ID: 1023885170

View in Genome Browser
Species Human (GRCh38)
Location 7:44349096-44349118
Sequence GACCAGGAACTGGCTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023885170_1023885174 -10 Left 1023885170 7:44349096-44349118 CCCACCTCAGCCAGTTCCTGGTC No data
Right 1023885174 7:44349109-44349131 GTTCCTGGTCCCTCCCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023885170 Original CRISPR GACCAGGAACTGGCTGAGGT GGG (reversed) Intergenic
No off target data available for this crispr