ID: 1023885160

View in Genome Browser
Species Human (GRCh38)
Location 7:44349054-44349076
Sequence TGAACACCCTTATGTCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023885160_1023885169 17 Left 1023885160 7:44349054-44349076 CCCCAGAGACATAAGGGTGTTCA No data
Right 1023885169 7:44349094-44349116 AGCCCACCTCAGCCAGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023885160 Original CRISPR TGAACACCCTTATGTCTCTG GGG (reversed) Intergenic
No off target data available for this crispr