ID: 1023885163

View in Genome Browser
Species Human (GRCh38)
Location 7:44349077-44349099
Sequence TGGGCTGGGGCAGGGTGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023885163_1023885169 -6 Left 1023885163 7:44349077-44349099 CCATGTCACCCTGCCCCAGCCCA No data
Right 1023885169 7:44349094-44349116 AGCCCACCTCAGCCAGTTCCTGG No data
1023885163_1023885174 9 Left 1023885163 7:44349077-44349099 CCATGTCACCCTGCCCCAGCCCA No data
Right 1023885174 7:44349109-44349131 GTTCCTGGTCCCTCCCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023885163 Original CRISPR TGGGCTGGGGCAGGGTGACA TGG (reversed) Intergenic
No off target data available for this crispr