ID: 1023884627

View in Genome Browser
Species Human (GRCh38)
Location 7:44344560-44344582
Sequence GATACTCAGTAACCCCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023884627_1023884629 -10 Left 1023884627 7:44344560-44344582 CCTGCTTGGGGTTACTGAGTATC No data
Right 1023884629 7:44344573-44344595 ACTGAGTATCTTGAGTTTGTGGG No data
1023884627_1023884630 -3 Left 1023884627 7:44344560-44344582 CCTGCTTGGGGTTACTGAGTATC No data
Right 1023884630 7:44344580-44344602 ATCTTGAGTTTGTGGGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023884627 Original CRISPR GATACTCAGTAACCCCAAGC AGG (reversed) Intergenic
No off target data available for this crispr