ID: 1023885168

View in Genome Browser
Species Human (GRCh38)
Location 7:44349092-44349114
Sequence AGGAACTGGCTGAGGTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023885168_1023885174 -6 Left 1023885168 7:44349092-44349114 CCAGCCCACCTCAGCCAGTTCCT No data
Right 1023885174 7:44349109-44349131 GTTCCTGGTCCCTCCCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023885168 Original CRISPR AGGAACTGGCTGAGGTGGGC TGG (reversed) Intergenic
No off target data available for this crispr