGACATGTCCTGGGCTGG - Intronic
1151940432 17:77288365-77288387 CCTGGGCACCTGTCCTGGCCAGG + Intronic
1154386998 18:13902802-13902824 TTTGGGTACCTGTGCTTGTCGGG - Intronic
1155994234 18:32313085-32313107 TCTGTGCATCTGACCTTGGCTGG - Intronic
1157326517 18:46672814-46672836 CTTGGGCAGTTGTCCTGGGCTGG - Intronic
1159097021 18:63914747-63914769 TTGGGGCACCTGTCATTTTCAGG + Intronic
1159637829 18:70826814-70826836 TTAGGGCACCTGTCCTTCTTGGG + Intergenic
1160751542 19:736672-736694 ATTGGGCTCCTGTCCTGTGCCGG - Intronic
1162654214 19:12116651-12116673 TATGTGCAGATGTCCTTGGCAGG + Intronic
1164185303 19:22861756-22861778 GGTGGGCACCTGTACTTGGGAGG + Intergenic
925741698 2:7010555-7010577 TGTGGCCACTTCTCCTTGGCAGG + Intronic
926141209 2:10369557-10369579 TGTGAGCACCTGTCCCAGGCAGG + Intronic
926162337 2:10497915-10497937 CTTGGGCTCCTGTTCTTAGCAGG - Intergenic
927881784 2:26694189-26694211 TTTGGCCACCCCTCCTTGTCTGG - Intronic
931264770 2:60650852-60650874 TTTGAGCACCTGTTCATGCCAGG - Intergenic
936345421 2:111671926-111671948 CTTGGGGACCTGTCCTTTGTAGG + Intergenic
937079238 2:119128487-119128509 TCTGGGCATCTGTCCTCTGCAGG - Intergenic
937255659 2:120553666-120553688 TCTGGGCACCTGCCCATGCCTGG - Intergenic
939444478 2:142291094-142291116 TTTTGGCACTTGTGCTTGGGAGG - Intergenic
946697849 2:222379085-222379107 TTTGGTCACCTGTACTTGTAGGG - Intergenic
948456159 2:238105597-238105619 TTTGGGCCCCACTCCTTGTCCGG - Intronic
1169140818 20:3226621-3226643 TTGGGGCTGCTGTCCTTTGCTGG + Intergenic
1172916792 20:38449267-38449289 TTTGGGATCCTGTGCTGGGCTGG + Intergenic
1174103290 20:48143753-48143775 TTTGGGCACCTGCCGGTGGGAGG + Intergenic
1175633263 20:60559741-60559763 GTTGAGCACCTGTCTCTGGCTGG + Intergenic
1175769189 20:61612531-61612553 TGTGGACAGCTGTCCTTGGTTGG - Intronic
1177397211 21:20552227-20552249 TTTGGGCACTTGGCCTTAGGCGG - Intergenic
1182303342 22:29351141-29351163 TCTGGGACTCTGTCCTTGGCTGG - Intronic
1182738684 22:32549765-32549787 TGTGTGCACCTGTACTTGGAAGG + Intronic
1184264259 22:43338468-43338490 TTTGTGCATCTGTCCTTGACTGG - Intronic
1184438493 22:44494907-44494929 TGGGGGCACCTCTCCCTGGCAGG + Exonic
1184557939 22:45243135-45243157 TTCTGGCACCAGTCCTGGGCTGG - Intergenic
1185046529 22:48531281-48531303 CTTGGGAGCCTGTCCTGGGCAGG + Intronic
1185291566 22:50030240-50030262 TTGGGGCACCTGTCCCAGCCCGG - Intronic
949141332 3:637019-637041 TTTGGGCACCTTTTCTTGACTGG + Intergenic
949675419 3:6447795-6447817 TTTGGGCACCCGCACTTGGTGGG + Intergenic
952688717 3:36178749-36178771 TTTTGTCTCCTGTCTTTGGCAGG + Intergenic
952889719 3:38031746-38031768 TTTAGGCACCTGGCCAGGGCTGG - Intergenic
954681976 3:52350753-52350775 TTCGGCCACCTGGCCCTGGCTGG - Intronic
954875771 3:53802377-53802399 TGTGGACACCAGTCCTTGGATGG - Intronic
955147142 3:56331129-56331151 TGTGTTCACCTGTCCTTGCCAGG + Intronic
956259863 3:67327462-67327484 TTTGGGCTCCTCCCCTTGGATGG - Intergenic
958973390 3:100638183-100638205 TTTGGGTACCTGCACTTGGTGGG + Intronic
960966265 3:123106897-123106919 GTTGGGCTCCTTTCCTTGGGAGG - Intronic
963779950 3:149476993-149477015 TTTGGGCATGTTTCCTAGGCTGG + Intronic
969510188 4:7613187-7613209 TTTGGGCAGCAGACCTAGGCTGG - Intronic
969692324 4:8710510-8710532 CTTGGGCAGCTGCCCTTGCCAGG - Intergenic
976777840 4:88725423-88725445 TTGAGGCATTTGTCCTTGGCTGG + Intergenic
977176658 4:93827797-93827819 TTTGGGCACCCTCCCCTGGCTGG + Intergenic
977917476 4:102610495-102610517 TTTGGGAATCTGACCTTTGCAGG + Intronic
979082630 4:116361817-116361839 TATGGGCACATGTCCCTGCCTGG + Intergenic
981599730 4:146472717-146472739 ATTGGGCACCACTGCTTGGCAGG - Intronic
982944849 4:161607568-161607590 ATTGGGCACCTGTTCTTTACTGG + Intronic
983106219 4:163690022-163690044 TTTGGGAGCCTGTACTTGGCTGG + Intronic
983635420 4:169893119-169893141 TTTAGGCCCGTGTCCTTGGCAGG + Intergenic
988835078 5:35024274-35024296 GTTCTCCACCTGTCCTTGGCTGG + Intronic
989770802 5:45142966-45142988 TTAAGGCTCCTGTCATTGGCAGG + Intergenic
991490898 5:67181778-67181800 TTCAGGCCCCTGTCCATGGCTGG + Intergenic
991632044 5:68665904-68665926 AGTGGGCATCTGTGCTTGGCTGG + Intergenic
995840407 5:116438503-116438525 TTGGGGCAGCAGTCCCTGGCTGG - Intergenic
999270654 5:150294716-150294738 TTTGAGCACCTGTGCTTGTGGGG - Intergenic
1002571372 5:180141196-180141218 TTTGAGGACCTTTCCATGGCAGG + Intronic
1003132676 6:3408855-3408877 TCTGGGCAGCCGTCCTTGTCAGG - Intronic
1006939739 6:37743868-37743890 TTTGGGCACCTGTTCTCTTCAGG + Intergenic
1010794566 6:80104563-80104585 TTTGGGAAACTGTCCTTTTCTGG - Intergenic
1014107425 6:117582854-117582876 TTTGGGTACCTGCACTTGGTGGG - Intronic
1018315760 6:162554789-162554811 TGTGGTGACCTGGCCTTGGCTGG - Intronic
1019286612 7:226450-226472 CTTGGGCCCTCGTCCTTGGCTGG - Intronic
1019904373 7:4049487-4049509 TGTGGGCAGCTGTCATTGTCTGG + Intronic
1020940340 7:14525550-14525572 ATTGGGTACATGTCCTTAGCAGG + Intronic
1021727748 7:23565885-23565907 TTTGGTCACCTGTGCTTTTCAGG + Intergenic
1022991900 7:35716860-35716882 TTTGGAAATCTGACCTTGGCTGG - Intergenic
1023880808 7:44320286-44320308 TTTGGGCACCTGTCCTTGGCCGG - Intronic
1025785490 7:64639913-64639935 TTCTGGGACCTGTCCATGGCAGG + Intergenic
1026504442 7:70970193-70970215 TCTGGGCCCCTATCCTTGGTTGG + Intergenic
1026775717 7:73229868-73229890 TGTGGGCATCTGTGCATGGCAGG + Intergenic
1027016574 7:74783240-74783262 TGTGGGCATCTGTGCATGGCAGG + Intronic
1027071454 7:75162696-75162718 TGTGGGCATCTGTGCATGGCAGG - Intergenic
1031537561 7:122954099-122954121 GCAGGGCACCTGTCCTTCGCTGG - Intergenic
1031782418 7:125985350-125985372 TTCTTGCACCTGTCCTTGTCCGG - Intergenic
1032002144 7:128272258-128272280 TTTGGCCCCCTGTGCTTCGCTGG - Intergenic
1034860597 7:154591795-154591817 TTTTGGAACCTGTCCATGGTGGG - Intronic
1035174654 7:157041777-157041799 TCTGGCCACCTGGGCTTGGCTGG - Intergenic
1035373530 7:158393876-158393898 TTAGGGGACGTGGCCTTGGCTGG - Intronic
1035710456 8:1709685-1709707 TGTGGGGACCTGTGCTGGGCTGG + Intergenic
1035865665 8:3078897-3078919 GTTGGGCTCCTGTTCTTAGCTGG + Intronic
1035881207 8:3245603-3245625 TTTAGGCTCCTGTCCTTTCCTGG - Intronic
1037382900 8:18307001-18307023 TCTGCTCACATGTCCTTGGCAGG - Intergenic
1041193196 8:55374227-55374249 AGTGGGCACCTATCCATGGCAGG + Intronic
1041262245 8:56031830-56031852 TTTGGTCACCTGTGCTTGTGAGG - Intergenic
1043657454 8:82687226-82687248 TTTGGGCAGCTGGCCATGCCTGG + Intergenic
1046747858 8:117895355-117895377 ATTGGGCACCTGTTCTGGCCAGG + Intronic
1048260507 8:132941141-132941163 TTTGGGGCCATGGCCTTGGCTGG + Intronic
1048392893 8:133985021-133985043 TTTGGAAACCTGGCCCTGGCAGG + Intergenic
1049240576 8:141535630-141535652 CTTGGGCCCGTGTCCTGGGCTGG - Intergenic
1049724401 8:144138759-144138781 TTTTTGCTCCTGCCCTTGGCTGG + Exonic
1055708447 9:79033542-79033564 TTTGGGTACCTGCACTTGGTGGG + Intergenic
1055812361 9:80163735-80163757 GTTGACCACCTGTCCTTGGGAGG - Intergenic
1059390687 9:113997934-113997956 GTGGGGCACATGTCCTTGGAGGG + Intronic
1060920334 9:127416167-127416189 TTTGAGTACCTGTCTTTGCCAGG - Intergenic
1062537373 9:137026943-137026965 CCTGGGCACCTGGCCTTGGCGGG - Intronic
1186154138 X:6708129-6708151 TTAGGGCATCTCTCCTTGGTTGG - Intergenic
1194112652 X:89854286-89854308 TTTTTGGACCTGTGCTTGGCCGG + Intergenic
1198191914 X:134315742-134315764 TTTGGACTCCTGACCTGGGCAGG - Intergenic
1200232472 X:154450958-154450980 CGTGGGCACCTGTCCTTGGGCGG + Intergenic
1200465305 Y:3509097-3509119 TTTTTGGACCTGTGCTTGGCCGG + Intergenic