ID: 1023885169

View in Genome Browser
Species Human (GRCh38)
Location 7:44349094-44349116
Sequence AGCCCACCTCAGCCAGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023885160_1023885169 17 Left 1023885160 7:44349054-44349076 CCCCAGAGACATAAGGGTGTTCA No data
Right 1023885169 7:44349094-44349116 AGCCCACCTCAGCCAGTTCCTGG No data
1023885162_1023885169 15 Left 1023885162 7:44349056-44349078 CCAGAGACATAAGGGTGTTCACC No data
Right 1023885169 7:44349094-44349116 AGCCCACCTCAGCCAGTTCCTGG No data
1023885163_1023885169 -6 Left 1023885163 7:44349077-44349099 CCATGTCACCCTGCCCCAGCCCA No data
Right 1023885169 7:44349094-44349116 AGCCCACCTCAGCCAGTTCCTGG No data
1023885161_1023885169 16 Left 1023885161 7:44349055-44349077 CCCAGAGACATAAGGGTGTTCAC No data
Right 1023885169 7:44349094-44349116 AGCCCACCTCAGCCAGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023885169 Original CRISPR AGCCCACCTCAGCCAGTTCC TGG Intergenic
No off target data available for this crispr