ID: 1023883474

View in Genome Browser
Species Human (GRCh38)
Location 7:44334856-44334878
Sequence AGGGAGCGTCCAGCAACCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023883474_1023883489 25 Left 1023883474 7:44334856-44334878 CCCTCGGTTGCTGGACGCTCCCT No data
Right 1023883489 7:44334904-44334926 GCAAAGCCAGTGGATGGAGGAGG No data
1023883474_1023883485 19 Left 1023883474 7:44334856-44334878 CCCTCGGTTGCTGGACGCTCCCT No data
Right 1023883485 7:44334898-44334920 ACCCTGGCAAAGCCAGTGGATGG No data
1023883474_1023883491 27 Left 1023883474 7:44334856-44334878 CCCTCGGTTGCTGGACGCTCCCT No data
Right 1023883491 7:44334906-44334928 AAAGCCAGTGGATGGAGGAGGGG No data
1023883474_1023883478 -6 Left 1023883474 7:44334856-44334878 CCCTCGGTTGCTGGACGCTCCCT No data
Right 1023883478 7:44334873-44334895 CTCCCTTGGTCCTGGAGTCCTGG No data
1023883474_1023883481 3 Left 1023883474 7:44334856-44334878 CCCTCGGTTGCTGGACGCTCCCT No data
Right 1023883481 7:44334882-44334904 TCCTGGAGTCCTGGTAACCCTGG No data
1023883474_1023883488 22 Left 1023883474 7:44334856-44334878 CCCTCGGTTGCTGGACGCTCCCT No data
Right 1023883488 7:44334901-44334923 CTGGCAAAGCCAGTGGATGGAGG No data
1023883474_1023883484 15 Left 1023883474 7:44334856-44334878 CCCTCGGTTGCTGGACGCTCCCT No data
Right 1023883484 7:44334894-44334916 GGTAACCCTGGCAAAGCCAGTGG No data
1023883474_1023883490 26 Left 1023883474 7:44334856-44334878 CCCTCGGTTGCTGGACGCTCCCT No data
Right 1023883490 7:44334905-44334927 CAAAGCCAGTGGATGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023883474 Original CRISPR AGGGAGCGTCCAGCAACCGA GGG (reversed) Intergenic
No off target data available for this crispr