ID: 1023880811

View in Genome Browser
Species Human (GRCh38)
Location 7:44320303-44320325
Sequence TACTCTGACCTGAGGCTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023880811_1023880816 8 Left 1023880811 7:44320303-44320325 CCCAAAAGCCTCAGGTCAGAGTA 0: 1
1: 0
2: 4
3: 10
4: 171
Right 1023880816 7:44320334-44320356 GCTGGCCATGAGTCAGCCAGTGG 0: 1
1: 0
2: 1
3: 16
4: 203
1023880811_1023880814 -10 Left 1023880811 7:44320303-44320325 CCCAAAAGCCTCAGGTCAGAGTA 0: 1
1: 0
2: 4
3: 10
4: 171
Right 1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG 0: 2
1: 0
2: 1
3: 11
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023880811 Original CRISPR TACTCTGACCTGAGGCTTTT GGG (reversed) Intronic
900966270 1:5960883-5960905 TGCAGTGACCTGAGGATTTTTGG - Intronic
901393140 1:8960867-8960889 TCCTCAGATTTGAGGCTTTTGGG - Intronic
901559462 1:10058718-10058740 GACACTGACCTGAGCCTTCTGGG + Intronic
903582220 1:24379959-24379981 TAAACTGACCTCAGGCTTTGAGG + Intronic
911059060 1:93732252-93732274 TTGTCTGTCCTGAGGCTTTCTGG - Intronic
912882516 1:113430402-113430424 TACTGTAAACTGAGACTTTTTGG + Intronic
922635962 1:227171507-227171529 TCCTCTGACCTCAGCCTCTTGGG - Intronic
923006271 1:230052578-230052600 TACTCTGAGTGGAGGGTTTTGGG - Intergenic
1063931731 10:11035371-11035393 GACCCTGAGATGAGGCTTTTGGG + Intronic
1064395870 10:14981606-14981628 CATTCTGACCAGAGGCTCTTTGG + Intronic
1064397566 10:14993793-14993815 CATTCTGACCAGAGGCTCTTTGG + Intergenic
1064466898 10:15592472-15592494 TACTGTGACCTGAATCTTCTGGG - Intronic
1064856526 10:19774551-19774573 TAATATGATCTGAGGCATTTGGG + Intronic
1066503469 10:36017584-36017606 TTCTCTGACCTGAAGCTTCCTGG + Intergenic
1067497093 10:46771265-46771287 TACTGTGATCTGAAGTTTTTAGG - Intergenic
1069221861 10:65893356-65893378 TACTGTGACTTTAGTCTTTTAGG - Intergenic
1070462612 10:76684918-76684940 TTCTATGACCTGTGGGTTTTAGG + Intergenic
1076825200 10:132963683-132963705 TGCTGTGACCTGTGGCTTTGGGG - Intergenic
1078805487 11:14696406-14696428 AACTCTCACCTAATGCTTTTGGG - Intronic
1081321887 11:41701523-41701545 TAGTGTGACCCAAGGCTTTTAGG - Intergenic
1081360333 11:42169560-42169582 TACTCTGTAATGAGGCTTTGGGG - Intergenic
1084807175 11:71587096-71587118 CATTCTGACCAGAGGCTCTTTGG - Intronic
1084811195 11:71612658-71612680 CATTCTGACCAGAGGCTCTTTGG - Intergenic
1084847113 11:71909563-71909585 CATTCTGACCAGAGGCTCTTTGG - Intronic
1088827625 11:113509014-113509036 CCCTCTGACCTGTGGCTTTTTGG - Intergenic
1089683550 11:120132884-120132906 TCCCCTGACCTGAGGCTGTGAGG - Intronic
1092337922 12:7650293-7650315 TCCTCTGACCTCAGCCTTCTGGG - Intronic
1092432737 12:8422019-8422041 CATTCTGACCAGAGGCTCTTTGG + Intergenic
1092435333 12:8442657-8442679 CATTCTGACCAGAGGCTCTTTGG + Intergenic
1093912895 12:24767562-24767584 TACTGTGACCAGAGGCTTGCAGG + Intergenic
1098286329 12:68911107-68911129 GACTTTAACCTGAGTCTTTTTGG + Intronic
1098611079 12:72459030-72459052 TACTCTCACTGGAGGCTTTAGGG + Intronic
1101030883 12:100658531-100658553 TAATCTGACCTGAGTCTTCAGGG - Intergenic
1104537893 12:129635486-129635508 TCCCTTGACCTGAGGCTTCTTGG - Intronic
1105899599 13:24743740-24743762 TGCTGTGACCTGATGCTGTTGGG + Intergenic
1107544515 13:41423584-41423606 CAATCTGACCAGAGGCTCTTTGG + Intergenic
1107862935 13:44678124-44678146 TACTTGGGCCTGAGGCATTTTGG - Intergenic
1110767014 13:79292222-79292244 TTCTCAGGCCTGAGGCCTTTGGG - Intergenic
1111312106 13:86502405-86502427 TACTTACAGCTGAGGCTTTTAGG + Intergenic
1112434733 13:99383817-99383839 AACTCTTCCCTAAGGCTTTTGGG + Intronic
1112598154 13:100828972-100828994 TATTATGACCAGAGGCTTGTAGG - Intergenic
1115749908 14:36479076-36479098 TACTTTGGCCTGTGCCTTTTTGG - Intronic
1116622530 14:47224477-47224499 TACTTTGACCTGAGACTTCTAGG + Intronic
1117038456 14:51749667-51749689 CATTCTGACCAGAGGCTCTTTGG - Intergenic
1118569710 14:67181502-67181524 TACTGTGCCGTGAGGCTATTGGG - Exonic
1120541713 14:85759266-85759288 TACTTTGAAATGGGGCTTTTGGG + Intergenic
1120962471 14:90138009-90138031 TCCTCTGACTTGAGTCATTTTGG + Intronic
1121125704 14:91405340-91405362 CCCTCTCACCTGTGGCTTTTTGG - Intronic
1121664473 14:95661369-95661391 TGCTCTCTCCTGAGGCTTTAGGG + Intergenic
1125231004 15:37455106-37455128 TACTCTCTCCTGAGACTTTCAGG - Intergenic
1127010748 15:54624802-54624824 TACTCTAAACTGAGTGTTTTCGG - Intronic
1128542040 15:68543060-68543082 CAGTCTAACCTGATGCTTTTTGG - Intergenic
1129408304 15:75334345-75334367 TCCTCTGACCTCAGCCTCTTAGG + Intergenic
1129839171 15:78733056-78733078 TACTCTCTCCTGAGTTTTTTAGG - Intergenic
1132204131 15:99974933-99974955 TACTTGGACCTCATGCTTTTTGG - Intronic
1133859181 16:9577916-9577938 GACTCTGAGCTGAGCCTCTTGGG + Intergenic
1134113525 16:11531138-11531160 GACTCTGACCTGAGCCTGATGGG - Intergenic
1134685452 16:16155057-16155079 TGCTCTGACCAGAGGGTTTGTGG + Intronic
1135065439 16:19305803-19305825 TAGTCAGACCTGAGTTTTTTTGG + Intronic
1136779355 16:32886815-32886837 ACCTCAGACCTGAGGCCTTTGGG - Intergenic
1136891262 16:33974703-33974725 ACCTCAGACCTGAGGCCTTTGGG + Intergenic
1139751595 16:69112278-69112300 TAGTCTGGCCTGAGGCTTCCTGG + Intronic
1141113678 16:81290565-81290587 TCCTCTGACCTGATGGTGTTGGG + Exonic
1203081771 16_KI270728v1_random:1148903-1148925 ACCTCAGACCTGAGGCCTTTGGG - Intergenic
1147866003 17:43552808-43552830 GACTCTTACCTGAATCTTTTTGG + Intronic
1149025267 17:52019716-52019738 TACTTTGATCTGGGGCTTCTGGG - Intronic
1149250680 17:54765553-54765575 TACTCTGAGCTGAAGTCTTTGGG + Intergenic
1151224354 17:72637804-72637826 TTCTCTGACCTTTGCCTTTTAGG - Intergenic
1151537321 17:74746190-74746212 AGTTCTGACCTGAGGTTTTTAGG - Exonic
1159021902 18:63150178-63150200 CAGCCTGACATGAGGCTTTTAGG + Intronic
1160314105 18:77824213-77824235 TCCTATAACCTGCGGCTTTTCGG + Intergenic
1164607616 19:29611335-29611357 TTCTCTAACCTAAGGCTTTGTGG + Intronic
1165138791 19:33687113-33687135 CACTCTCTCCTGAGGCTTTGGGG + Intronic
1167833587 19:52048060-52048082 TACTCGGACCTGAAACTTTTAGG + Intronic
927082197 2:19641693-19641715 CAGTCTGAAGTGAGGCTTTTTGG + Intergenic
928179434 2:29057548-29057570 CTCTCTGCCCTGAAGCTTTTGGG - Exonic
928954101 2:36843690-36843712 TAGTCTGATTTGGGGCTTTTGGG - Exonic
929188324 2:39118242-39118264 TACTCTTACCTGAGGCTCTTTGG - Intronic
930953745 2:57177685-57177707 TACTTTGGCCTGAGGACTTTTGG - Intergenic
931375920 2:61708245-61708267 TTCTCTGATCTGAGTCATTTGGG - Intergenic
932349592 2:71021474-71021496 CATTCTGACCAGAGGCTCTTTGG - Intergenic
932614798 2:73225153-73225175 AACACTGTCCTGAGGCTTTCTGG - Intronic
932932840 2:76062602-76062624 TATTGTGACATGAGGCCTTTAGG + Intergenic
937131642 2:119518407-119518429 TTCCCTCACCTGAGGCTCTTAGG - Intronic
937708759 2:124952907-124952929 TTCTCTGACCTGAGGTTCTGAGG + Intergenic
940871859 2:158867258-158867280 CATTCTGACCAGAGGCTCTTTGG - Intergenic
940874079 2:158883245-158883267 CATTCTGACCAGAGGCTCTTTGG - Intergenic
943538860 2:189186116-189186138 TCCTCTCACCTCAGGCTCTTGGG + Intergenic
943798600 2:192029517-192029539 TCCTCTGACCTAAATCTTTTAGG + Intronic
944000140 2:194824534-194824556 TGCTTTGGCCTGAGTCTTTTAGG - Intergenic
945371821 2:209027969-209027991 TATTGTGACCAGAGGCTTATAGG - Intergenic
945636613 2:212361231-212361253 TATTCTGATCTGAGGCTTTCAGG + Intronic
946832056 2:223737098-223737120 TACTCTGACCTGTGGGGTGTGGG + Intergenic
1171248250 20:23630353-23630375 TCCTGTCACCTGAGGCTTATGGG - Intronic
1171392541 20:24811005-24811027 TCCTCTGGGCTGAGGCTTTCTGG + Intergenic
1173641039 20:44602029-44602051 TACTCTGTCCCCAGGCCTTTTGG - Intronic
1178048239 21:28720247-28720269 TACTGTGACCAGAGGCTCCTGGG + Intergenic
1178744416 21:35234681-35234703 TACTCTCCCATGAGGCTTTTAGG + Intronic
1184808485 22:46812203-46812225 TGCTCTGAGCTGTGGCTGTTTGG + Intronic
951192613 3:19787331-19787353 TACTCTGAACTGTGGACTTTTGG + Intergenic
951866113 3:27310018-27310040 AGCTCTGACCTGAGACATTTTGG - Intronic
952567796 3:34679874-34679896 TAGTCTGACCTGAGGGGGTTGGG + Intergenic
953150975 3:40324153-40324175 TGCTCTGCCCTCAGGCATTTGGG - Intergenic
953538855 3:43796615-43796637 TATTCGGAGATGAGGCTTTTAGG + Intergenic
954320555 3:49829636-49829658 GACTCTGACCTGGGCCTCTTGGG + Exonic
954326190 3:49865461-49865483 GAATCTGACGGGAGGCTTTTGGG - Intronic
954674002 3:52305694-52305716 TGCTCTGGCCTGAGGTATTTGGG + Intergenic
954745056 3:52783005-52783027 TACTTTGACCTGGTTCTTTTTGG + Exonic
957044735 3:75364835-75364857 CATTCTGACCAGAGGCTCTTTGG + Intergenic
957076518 3:75607022-75607044 CATTCTGACCAGAGGCTCTTTGG + Intergenic
959557137 3:107733582-107733604 TTCTCTCACCTCAGCCTTTTGGG + Intronic
959697509 3:109264450-109264472 AACTCAGTCCTGAGGATTTTGGG - Intergenic
960260189 3:115558735-115558757 TAATCTGTCTTGAGACTTTTGGG + Intergenic
961271928 3:125695926-125695948 CATTCTGACCAGAGGCTCTTTGG - Intergenic
962665396 3:137649211-137649233 TAGTCTAACCTCAGGTTTTTGGG + Intergenic
964205441 3:154169838-154169860 TATTGTGACCAGAGGCTTGTAGG + Intronic
964627317 3:158772063-158772085 TACTCTTGCGTGAGGCTGTTTGG + Intronic
965125399 3:164621246-164621268 TACTGTGGCCTGGGACTTTTAGG + Intergenic
966457319 3:180132556-180132578 TACTCTGAAGTGATGCTTTCTGG + Intergenic
968988997 4:3896075-3896097 CATTCTGACCAGAGGCTCTTTGG + Intergenic
969019973 4:4133317-4133339 CATTCTGACCAGAGGCTCTTTGG + Intergenic
969056028 4:4403338-4403360 TGCTCTGTCCGGAGGCTCTTAGG + Intronic
969788727 4:9477385-9477407 CATTCTGACCAGAGGCTCTTTGG - Intergenic
969793466 4:9508153-9508175 CATTCTGACCAGAGGCTCTTTGG - Intergenic
969826354 4:9761518-9761540 CATTCTGACCAGAGGCTCTTGGG - Intergenic
971526065 4:27620645-27620667 TACTCTGACCAGAGACTTTTGGG + Intergenic
972276389 4:37561762-37561784 TATTGTGACCAGAGGCTTCTAGG - Intronic
974706643 4:65526285-65526307 TACTCTGTCTTGTTGCTTTTTGG - Intronic
976050105 4:81001568-81001590 TATTAAGAGCTGAGGCTTTTTGG - Intergenic
976075018 4:81288132-81288154 TACTTTTTCCTGAGGCCTTTGGG - Intergenic
978713469 4:111813651-111813673 GACTCAGACATGAAGCTTTTAGG - Intergenic
978821230 4:112968930-112968952 CACTCTGAACTGAGACTTTGGGG - Intronic
982949218 4:161668113-161668135 TACTCTGGTTTGAGGCTTATTGG - Intronic
989553793 5:42767494-42767516 TATTCTGACCTCTGGTTTTTAGG + Intronic
991290658 5:65031142-65031164 TTCTCTGACCTGGGGTTCTTGGG - Intergenic
994370560 5:98962651-98962673 TACTCTGAGCTGAAGCCTCTGGG + Intergenic
995330967 5:110945589-110945611 TTCTCTGTCCTGAGGCATTTGGG + Intergenic
996458432 5:123711968-123711990 TGCTATGAGCTGAGGCTTTGAGG - Intergenic
996672666 5:126136215-126136237 TATTTGGATCTGAGGCTTTTGGG + Intergenic
997412201 5:133698965-133698987 TGCTCTGACCTGTCGCTTATAGG + Intergenic
998023354 5:138790300-138790322 TCCTGTGACTTGAGGCATTTAGG + Intronic
1001143782 5:169166716-169166738 TACTCTCACCTGTGCTTTTTGGG - Intronic
1001839919 5:174866577-174866599 TACTCTAACCCGAGGCATTTTGG + Intergenic
1002510837 5:179715987-179716009 AAGTCTGACCTGAGGCTTTGGGG - Intronic
1004000828 6:11595365-11595387 TACTCTGCACTAAGACTTTTGGG + Intergenic
1004250183 6:14017232-14017254 TGCTCTGACCTGAGTCTGGTTGG + Intergenic
1005626466 6:27667140-27667162 TACTCTGTCCTGAGGCTTGTTGG - Intergenic
1006872032 6:37260105-37260127 TCCTATGACCAGAGGCTTGTGGG - Intronic
1012351176 6:98252534-98252556 TACACTGACTTGAGGCCCTTTGG + Intergenic
1013249447 6:108319904-108319926 TCCTCTGAAGTGAGGCTGTTGGG + Intronic
1015934819 6:138398308-138398330 TACTGTGACCAGAGGCTTACGGG + Intergenic
1017566247 6:155690739-155690761 TACAATGAACTGAGGCTTTTGGG + Intergenic
1020307380 7:6845352-6845374 CATTCTGACCAGAGGCTCTTTGG + Intergenic
1020614419 7:10440545-10440567 TATTTTGAGTTGAGGCTTTTGGG - Intergenic
1023672354 7:42591147-42591169 TTCTCTGACCTTATGCTTCTTGG - Intergenic
1023880811 7:44320303-44320325 TACTCTGACCTGAGGCTTTTGGG - Intronic
1028172491 7:87615234-87615256 TACTCTGTGTAGAGGCTTTTGGG - Intronic
1028998785 7:97130563-97130585 TGCTCTGGCCTGTGGCTCTTGGG + Intronic
1029733041 7:102450335-102450357 TACTCTGGCCTGAGTCTTTTGGG + Exonic
1032383012 7:131503655-131503677 TACTCTGTCCTGGGGCCTCTGGG - Intronic
1034057138 7:148047268-148047290 TACTGTGACCAGAGGCTTGCAGG - Intronic
1036820250 8:11934318-11934340 CATTCTGACCAGAGGCTTTTTGG + Intergenic
1036833670 8:12040930-12040952 CATTCTGACCAGAGGCTCTTTGG + Intergenic
1036855516 8:12287495-12287517 CATTCTGACCAGAGGCTCTTTGG + Intergenic
1037729426 8:21511493-21511515 CATTCTTACCTAAGGCTTTTAGG - Intergenic
1039059969 8:33565634-33565656 TCATTTCACCTGAGGCTTTTTGG - Intronic
1042784703 8:72535442-72535464 TACTTTGTACTGAGGGTTTTTGG - Intergenic
1045490677 8:102666614-102666636 TACTTGGACCTGGGGCCTTTTGG - Intergenic
1047076851 8:121413706-121413728 TACTCTGCCCTGTGAATTTTAGG - Intergenic
1048635336 8:136289275-136289297 TCCTCTAACCTGAAGGTTTTTGG - Intergenic
1048680293 8:136833645-136833667 TACTCTGAACAGAGGCTCTGAGG + Intergenic
1050165337 9:2759296-2759318 TACTTGGATCTGAGTCTTTTGGG - Intronic
1051487044 9:17620207-17620229 TACTCTGACCTGAATCTTACTGG + Intronic
1052744281 9:32424595-32424617 AACTTTGTCCTGAGGCCTTTTGG - Exonic
1056865489 9:90224715-90224737 CATTCTGACCAGAGGCTCTTTGG - Intergenic
1056917515 9:90758171-90758193 CATTCTGACCAGAGGCTCTTTGG + Intergenic
1057974378 9:99588777-99588799 TATTAAGACCTGGGGCTTTTGGG + Intergenic
1187761098 X:22586284-22586306 TTCTTTGGCTTGAGGCTTTTTGG + Intergenic
1190066232 X:47243502-47243524 TACTACGGCCTGATGCTTTTTGG + Exonic
1195167799 X:102237758-102237780 TGATCTGTCCTGAGACTTTTGGG + Intergenic
1195191058 X:102449329-102449351 TGATCTGTCCTGAGACTTTTGGG - Intronic
1196248393 X:113428529-113428551 TTCTCTCACCTGAGCCTTTCAGG + Intergenic
1196989170 X:121308910-121308932 TACTGTGATTTGAAGCTTTTGGG + Intergenic
1199205302 X:145141651-145141673 TATTGTGACCTAAGGATTTTTGG - Intergenic
1199602403 X:149549914-149549936 TACTCTGACTGAAGGCATTTTGG - Intronic
1199647985 X:149929561-149929583 TACTCTGACTGAAGGCATTTTGG + Intronic