ID: 1023880809

View in Genome Browser
Species Human (GRCh38)
Location 7:44320290-44320312
Sequence GGCTTTTGGGCACCTGTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023880809_1023880816 21 Left 1023880809 7:44320290-44320312 CCAAGGACAGGTGCCCAAAAGCC 0: 1
1: 0
2: 0
3: 19
4: 225
Right 1023880816 7:44320334-44320356 GCTGGCCATGAGTCAGCCAGTGG 0: 1
1: 0
2: 1
3: 16
4: 203
1023880809_1023880814 3 Left 1023880809 7:44320290-44320312 CCAAGGACAGGTGCCCAAAAGCC 0: 1
1: 0
2: 0
3: 19
4: 225
Right 1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG 0: 2
1: 0
2: 1
3: 11
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023880809 Original CRISPR GGCTTTTGGGCACCTGTCCT TGG (reversed) Intronic
900363263 1:2300091-2300113 GGCAGGGGGGCACCTGTCCTTGG + Intronic
902245412 1:15117575-15117597 AGCTTTTGGGTCCCTGTCCTGGG - Exonic
902858554 1:19227450-19227472 GGCTTTTTTGCCCCTGCCCTAGG - Exonic
903186626 1:21632965-21632987 GGCATCTGGCCACCTGTGCTTGG - Intronic
903230787 1:21921240-21921262 GGCTTTGGGGCAGCTGAGCTTGG - Intronic
904350303 1:29900875-29900897 GGATTTAGTGCTCCTGTCCTTGG + Intergenic
905844238 1:41213836-41213858 GTCTTTTCCTCACCTGTCCTAGG - Intronic
906588789 1:47004185-47004207 GGCTCTTGAGCCCCTGTGCTCGG + Intergenic
907183280 1:52589471-52589493 GGATTTTGAGCCCCTGTGCTTGG + Intergenic
907884171 1:58577478-58577500 GGCTTCTGGGGACCCGCCCTCGG + Exonic
911827300 1:102503902-102503924 GGATTTTGGTAACATGTCCTTGG - Intergenic
915399292 1:155610710-155610732 GGCTCTTGAGCAACTGTCGTGGG - Intronic
915416406 1:155746290-155746312 GGCTCTTGAGCAACTGTCGTGGG - Intergenic
915633604 1:157171293-157171315 GGCTGGTGGGCGCGTGTCCTCGG + Intergenic
915657865 1:157376587-157376609 GGCTGGTGGGCATGTGTCCTCGG + Intergenic
915671192 1:157490386-157490408 GGCTGGTGGACACGTGTCCTCGG - Intergenic
915752861 1:158228289-158228311 GGCATTTGTGGACCTGCCCTGGG + Intergenic
915810958 1:158910012-158910034 GGCATTCTGGGACCTGTCCTGGG + Intergenic
916640688 1:166725699-166725721 GGCTCTTGAGCCCCTGTGCTCGG + Intergenic
919511539 1:198471864-198471886 GGCATTTCTGGACCTGTCCTGGG + Intergenic
920305547 1:205016049-205016071 TGCTTTTGGGCTCCTGTTCTGGG - Intronic
920682228 1:208082046-208082068 GGCTCTTGTTCCCCTGTCCTTGG - Intronic
920818025 1:209353694-209353716 GGCTTTTGGTCAGATGTACTTGG - Intergenic
921634605 1:217477454-217477476 GGCATTTTTGGACCTGTCCTGGG + Intronic
921929351 1:220742452-220742474 GGCATTTCTGGACCTGTCCTGGG - Intergenic
922388529 1:225113893-225113915 GGCATTTCTGCACCTGCCCTGGG - Intronic
922561452 1:226572638-226572660 GGCCTTTGGGCAGCATTCCTGGG + Intronic
1064052499 10:12070379-12070401 GGCATCTGGGCACCTGACCTTGG + Intronic
1068401354 10:56531765-56531787 GGTGTTTGGGGGCCTGTCCTGGG + Intergenic
1069945746 10:71984327-71984349 GCCTTTTGAGCTCCTGTGCTCGG + Intronic
1070833395 10:79433676-79433698 AGTTCTTGGGCACCTGTGCTGGG - Intronic
1072407746 10:95170497-95170519 GGCTTTGGGGAGCCTTTCCTGGG - Intergenic
1073100515 10:101003973-101003995 GGCTTTTGGGCAGTGGTACTCGG + Exonic
1073822059 10:107275199-107275221 GGCTTTTGAGCTCCTATGCTTGG - Intergenic
1075159332 10:120009614-120009636 GATTTTTGGGTACCTGCCCTGGG - Intergenic
1076228932 10:128803867-128803889 GGCGTTTGGGGAGCTGTGCTAGG + Intergenic
1077089066 11:770133-770155 GCCTGCTGGGCACCTGGCCTGGG - Exonic
1077528388 11:3082957-3082979 TGGTGTTGGGCACCTGTACTCGG - Intergenic
1077612954 11:3655759-3655781 AGCCTTAGGGCACCAGTCCTGGG + Intronic
1078249696 11:9606997-9607019 TGTTTTTGGGCTCCTTTCCTCGG - Intergenic
1079666960 11:23117871-23117893 CGCTCTTGAGCATCTGTCCTGGG - Intergenic
1080462507 11:32467905-32467927 GGCTTTTGGGAAGCTGACGTGGG + Intergenic
1083590212 11:63889281-63889303 GTCCCTTGGGCACCAGTCCTGGG - Intronic
1083812760 11:65114966-65114988 GGCGTTTGGGGACATGGCCTGGG + Exonic
1083890850 11:65595195-65595217 GGCATCTGGGCAGCTCTCCTGGG + Intronic
1096518324 12:52170475-52170497 GGCTTTGGTGCACCAGGCCTTGG - Exonic
1097035360 12:56120327-56120349 GGGTTTTGTGCACCTGGTCTGGG - Intronic
1097473219 12:60021556-60021578 GGCATTTCTGGACCTGTCCTGGG - Intergenic
1098135482 12:67397402-67397424 GGCTTTTGAGCCCCTATGCTCGG - Intergenic
1100360776 12:93877763-93877785 GGCATTTCTGGACCTGTCCTGGG - Intronic
1100931062 12:99609948-99609970 GGCTTTTGGTCAGTTGTCCTAGG + Intronic
1103161864 12:118735928-118735950 GGCATTTGGGAACCAGTACTGGG - Intergenic
1103409115 12:120698273-120698295 AGCTCTTGGGCTCATGTCCTGGG + Exonic
1103447681 12:121004794-121004816 TGCTTTTGAGCACCTGTCTTGGG - Intronic
1104410537 12:128554084-128554106 GCCTTTTGGAAACCTTTCCTGGG + Intronic
1105851339 13:24339160-24339182 GACTTTGCGGCACCTGTCCCAGG - Intergenic
1107352082 13:39525684-39525706 GGCTTTTGGCCACATTTCTTTGG - Intronic
1111639336 13:90947518-90947540 GGCATTTCTGAACCTGTCCTGGG + Intergenic
1116371808 14:44144259-44144281 GACTTTTGATCACCTGTCCTTGG - Intergenic
1116990863 14:51274968-51274990 AACTTTTAGGCATCTGTCCTAGG + Intergenic
1119130761 14:72170766-72170788 GGCTTTTCTGTACCTGTCATAGG - Intronic
1119883706 14:78122619-78122641 GTCTTTTGGGCTCCTCTCCCAGG - Intergenic
1121906641 14:97752091-97752113 GCCTTATGGGCACATGACCTGGG - Intronic
1122272466 14:100574305-100574327 GGAATTTGGGCACCTGGCCTCGG + Intronic
1122855207 14:104556742-104556764 TCCTTTTGGGCTCCTCTCCTTGG - Intronic
1122960298 14:105091077-105091099 AGCCTTTAGGCACCTGTGCTGGG - Intergenic
1125733921 15:41910409-41910431 GGCTTCTGGGCTCCTCTCCCAGG - Intronic
1126163520 15:45634948-45634970 GACTTTTCGGGACCTTTCCTGGG + Exonic
1126383199 15:48068734-48068756 GGCTTTTGGTCCCAAGTCCTGGG - Intergenic
1129160842 15:73746851-73746873 GGGTTAAGGGCCCCTGTCCTTGG - Intronic
1129541618 15:76354158-76354180 GGCGTTTCGGCAGCTGACCTGGG - Intronic
1130757555 15:86781474-86781496 TGGTTTTGAGCACCTGTCATGGG - Intronic
1133069163 16:3234583-3234605 TGCTTTTAGGCAGATGTCCTCGG - Intronic
1135313187 16:21421587-21421609 GGCTTTGGGGAGCCTTTCCTGGG - Intronic
1135366111 16:21853865-21853887 GGCTTTGGGGAGCCTTTCCTGGG - Intronic
1135445704 16:22517299-22517321 GGCTTTGGGGAGCCTTTCCTGGG + Intronic
1136152341 16:28359316-28359338 GGCTTTGGGGAGCCTTTCCTGGG - Intronic
1136194404 16:28641875-28641897 GGCTTTGGGGAGCCTTTCCTGGG + Intronic
1136210740 16:28755965-28755987 GGCTTTGGGGAGCCTTTCCTGGG + Intronic
1136255456 16:29035935-29035957 GGCTTTGGGGAGCCTTTCCTGGG + Intergenic
1136309855 16:29400302-29400324 GGCTTTGGGGAGCCTTTCCTGGG - Intronic
1136323299 16:29502092-29502114 GGCTTTGGGGAGCCTTTCCTGGG - Intronic
1136437984 16:30242061-30242083 GGCTTTGGGGAGCCTTTCCTGGG - Intronic
1137709495 16:50556361-50556383 GCCTTGTGGGCACCAGTCGTGGG + Intronic
1137715955 16:50598490-50598512 GGCTATGGGGCACCCTTCCTTGG + Intronic
1138100632 16:54249452-54249474 GGCTTTCAGGCCCCTGCCCTGGG - Intronic
1138229771 16:55328519-55328541 GGTTGTTGGCCACCTGTCCTTGG - Intronic
1139857540 16:69992690-69992712 GGCTTTGGGGAGCCTTTCCTGGG - Intergenic
1140365134 16:74375239-74375261 GGCTTTGGGGAGCCTTTCCTGGG + Intergenic
1141606574 16:85157348-85157370 GATTTATGGGCACCTGTCTTGGG - Intergenic
1141700775 16:85641050-85641072 AGCCTTTGGGGGCCTGTCCTGGG + Intronic
1141907812 16:87039144-87039166 GGCTTTGGGGAACCTGGGCTGGG + Intergenic
1141961790 16:87413795-87413817 GGCCTCTGGGCACCAGTCCTGGG + Intronic
1143003716 17:3813010-3813032 GGCTTTAGGGCAGCTGCCATAGG + Exonic
1143478514 17:7216284-7216306 GGATATTGGGCACCTGCCTTTGG + Intronic
1143888595 17:10085284-10085306 GGAGTGTGGACACCTGTCCTTGG + Intronic
1145250358 17:21293884-21293906 GGTTCTGGGGCCCCTGTCCTGGG - Intronic
1147944940 17:44075605-44075627 GGCTCTTGGCCATCTGCCCTTGG - Intronic
1149969653 17:61203987-61204009 GGGTTTTGGCAGCCTGTCCTCGG + Intronic
1150721120 17:67615097-67615119 GTCTTCTGGGCAGCTGCCCTGGG + Intronic
1151226500 17:72651857-72651879 AGCTTTTGTGGACATGTCCTGGG - Intronic
1154118985 18:11635945-11635967 GGCTTTGGGGAGCCTTTCCTGGG - Intergenic
1157059827 18:44275264-44275286 GGCTTTTGAGCTCCCCTCCTAGG - Intergenic
1158558631 18:58495450-58495472 GGGTCTTGGGCAGCTGTCCCGGG + Intronic
1163174146 19:15552466-15552488 TCCTTTGGAGCACCTGTCCTGGG - Intergenic
1163519106 19:17781394-17781416 CGCTTTTGGGCACTGGTCCTGGG + Intronic
1164491094 19:28714902-28714924 GGCATTTCTGGACCTGTCCTGGG + Intergenic
1165467571 19:35984068-35984090 GTCTTTTGGGCTCATGTCCTCGG - Intergenic
1166170584 19:41025427-41025449 GGGTATTGGGCACCCATCCTGGG + Intergenic
1166739294 19:45104382-45104404 GGCTTTGCGGCACCCGGCCTGGG - Intronic
1168306157 19:55437516-55437538 GGCTCTTGGGCCACTGTCCACGG + Intronic
926143745 2:10384374-10384396 GGGTTTTGGGCACCCACCCTGGG + Intronic
926336739 2:11868906-11868928 GACTTCTGGGAATCTGTCCTAGG - Intergenic
926812039 2:16763877-16763899 GGCTCTTGAGCCCCTGTGCTCGG - Intergenic
935188423 2:100755769-100755791 TGCTTTTGGGTACCTCTCTTAGG - Intergenic
938236355 2:129709724-129709746 GGCTTCTGGGGACCTGACCAAGG + Intergenic
938306517 2:130260227-130260249 GGATTCTGGGCAGCTGTCATTGG - Intergenic
938583707 2:132669834-132669856 GGATTGTGCGCACCTGGCCTCGG + Intronic
940071715 2:149695980-149696002 GGCTTCTTAGCACCTGTGCTAGG - Intergenic
941303007 2:163827745-163827767 GGCATTTTTGGACCTGTCCTGGG - Intergenic
941851789 2:170190763-170190785 GGCATTTCTGGACCTGTCCTGGG - Intronic
942132589 2:172895304-172895326 GGCTTTTTGGAACTTGTCATTGG + Intronic
944143604 2:196482660-196482682 GGCTGCTGAGCATCTGTCCTGGG + Intronic
946154119 2:217796052-217796074 GGCCCATGGGCACCTGTGCTTGG - Intergenic
948573194 2:238930318-238930340 GGCTCCTGGGCACCTGTCATGGG + Intergenic
948639592 2:239366845-239366867 GGCTGTTTGTCACCTGCCCTGGG - Intronic
1170013428 20:11753829-11753851 GGGTTTAGCTCACCTGTCCTGGG + Intergenic
1171020381 20:21579362-21579384 GGCTTTGGGGCACTTCTCCATGG + Intergenic
1172931524 20:38589507-38589529 GGCCTTTGGTCTCCTGGCCTTGG + Intergenic
1174067297 20:47874917-47874939 GGCCTTGGGGGACCTGACCTGGG + Intergenic
1174157002 20:48521956-48521978 GGCCTTGGGGGACCTGACCTGGG - Intergenic
1176009846 20:62887156-62887178 GGCTCCTGGTCACCTATCCTAGG - Intronic
1176171914 20:63699926-63699948 GGCCTTTGGGAACATGGCCTGGG + Exonic
1177603897 21:23354355-23354377 GGCCTTTGGGATCCTTTCCTGGG + Intergenic
1179178171 21:39023473-39023495 GGCTTTTGGCCCCATGTCCTCGG - Intergenic
1179418138 21:41214872-41214894 GGCTTCTGTGCCCCTGTCCTGGG - Intronic
1181738305 22:24899323-24899345 GGCTTTTGGGGAGAAGTCCTTGG - Intronic
1182697755 22:32208011-32208033 GGCTTTTGGGCACCTAGCCAGGG - Intergenic
1183301704 22:37062027-37062049 GGCTTGTGGGCACATGGCCAGGG - Intronic
1183628543 22:39019599-39019621 GCCATGTGGGCACCTGGCCTGGG - Exonic
1183664199 22:39237981-39238003 GGCCTTTGGGCCCCTCCCCTGGG - Intronic
1185046527 22:48531277-48531299 GCCTCTTGGGAGCCTGTCCTGGG + Intronic
949235679 3:1805988-1806010 GGCATTTCTGGACCTGTCCTAGG - Intergenic
949831092 3:8215392-8215414 GCCATTGGAGCACCTGTCCTAGG + Intergenic
949852001 3:8429109-8429131 GGCATTTGGGGTCCTGTTCTTGG + Intergenic
950274272 3:11645100-11645122 AGTTTTTGGGCACCTGAACTTGG - Intronic
953838561 3:46369113-46369135 GCCTTTTGGGCACCCACCCTCGG - Intergenic
954362080 3:50127251-50127273 GGCCCATGGGAACCTGTCCTAGG - Intergenic
958078382 3:88712926-88712948 GGCATTTTGGGACCTGCCCTGGG + Intergenic
958839994 3:99191987-99192009 GGCATTTCTGGACCTGTCCTCGG + Intergenic
959469458 3:106731805-106731827 GCCTTTTGAGCACATATCCTTGG - Intergenic
959667399 3:108937064-108937086 GGCATTTGGGAACATTTCCTGGG - Intronic
960382619 3:116982821-116982843 GGCTTTGAGGAATCTGTCCTAGG + Intronic
964021787 3:152021898-152021920 GGCTTTTCTGGACCTATCCTAGG + Intergenic
967924799 3:194637752-194637774 AGCTCCTGGGCACGTGTCCTTGG + Intergenic
968734952 4:2290531-2290553 GGCTTTTGGAGACATCTCCTGGG - Intronic
976117134 4:81739833-81739855 GGCTTTATGGAACTTGTCCTGGG + Intronic
976462079 4:85323424-85323446 TGCTATTGGGCAACTGTTCTGGG - Intergenic
976638787 4:87315264-87315286 GGCTCTTGAGCCCCTGTGCTTGG + Intronic
979111409 4:116762078-116762100 GGCATTTCTGGACCTGTCCTGGG + Intergenic
979312613 4:119221578-119221600 AGCTCTTGGGCTCCTGTCTTTGG - Intronic
980413018 4:132447407-132447429 GGCTTTTCTGGACCTGTCCTGGG + Intergenic
980646713 4:135652215-135652237 GGCATTTCTGAACCTGTCCTAGG + Intergenic
982813668 4:159858252-159858274 AGCTTTAGGGCACCAGGCCTGGG - Intergenic
983106218 4:163690018-163690040 GGTTTTTGGGAGCCTGTACTTGG + Intronic
985410569 4:189679468-189679490 GGCTTTGCGGCACCTAGCCTGGG + Intergenic
985485269 5:145219-145241 GGGTGGTGGGCACCTGTCCCAGG + Intronic
987861988 5:23500613-23500635 GGCTGTAGGGCACATGTTCTGGG + Intergenic
988017599 5:25579266-25579288 GGCTTTTGTACACCTGGCTTTGG - Intergenic
988045863 5:25952157-25952179 GGCTATTGGGCACAAGTACTAGG - Intergenic
988418371 5:30974803-30974825 GGCTGTTGGGGATCTGTCCTTGG + Intergenic
988599177 5:32623666-32623688 GGCTCTTGAGCCCCTGTGCTCGG + Intergenic
989460803 5:41696474-41696496 GAGTTTAGGCCACCTGTCCTAGG - Intergenic
991484799 5:67123849-67123871 GCCTCTTTGGCACATGTCCTGGG - Intronic
992595571 5:78343998-78344020 GGCTTTTGGGCCTTTGGCCTTGG + Intergenic
993554855 5:89323284-89323306 GGGTTAAGGGCTCCTGTCCTGGG + Intergenic
993901694 5:93588403-93588425 GGCTTTGAGGCAGCTGTACTCGG - Exonic
997671061 5:135672352-135672374 GGTTTTTGTGCAGCTGTCATCGG + Intergenic
999214303 5:149919089-149919111 GCCTTAGGGCCACCTGTCCTTGG + Intronic
999274802 5:150322835-150322857 GGCTTTTGGCCATGTTTCCTGGG + Intronic
999406570 5:151312269-151312291 GGCATTTCTGGACCTGTCCTGGG - Intergenic
1002431523 5:179206863-179206885 GTCTTCTGGGCACCTGCCCATGG - Intronic
1002467694 5:179416038-179416060 GGCTCTTGGGCACTGTTCCTAGG + Intergenic
1004528820 6:16435083-16435105 GACTTTTAGGCATCTGTCTTGGG + Intronic
1006911194 6:37564730-37564752 GACTTCTGGGTACCTGGCCTGGG - Intergenic
1007246641 6:40468103-40468125 GGTTATTGGGCACCTGCTCTGGG + Intronic
1007667478 6:43523841-43523863 AGCTTTTGGGCATCCTTCCTCGG - Exonic
1010373851 6:75143307-75143329 GTCTTTTGGGAACCTGTGCCTGG - Exonic
1015030328 6:128586862-128586884 GGCATTTCTGCACCTGCCCTGGG + Intergenic
1019281642 7:203274-203296 GGCGTGTGGGCACAGGTCCTGGG - Intronic
1019449527 7:1090212-1090234 TGGGCTTGGGCACCTGTCCTAGG + Intronic
1020141229 7:5613002-5613024 GTCCCTTGGGCACCAGTCCTAGG + Intergenic
1023880809 7:44320290-44320312 GGCTTTTGGGCACCTGTCCTTGG - Intronic
1024177139 7:46852030-46852052 AGCTTTTGAGCAACTATCCTTGG + Intergenic
1027659720 7:80974875-80974897 GGCTTTGTGGCACCTCGCCTGGG + Intergenic
1029298702 7:99561551-99561573 GACTTGTGGGGACTTGTCCTGGG - Intronic
1031553346 7:123142354-123142376 GGCATTTATGGACCTGTCCTGGG - Intronic
1031829449 7:126608453-126608475 TGCTTTTGGGCACCAATCCCAGG + Intronic
1032252658 7:130271382-130271404 GGCTCTTGGGCCCCTATGCTCGG - Intronic
1032673529 7:134107365-134107387 GGCTCTTGAGCCCCTGTGCTTGG - Intergenic
1034201362 7:149285070-149285092 GGCTGTTGGGCACCAGCCCGGGG + Intronic
1035198550 7:157243518-157243540 GGCTTTAGGGCACCTGCCAGTGG + Intronic
1038014516 8:23502714-23502736 AGCTCTTGGGCACCTGTGCCTGG - Intergenic
1038790913 8:30667647-30667669 TGCTTTTGTGCTCCTGCCCTAGG + Intergenic
1040298239 8:46174368-46174390 GGCTTTTATGCACCAGTCTTTGG + Intergenic
1040598134 8:48859812-48859834 GCCTTGTGAGCCCCTGTCCTGGG + Intergenic
1043949380 8:86290997-86291019 GGCTTTTGGGCCCCTATGCTTGG + Intronic
1045036284 8:98178788-98178810 GGCATTTGGCCACCTGGCCCGGG - Intergenic
1045429120 8:102096759-102096781 GGCTCTTGAGCCCCTGTGCTGGG + Intronic
1050629498 9:7543584-7543606 ATCTCTTGGGCACCTGACCTAGG + Intergenic
1052190156 9:25651737-25651759 GTATGTTGAGCACCTGTCCTGGG - Intergenic
1055462063 9:76528736-76528758 GACTTTTGGGCACCTACCCCGGG + Intergenic
1055641061 9:78319395-78319417 GGCCTTTGGGCTCCTTTCCCAGG + Intronic
1056595971 9:88007770-88007792 GGCTTCTGGGTACCTCTCCAGGG - Intergenic
1056697665 9:88873765-88873787 GGCTCTTGGGCTCCTGCCCCGGG + Intergenic
1060061408 9:120463503-120463525 GGTCTTTGGGGACCTTTCCTGGG - Intronic
1062085664 9:134646748-134646770 TGATTTTGGGTACCTGTGCTGGG + Intronic
1062333908 9:136056607-136056629 GGCCTTTGCGCCCCTTTCCTGGG - Intronic
1203672194 Un_KI270755v1:25958-25980 GGCTTTGCGGCACCTAGCCTGGG - Intergenic
1186737403 X:12480168-12480190 GGATTTTGGCCATGTGTCCTTGG - Intronic
1187161823 X:16772518-16772540 GGCTCTTGAGCCCCTGTACTAGG - Intergenic
1188721506 X:33528504-33528526 GGCATTTGTGGACCTGCCCTTGG - Intergenic
1189114623 X:38329900-38329922 GGCTCTTGAGCCCCTGTGCTAGG + Intronic
1191083421 X:56538143-56538165 GGCATTTTTGGACCTGTCCTGGG + Intergenic
1192060218 X:67816892-67816914 GGCATTTCTGGACCTGTCCTGGG + Intergenic
1192065444 X:67880102-67880124 GGCATTTCTGGACCTGTCCTGGG + Intergenic
1192304412 X:69944087-69944109 GGCATTTCTGGACCTGTCCTGGG - Intronic
1192374895 X:70549499-70549521 GGCATTTCTGTACCTGTCCTGGG + Intronic
1192566556 X:72168998-72169020 GGCTCTTGAGCCCCTGTGCTCGG - Intergenic
1193243000 X:79194885-79194907 GGCATTTGTGGACCTGCCCTGGG + Intergenic
1193917137 X:87379253-87379275 GGCATTTAAGGACCTGTCCTGGG + Intergenic
1194352260 X:92834972-92834994 GGCTTTTCTGCACATGCCCTGGG + Intergenic
1194626349 X:96230398-96230420 GGCATTTTGGCACCTGCCCTGGG + Intergenic
1194921949 X:99778243-99778265 GGCATTTGTGGACCTGCCCTGGG - Intergenic
1196294649 X:113983930-113983952 GCCTTTTGGGCAGATGTCCCTGG - Intergenic
1196404750 X:115349440-115349462 GGCTATTGGCCAGCTGTCTTAGG - Intergenic
1197977389 X:132180361-132180383 GGCTATTGGGGATCTTTCCTAGG - Intergenic
1198175753 X:134152785-134152807 GGGCTTTGTGCACCTGTCCATGG - Intergenic
1198609634 X:138383384-138383406 GACTTGTGGGCTCCTGTGCTGGG + Intergenic
1198859495 X:141054631-141054653 GGCATTTCCGGACCTGTCCTGGG - Intergenic
1198903199 X:141532759-141532781 GGCATTTCCGGACCTGTCCTGGG + Intergenic
1198947550 X:142031339-142031361 GGCATTTCTGGACCTGTCCTGGG - Intergenic
1199177696 X:144811004-144811026 GGCATTTCTGGACCTGTCCTGGG + Intergenic
1200660569 Y:5951710-5951732 GGCTTTTCTGCACATGCCCTGGG + Intergenic
1201562714 Y:15334618-15334640 TGCTTCTGGACACTTGTCCTTGG - Intergenic