ID: 1023880814

View in Genome Browser
Species Human (GRCh38)
Location 7:44320316-44320338
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 2, 1: 0, 2: 1, 3: 11, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023880808_1023880814 7 Left 1023880808 7:44320286-44320308 CCGGCCAAGGACAGGTGCCCAAA 0: 1
1: 0
2: 2
3: 8
4: 166
Right 1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG 0: 2
1: 0
2: 1
3: 11
4: 88
1023880811_1023880814 -10 Left 1023880811 7:44320303-44320325 CCCAAAAGCCTCAGGTCAGAGTA 0: 1
1: 0
2: 4
3: 10
4: 171
Right 1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG 0: 2
1: 0
2: 1
3: 11
4: 88
1023880809_1023880814 3 Left 1023880809 7:44320290-44320312 CCAAGGACAGGTGCCCAAAAGCC 0: 1
1: 0
2: 0
3: 19
4: 225
Right 1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG 0: 2
1: 0
2: 1
3: 11
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902233691 1:15044268-15044290 GGGCAGAGCAGAACACAAGCAGG + Intronic
905359988 1:37412579-37412601 GCTCAGAACAGAGCACAAGCCGG - Intergenic
909395493 1:75167034-75167056 TCTCAGATTAGAACACAAGCAGG - Intergenic
909634188 1:77796947-77796969 GGTCAGAGGTGACCACAAAGGGG - Intronic
910872270 1:91845663-91845685 GGTCAGGGTATACTACATGCAGG - Intronic
911870038 1:103085646-103085668 ATTCAGAGTAGACCATATGCTGG + Intronic
913609939 1:120501218-120501240 GGTCAGACTGCAGCACAAGCTGG - Intergenic
913984855 1:143555625-143555647 GGTCAGACTGCAGCACAAGCTGG + Intergenic
914203876 1:145509920-145509942 GGTCAGACTGCAGCACAAGCTGG + Intergenic
914482999 1:148083074-148083096 GGTCAGACTGAAGCACAAGCTGG + Intergenic
914581250 1:149021023-149021045 GGTCAGACTGCAGCACAAGCTGG + Exonic
917362647 1:174194082-174194104 GGTCAGTGTTGACCCCATGCTGG - Intronic
922188946 1:223300124-223300146 GGTCAGAGCAGACCAGGGGCAGG + Intronic
924027224 1:239847045-239847067 GGACAGAGTAGAACACCAGAAGG - Intronic
1067569566 10:47361434-47361456 GGCCAGAGTAGCCCCCAGGCCGG - Intergenic
1069686646 10:70323196-70323218 GGGCAGGTTAGACCACTAGCTGG + Intronic
1070154680 10:73826062-73826084 GGACAGAGTAGGCCACACACAGG + Intronic
1077713106 11:4555185-4555207 GGTCAGAGGAGACACTAAGCGGG + Intergenic
1079156096 11:17949354-17949376 GGTCAGTGTAAACAACAAGGAGG + Intronic
1080597229 11:33784162-33784184 GCTGAGAGTAGACCAAAAGTGGG - Intergenic
1080931690 11:36817947-36817969 GGTCAGAGAGGCCCACAGGCAGG + Intergenic
1081541553 11:44038278-44038300 GGACAGAGTAGCCCAGACGCTGG + Intergenic
1083923299 11:65791834-65791856 GGACAGAGAGCACCACAAGCAGG + Intronic
1083938624 11:65883262-65883284 GGACAGAGTGGTCCACAAGCTGG - Exonic
1089707151 11:120286937-120286959 AGCCACAGTGGACCACAAGCAGG + Intronic
1094336788 12:29366496-29366518 GGTCATAGTAGAATACAAACAGG + Intronic
1096944651 12:55391713-55391735 GCTCAGAGGAGACCAGCAGCAGG + Intergenic
1099874083 12:88382954-88382976 GGACAGAATAGACCCCAAGTAGG - Intergenic
1109242045 13:59901435-59901457 GGTAAGAGTTGAGCAGAAGCCGG - Intronic
1112287305 13:98115731-98115753 GGTCCGAGCAAACAACAAGCCGG + Intergenic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1120850203 14:89162887-89162909 GGTCAGCGGAGACCCCAAGGAGG - Exonic
1122539083 14:102486871-102486893 GGGAAGAATAGACCAGAAGCAGG + Intronic
1126386177 15:48095678-48095700 GCTCAGAGCAGACATCAAGCTGG - Intergenic
1128840500 15:70847014-70847036 GTTGAGAGTAGAACTCAAGCTGG + Intronic
1132692460 16:1187687-1187709 GGTCAGAGTGGCCCCCAAGCAGG - Intronic
1135738604 16:24954335-24954357 GGTCAGGGTGTACCACAATCAGG + Intronic
1139199122 16:64954777-64954799 GATCAGAGTGGATCACAAGAAGG - Intronic
1140126121 16:72120281-72120303 GGTCTGAGTGGACCAGGAGCTGG + Intronic
1141097075 16:81170534-81170556 GGTCAGAGAAGACCCCCAGAAGG + Intergenic
1142133647 16:88442078-88442100 GGTCAGAGTAGACCCCTGACTGG + Intergenic
1151480688 17:74368662-74368684 GACCAGAGCAGCCCACAAGCAGG - Intronic
1160413110 18:78688220-78688242 GGACAGAGAATACCACATGCTGG - Intergenic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1161666724 19:5581638-5581660 GGTCAGAGGAGACCTCTTGCAGG + Intergenic
1163594053 19:18210736-18210758 GGTCAGAGTGGACCCCAGCCAGG + Exonic
1165175640 19:33927802-33927824 GGTGAGAATAAACCACCAGCAGG - Intergenic
1165610689 19:37149737-37149759 GATCTCAGGAGACCACAAGCTGG - Exonic
1165874378 19:38995518-38995540 TGTCAGAATAGACCACCTGCAGG + Intronic
1167667787 19:50832790-50832812 GGTCAGAGAAGGCCTCAAGGAGG - Intronic
930024041 2:47019548-47019570 GGTCAGAGTGGATCACAAGTTGG + Intronic
933518083 2:83331481-83331503 GGACAGAGCAGAACAAAAGCTGG - Intergenic
933727218 2:85433787-85433809 GGTCAGCCTGGACCACAGGCAGG - Intronic
942334890 2:174872816-174872838 GATCAGAGTAGTCCCCAACCAGG - Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
946547128 2:220756456-220756478 GGTCAGAGCACACCCCATGCGGG + Intergenic
947240690 2:227991116-227991138 GGTCAAAGTTGATCACCAGCAGG + Exonic
1173866542 20:46316172-46316194 GGTCAGATGAGATGACAAGCAGG + Intergenic
1174197682 20:48785279-48785301 TGTCAGAGGAGACCCCAGGCAGG - Intronic
954731142 3:52663275-52663297 GGTCAGGGTCTACCAGAAGCTGG + Intronic
955508794 3:59658712-59658734 GGTACCAGTAGACCACCAGCTGG - Intergenic
955791352 3:62591601-62591623 GTTCAGATTTTACCACAAGCAGG + Intronic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
963780113 3:149478695-149478717 GGCCAGGGTCGACCACATGCTGG + Intronic
981005002 4:139865772-139865794 GGTCAGAGGAGGACCCAAGCAGG - Intronic
984148940 4:176101549-176101571 GGTAAAAGTAGACAACATGCAGG + Intronic
986866156 5:11990202-11990224 GGCCTGACTAGACCATAAGCTGG + Intergenic
989139404 5:38188527-38188549 GGTCAGAGTAGAACACAGGCTGG - Intergenic
989267909 5:39499029-39499051 TGTAAGAGTAGAGCACAGGCAGG + Intergenic
991234781 5:64380858-64380880 GGGCAGAGAAGATCACAAGAAGG + Intergenic
994082144 5:95718867-95718889 GGTCCCAGGAGAGCACAAGCAGG + Intronic
994390288 5:99184296-99184318 GATCAGAGAAGAACAGAAGCAGG + Intergenic
995990639 5:118234651-118234673 AGTCAGATTATAACACAAGCAGG + Intergenic
997878643 5:137570871-137570893 GGTCAGAAAAGACCACCTGCAGG + Intronic
998410200 5:141904212-141904234 GGGAAGAGTAGACCAGAAGGAGG + Intergenic
999758719 5:154683846-154683868 GATCAGAGTAGACCTCAAATGGG + Intergenic
1001337833 5:170815160-170815182 GATTACAGTAGACCTCAAGCTGG + Intergenic
1002290089 5:178194469-178194491 GGTCTGATTAGACCAAAGGCTGG + Intergenic
1004276144 6:14236629-14236651 GGTCAGAGCAGGAAACAAGCAGG + Intergenic
1007398983 6:41593072-41593094 GGTCAAAGTGGACCTCAAGCTGG - Intronic
1007908035 6:45483857-45483879 AGTGTGAGTAGAGCACAAGCTGG + Intronic
1011553703 6:88552669-88552691 GGTCAGAGAAGACGTCAAGCAGG - Intergenic
1018690072 6:166337503-166337525 CGGCAGAGGAGACCCCAAGCAGG - Intronic
1018908925 6:168090834-168090856 GGACAGAGTAGCCCCCAAGAGGG - Intergenic
1019056181 6:169225160-169225182 GGTCTGGGTTGAACACAAGCCGG + Exonic
1019200132 6:170307134-170307156 GGTCAGAGGTGACCTCAAGATGG - Intronic
1021090268 7:16474625-16474647 GGTTATATTAGAACACAAGCAGG + Intronic
1021894759 7:25223362-25223384 GGTCTTAGCAAACCACAAGCAGG - Intergenic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1029468309 7:100739982-100740004 GGTCAGAGTAGGTCACATTCAGG + Intronic
1030977772 7:116148164-116148186 GGTCAGAGTATTCCAGAAACAGG + Intronic
1035549226 8:507386-507408 GGTCAGAGTAAATATCAAGCAGG + Intronic
1036768534 8:11563877-11563899 CGGCAGAGGAGACCGCAAGCGGG - Intronic
1037590597 8:20308849-20308871 GGGCAGTGTTGACCACAAGCAGG + Intergenic
1053282188 9:36827662-36827684 GATCAGAGTAGACCAAGAGCAGG + Intergenic
1055155083 9:73052924-73052946 TGACAGAGTTGACCATAAGCAGG - Intronic
1055709010 9:79038140-79038162 AGTCAGAGTAGACCACCAGATGG + Intergenic
1061698066 9:132392968-132392990 TGTCAGAGTAAAACACATGCTGG - Intronic
1062039320 9:134396836-134396858 GGTCTGAGCAGGCCACAGGCTGG - Intronic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1187058363 X:15762334-15762356 TGTCAGAGTAAACCAGAGGCAGG + Intronic