ID: 1023885174

View in Genome Browser
Species Human (GRCh38)
Location 7:44349109-44349131
Sequence GTTCCTGGTCCCTCCCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023885163_1023885174 9 Left 1023885163 7:44349077-44349099 CCATGTCACCCTGCCCCAGCCCA No data
Right 1023885174 7:44349109-44349131 GTTCCTGGTCCCTCCCCAGAAGG No data
1023885166_1023885174 -4 Left 1023885166 7:44349090-44349112 CCCCAGCCCACCTCAGCCAGTTC No data
Right 1023885174 7:44349109-44349131 GTTCCTGGTCCCTCCCCAGAAGG No data
1023885167_1023885174 -5 Left 1023885167 7:44349091-44349113 CCCAGCCCACCTCAGCCAGTTCC No data
Right 1023885174 7:44349109-44349131 GTTCCTGGTCCCTCCCCAGAAGG No data
1023885164_1023885174 1 Left 1023885164 7:44349085-44349107 CCCTGCCCCAGCCCACCTCAGCC No data
Right 1023885174 7:44349109-44349131 GTTCCTGGTCCCTCCCCAGAAGG No data
1023885165_1023885174 0 Left 1023885165 7:44349086-44349108 CCTGCCCCAGCCCACCTCAGCCA No data
Right 1023885174 7:44349109-44349131 GTTCCTGGTCCCTCCCCAGAAGG No data
1023885170_1023885174 -10 Left 1023885170 7:44349096-44349118 CCCACCTCAGCCAGTTCCTGGTC No data
Right 1023885174 7:44349109-44349131 GTTCCTGGTCCCTCCCCAGAAGG No data
1023885168_1023885174 -6 Left 1023885168 7:44349092-44349114 CCAGCCCACCTCAGCCAGTTCCT No data
Right 1023885174 7:44349109-44349131 GTTCCTGGTCCCTCCCCAGAAGG No data
1023885162_1023885174 30 Left 1023885162 7:44349056-44349078 CCAGAGACATAAGGGTGTTCACC No data
Right 1023885174 7:44349109-44349131 GTTCCTGGTCCCTCCCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023885174 Original CRISPR GTTCCTGGTCCCTCCCCAGA AGG Intergenic
No off target data available for this crispr